Treating Higher-Risk MDS. Case presentation. Defining higher risk MDS. IPSS WHO IPSS: WPSS MD Anderson PSS
|
|
- Frederick Franklin
- 6 years ago
- Views:
Transcription
1 Treating Higher-Risk MDS Eyal Attar, M.D. Massachusetts General Hospital Cancer Center Case presentation 72 year old man, prior acoustic neuroma WBC (X10 3 /ul) 11/08 12/08 3/09 7/09 2/10 Rx 4/10 8/10 10/10 12/ HCT (%) Plts (K) Dysplasia My, My, E, Blasts (%) Defining higher risk MDS IPSS WHO IPSS: WPSS MD Anderson PSS 1
2 International Prognosis Scoring System (IPSS) Score Score % BM blasts < Karyotype Good (NL, Y-, 5q-, 20q-) Intermediat e (all others) Poor (complex, Chr 7) - - Cytopenias 0/1 2/ RBC HgB < 10 WBC ANC<1800 Plt <100K Greenberg, et. al, Blood, 1997; 9:2079 Score Overall Median Survival, years IPSS Time to 25% of patients tx to AML, years Low Int Int High Greenberg, et. al, Blood, 1997; 9:2079 WPSS (Dynamic) Very low: 0 Low: 1 Int: 2 High: 3-4 Very high: 5-6 Malcovati L, et al., J Clin Oncol.,
3 MD Anderson Prognostic Scoring System Risk category Score % patients Median survival (Months) % alive at 3 years % alive at 6 years Low Int Int High Performance status, Age, Platelet count, Hemoglobin, Bone marrow blast %, WBC >20 x 109/L, Karyotype chromosome 7 abnormality or complex 3 abnormalities, Prior transfusion Kantarjian H, et al., Cancer, 2008 Why do we care about low vs high risk? Risk QoL Transfusions, clinic visit, hospitalizations, infections Longevity What s my doctor thinking? How strong is this person? How much treatment can they REALLY take? How much chemotherapy do they really want? What s driving them to live? What kind of supports do they have in place? 3
4 What s my doctor thinking? Has the person been treated with chemotherapy or radiation in the past? What are the kinetics of the disease? How fast is it coming on? How far do they live from a treatment center and how motivated are they to come for treatment? What s my doctor thinking? How many blasts are in the marrow? What are the cytogenetics? How well does this person understand the treatment options I m presenting? Is it the right time to discuss end of life issues? Treatment Goals Control symptoms due to cytopenias Improve QoL, minimize therapy-related toxicities Improve overall survival Prevent/delay progression to AML 4
5 MDS Treatment Options FDA-approved medications azacitidine (Vidaza) lenalidomide (Revlimid) decitabine (Dacogen) Clinical Trial Allogeneic stem cell transplantation MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Most patients Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Few patients Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy 5
6 MDS: Treatment Approach at MGH IPSS Low and Int-1 Int-2 and High or therapy-related 5q - deletion with or without other cytogenetic alterations? Some patients Intensive therapy candidate? Lenalidomide Serum EPO 500 mu/ml? Donor available? Epo ± GCSF ATG ± cyclosporine (HLA DR 15+) Lenalidomide Allogeneic stem cell transplantation Intensive therapy MDS: Supportive Care Erythroid growth factors Epoetin alfa (Procrit) 40, ,000 units SC q week Darbepoetin alfa (Aranesp) 200 ug SC q 1-2 weeks Myeloid growth factors Filgrastim (Neupogen) 300 ug SC q week q day Blood products RBCs (with consideration of Fe-chelation therapy) Plts Antibiotics Is a stem cell transplant possible? Even a small chance?, possibly Goals Maintain or increase QoL Prolong life Cytoreduce Blasts, definitely Transplant High: cytoreduce Low: get me to transplant! 6
7 Is a stem cell transplant possible? Even a small chance? What might treatment look like? A A B C D, possibly A, low dose Transplant A, high dose Transplant A, low B, high Transplant, definitely Arrange transplant Transplant A, low dose Transplant A, high dose Transplant A, low B, high Transplant Therapies for High-Risk MDS Hypomethylating agents azacitidine, decitabine IMIDs lenalidomide, thalidomide Induction chemotherapy cytarabine, anthracycline (idarubicin, daunorubicin) s Allogeneic stem cell transplantation Hypomethylating agents Why do we think they work? DNA is overmethylated in MDS and AML Before chemotherapy Me Me Gene transcription blocked AAGTCGCGCGATGCATGGCT tumor suppressor gene, cell cycle arrest gene After chemotherapy Me Me Gene transcription back on AAGTCGDGVGATGCATGGCT tumor suppressor gene, cell cycle arrest gene 7
8 SC Hypomethylating agents: How are they given? VVVVVVV every 4 weeks IV VVVVV every 4 weeks IV IV D 8 D 8 D 8 DDDDD every 6 weeks every 4 weeks Hypomethylating agents Goals prolong survival delay development of AML How do we know if they work? QoL improves Less transfusions Blasts decrease Survival Study Screening/Central Pathology Review Investigator CCR Tx Selection Randomization BSC was included with each arm AZA 75 mg/m 2 /d x 7 d q28 d CCR Best Supportive Care (BSC) only Low Dose Ara-C (LDAC, 20 mg/m 2 /d x 14 d q28-42 d) Std Chemo (7 + 3) Fenaux P, et al., Lancet Oncol.,
9 Proportion Surviving Parameter Age (yrs) Median Pts 65 (%) FAB (%) IPSS (%) Baseline Clinical Characteristics N = 358 RAEB RAEB-T CMML INT-1 INT-2 High AZA N= CCR N= BSC Only N= CCR Regimens LDAC N= Std Chemo N= Overall Survival: vs CCR ITT Population 15 months Log-Rank p= HR = 0.58 [95% CI: 0.43, 0.77] Deaths: AZA = 82, CCR = 113 Difference: 9.4 months 50.8% 24.4 months 26.2% Time (months) from Randomization AZA CCR Comparison of BSC vs decitabine 233 patients years old, median age 70 Ineligible for intensive therapy 15 mg/m2 every 8 hours for 3 every 6 weeks OS prolongation with decitabine versus BSC was not statistically significant (median OS, 10.1 v 8.5 months, P =.38) Progression-free survival (PFS), but not acute myeloid leukemia (AML) -free survival (AMLFS), was significantly prolonged with decitabine versus BSC (median PFS, 6.6 v 3.0 months; P =.004; median AMLFS, 8.8 v 6.1 months, respectively; P =.24). AML transformation was significantly (P =.036) reduced at 1 year (from 33% with BSC to 22% with decitabine). CONCLUSION resulted in improvements of OS and AMLFS (nonsignificant), of PFS and AML transformation (significant), and of QOL. Lubbert M, et al., J Clin Oncol.,
10 Comparison of BSC vs decitabine Lubbert M, et al., J Clin Oncol., 2011 Intensive chemotherapy IVB IVCI AAA CCCCCCC wait 2 weeks Repeat if necessary A=anthracycline, C=cytarabine Limitations Low remission rate high morbidity/mortality 4-6 week hospitalization Autologous Transplant: Own Stem Cells Neupogen Freeze Wait 1-2 weeks Defrost and infuse stem cells Chemotherapy +/- radiation Recovery, 3-4 weeks 10
11 Allogeneic Transplant: Another Person s Stem Cells Neupogen Donor Donor and patient treatments occur simultaneously Infuse fresh stem cells Chemotherapy +/- radiation Recovery, 3-4 weeks Full Allogeneic Transplant: Mini vs. Full High-dose chemotherapy +/- radiation Recovery, 3-4 weeks Eradicate malignancy converts to donor blood type Intense High treatmentrelated mortality rate Graft-versushost disease Mini Low-dose chemotherapy Recovery, 3-4 weeks Create space for donor blood: chimerism Safer Graft-versushost disease Mini-Transplants: Chimerism Copeland E., NEJM, 2006,
12 Gain/Loss of Discounted Life Expectancy Overall Survival (%) Overall Survival (%) Allogeneic Stem Cell Transplant in s With MDS Allogeneic SCT is the only potentially curative therapy for MDS Up to 50% long term survival rate Allogeneic SCT appropriate for <5-10% of MDS patients Adequate performance status Appropriately matched donor Morbidity and mortality increases with age n-myeloablative SCT for older patients Deeg HJ et al. Blood. 2000;95:1188 Cutler CS et al. Blood. 2004;104:579 Survival by IPSS Risk in s Who Did or Did t Undergo Transplantation Transplant 50 Low 25 0 High Int-2 Int Months Low Int-1 High Int-2 Transplant Months Cutler CS et al. Blood. 2004;104:579 Effect of Delaying Transplantation by IPSS Risk Low Int-1 Years of Delay High Int-2 Cutler CS et al. Blood. 2004;104:579 12
13 Clinical Trials studies 462 studies recruiting What to use after azacitidine Plts stimulation GST inhibition CXCR4 modulation Combination therapies WBC (X10 3 /ul) More genetically complex than we realize 11/08 12/08 3/09 7/09 2/10 Rx 4/10 8/10 10/10 12/ HCT (%) Plts (K) Dysplasia My, My, E, Blasts (%) Cytogenetics NL NL NL NL NL NL NL Mutations Conclusions Higher risk disease defined by increased blasts adverse cytogenetics lower blood counts Treatments hypomethylating agents intensive chemotherapy allogeneic SCT clinical trials 13
MDS FDA-approved Drugs
MDS: Current Thinking on the Disease, Diagnosis, and Treatment Mikkael A. Sekeres, MD, MS Associate Professor of Medicine Director, Leukemia Program Dept of Hematologic Oncology and Blood Disorders Taussig
More informationAML IN OLDER PATIENTS Whenever possible, intensive induction therapy should be considered
AML IN OLDER PATIENTS Whenever possible, intensive induction therapy should be considered Charles A. Schiffer, M.D. Karmanos Cancer Institute Wayne State University School of Medicine Detroit, MI WHY ARE
More informationMyelodysplastic syndrome. Jeanne Palmer, MD Mayo Clinic, Arizona
Myelodysplastic syndrome Jeanne Palmer, MD Mayo Clinic, Arizona What is Myelodysplastic syndrome? A disease where the bone marrow doesn t work appropriately What does that mean?? Red blood cells Carry
More informationManagement of low and high risk MDS
Management of low and high risk MDS D.Selleslag AZ Sint-Jan Brugge, Belgium Brussels, 4th October 2014 Low / int 1 risk MDS Improve QOL Improve cytopenia Int 2 / high risk MDS Delay progression To AML
More informationDr Kavita Raj Consultant Haematologist Guys and St Thomas Hospital
Dr Kavita Raj Consultant Haematologist Guys and St Thomas Hospital IPSS scoring system Blood counts Bone marrow blast percentage Cytogenetics Age as a modulator of median survival IPSS Group Median Survival
More informationOutline. Case Study 5/17/2010. Treating Lower-Risk Myelodysplastic Syndrome (MDS) Tapan M. Kadia, MD Department of Leukemia MD Anderson Cancer Center
Treating Lower-Risk Myelodysplastic Syndrome (MDS) Tapan M. Kadia, MD Department of Leukemia MD Anderson Cancer Center Outline Case Study What is lower-risk MDS? Classification systems Prognosis Treatment
More informationNon-transplant Therapy for MDS. Bart Scott, MD Associate Member, FHCRC Associate Professor, UWMC
Non-transplant Therapy for MDS Bart Scott, MD Associate Member, FHCRC Associate Professor, UWMC MDS Treatment Algorithm Asymptomatic Symptomatic Bone Marrow Function Low/Int-1 Int-2/High Observation Cytokine
More informationLet s Look at Our Blood
Let s Look at Our Blood Casey O Connell, MD Associate Professor of Clinical Medicine Jane Anne Nohl Division of Hematology Keck School of Medicine of USC 10,000,000,000 WBCs/day Bone Marrow: The Blood
More informationAML in elderly. D.Selleslag AZ Sint-Jan Brugge, Belgium 14 December 2013
AML in elderly D.Selleslag AZ Sint-Jan Brugge, Belgium 14 December 2013 AML is predominantly a disease of the elderly incidence 2 3/100.000 SEER Cancer Statistics, National Cancer Institute, USA 2002 2006
More informationUnderstanding & Treating Myelodysplastic Syndrome (MDS)
Understanding & Treating Myelodysplastic Syndrome (MDS) Casey O Connell, MD Associate Professor of Clinical Medicine Jane Anne Nohl Division of Hematology Keck School of Medicine of USC Let s Look at Our
More informationEmerging Treatment Options for Myelodysplastic Syndromes
Emerging Treatment Options for Myelodysplastic Syndromes James K. Mangan, MD, PhD Assistant Professor of Clinical Medicine Abramson Cancer Center, University of Pennsylvania Please note that some of the
More informationMyelodysplastic Syndromes (MDS) Diagnosis, Treatments & Support
Myelodysplastic Syndromes (MDS) Diagnosis, Treatments & Support LLS Mission & Goals Our mission. Cure leukemia, lymphoma, Hodgkin s disease and myeloma, and improve the quality of life of patients and
More informationMyelodysplastic Syndromes: Update in Diagnosis and Therapy. Peter Valent
Myelodysplastic Syndromes: Update in Diagnosis and Therapy Peter Valent MDS: Typical Features - Dysplasia in one or more Cell Lineages in the BM - Peripheral Cytopenia (unilineage, bi-, or pan-cp) - Quality
More informationLow Risk MDS Scoring System. Prognosis in Low Risk MDS. LR-PSS Validation 9/19/2012
Advances in MDS What s on the Horizon Tapan M. Kadia, MD Department of Leukemia MD Anderson Cancer Center Outline Newer Prognostic Systems Hypomethylating agent failures Newer Treatment approaches Role
More informationScottish Medicines Consortium
Scottish Medicines Consortium azacitidine 100mg powder for suspension for injection (Vidaza ) No. (589/09) Celgene Ltd 05 March 2010 The Scottish Medicines Consortium (SMC) has completed its assessment
More informationMyelodyplastic Syndromes Paul J. Shami, M.D.
Myelodyplastic Syndromes Paul J. Shami, M.D. Professor of Hematology, University of Utah Member, Huntsman Cancer Institute Objectives Define Myelodysplastic Syndromes (MDS) Explain how MDS are diagnosed
More informationMDS overview 전남대학교김여경
MDS overview 전남대학교김여경 2008 WHO Classification of MDS Name Abbreviation Key Feature Pts, % Refractory cytopenia, with unlineage, dysplasia Refractory anemia with ring sideroblasts RA Anemia and erythroid
More informationAllogeneic Hematopoietic Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Neoplasms
Allogeneic Hematopoietic Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Neoplasms Policy Number: 8.01.21 Last Review: 1/2019 Origination: 12/2001 Next Review: 1/2020 Policy Blue
More informationMyelodysplastic Syndrome
Myelodysplastic Syndrome A Family-Oriented Approach on Diagnosis and Treatment Options Cecilia Arana Yi, MD Assistant Professor MDS Patient & Family/Caregiver Forum March 3, 2018 Quote of the Day There
More informationMYELODYSPLASTIC SYNDROME. Vivienne Fairley Clinical Nurse Specialist Sheffield
MYELODYSPLASTIC SYNDROME Vivienne Fairley Clinical Nurse Specialist Sheffield MDS INCIDENCE 1/100,000/YEAR 3,250/YEAR MEDIAN AGE 70 MDS HYPO OR HYPERCELLULAR BONE MARROW BLOOD CYTOPENIAS (EARLY STAGES
More information7/24/2017. MDS: Understanding Your Diagnosis and Current and Emerging Treatments. Hematopoiesis = Blood Cell Production
: Understanding Your Diagnosis and Current and Emerging Treatments Erica Warlick, MD Associate Professor of Medicine Division of Hematology, Oncology, and Transplantation University of MN Objectives Overview
More informationTrends in Hematopoietic Cell Transplantation. AAMAC Patient Education Day Oct 2014
Trends in Hematopoietic Cell Transplantation AAMAC Patient Education Day Oct 2014 Objectives Review the principles behind allogeneic stem cell transplantation Outline the process of transplant, some of
More informationShould lower-risk myelodysplastic syndrome patients be transplanted upfront? YES Ibrahim Yakoub-Agha France
Should lower-risk myelodysplastic syndrome patients be transplanted upfront? YES Ibrahim Yakoub-Agha France Myelodysplastic syndromes (MDS) are heterogeneous disorders that range from conditions with a
More informationMyelodysplastic Syndromes: Understanding your diagnosis and current and emerging treatments
Myelodysplastic Syndromes: Understanding your diagnosis and current and emerging treatments Shyamala Navada, M.D., MSCR Assistant Professor Icahn School of Medicine at Mount Sinai Tisch Cancer Institute
More informationEmerging Treatment Options for Myelodysplastic Syndromes
Emerging Treatment Options for Myelodysplastic Syndromes James K. Mangan, MD, PhD Assistant Professor of Clinical Medicine Abramson Cancer Center, University of Pennsylvania Please note that some of the
More informationEnhancing Survival Outcomes in the Management of Patients With Higher-Risk Myelodysplastic Syndromes
The classification, diagnosis, treatment goals, clinical experience, guidelines, and therapeutic options for higher-risk MDS patients are reviewed. Anne Silber. Ha Long Bay, Vietnam (detail). Limited edition
More informationCREDIT DESIGNATION STATEMENT
CME Information LEARNING OBJECTIVES Recall the dose-limiting toxicity and preliminary clinical response results with 14- and 21-day extended treatment schedules of daily oral azacitidine. Apply new research
More informationMDS-004 Study: REVLIMID (lenalidomide) versus Placebo in Myelodysplastic Syndromes with Deletion (5q) Abnormality
MDS-4 Study: REVLIMID (lenalidomide) versus Placebo in Myelodysplastic Syndromes with Deletion (5q) Abnormality TABLE OF CONTENTS Section 1. Executive Summary Section 2. Background Section
More informationTreatment of Low-Blast Count AML. Maria Teresa Voso Dipartimento di Biomedicina e Prevenzione Università di Roma Tor Vergata
Treatment of Low-Blast Count AML Maria Teresa Voso Dipartimento di Biomedicina e Prevenzione Università di Roma Tor Vergata Definition of Low-Blast Count AML Blast counts 20-30%, or > 10%? v Retrospective
More informationLAM 20-30% Cristina Papayannidis, MD, PhD DIMES, Istituto di Ematologia L. e A. Seràgnoli Università di Bologna
LAM 20-30% Cristina Papayannidis, MD, PhD DIMES, Istituto di Ematologia L. e A. Seràgnoli Università di Bologna FAB CLASSIFICATION OF MYELODYSPLASTIC SYNDROME Subtype % Blood Myeloblasts Bone Marrow Myeloblasts
More informationEmerging Treatment Options for Myelodysplastic Syndromes
Emerging Treatment Options for Myelodysplastic Syndromes James K. Mangan, MD, PhD Assistant Professor of Clinical Medicine Abramson Cancer Center, University of Pennsylvania Please note that some of the
More informationWelcome and Introductions
MDS: Update on Treatment and Side Effects Management Azra Raza, MD Professor of Medicine Director, MDS Center Columbia University Medical Center Milstein Hospital Building New York, NY Antonietta de los
More informationN Engl J Med Volume 373(12): September 17, 2015
Review Article Acute Myeloid Leukemia Hartmut Döhner, M.D., Daniel J. Weisdorf, M.D., and Clara D. Bloomfield, M.D. N Engl J Med Volume 373(12):1136-1152 September 17, 2015 Acute Myeloid Leukemia Most
More informationAcute Myeloid Leukemia
Acute Myeloid Leukemia Pimjai Niparuck Division of Hematology, Department of Medicine Ramathibodi Hospital, Mahidol University Outline Molecular biology Chemotherapy and Hypomethylating agent Novel Therapy
More informationAcute myeloid leukemia: prognosis and treatment. Dimitri A. Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Campus Stuivenberg
Acute myeloid leukemia: prognosis and treatment Dimitri A. Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Campus Stuivenberg Patient Female, 39 years History: hypothyroidism Present:
More informationRefining Prognosis. Overview. Low Blood Counts. Low Blood Counts. High Risk MDS and Novel Therapy: What s on the Horizon? 3/2/2016
High Risk MDS and Novel Therapy: What s on the Horizon? Rafael Bejar MD, PhD Aplastic Anemia & MDS International Foundation Regional Patient and Family Conference March 19 th, 216 Overview Refining Prognosis
More informationManagement of Multiple Myeloma: The Changing Paradigm
Management of Multiple Myeloma: The Changing Paradigm High-Dose Chemotherapy and Stem Cell Transplantation Todd Zimmerman, MD University of Chicago Medical Center Case Presentation R.M. is a 64 year old
More informationMDS - Diagnosis and Treatments. Dr Helen Enright, Adelaide and Meath Hospital Dr Catherine Flynn, St James Hospital
MDS - Diagnosis and Treatments Dr Helen Enright, Adelaide and Meath Hospital Dr Catherine Flynn, St James Hospital Overview What is myelodysplasia? Symptoms Diagnosis and prognosis Myelodysplasia therapy
More informationMyelodysplastic Syndromes
Myelodysplastic Syndromes Jennifer Rogers MS, FNP Cancer Center of the Carolinas Greenville, SC The Myelodysplastic Syndromes Overview Clonal disorder characterized by hypercellular marrows, peripheral
More informationLa lenalidomide: meccanismo d azione e risultati terapeutici. F. Ferrara
La lenalidomide: meccanismo d azione e risultati terapeutici F. Ferrara MDS: new treatment goals Emerging treatment options expected to facilitate shift from supportive care to active therapy in MDS New
More informationNational Horizon Scanning Centre. Decitabine (Dacogen) for myelodysplastic syndrome. April 2008
Decitabine (Dacogen) for myelodysplastic syndrome April 2008 This technology summary is based on information available at the time of research and a limited literature search. It is not intended to be
More informationMyelodysplastic syndromes post ASH Dominik Selleslag AZ Sint-Jan Brugge
Myelodysplastic syndromes post ASH 2016 Dominik Selleslag AZ Sint-Jan Brugge Why did they put MDS at the end of the meeting? Possible explanations Least fascinating disease without progress? Poor speaker?
More informationMyelodysplastic Syndromes without Deletion 5q Cytogenetic Abnormality and REVLIMID (lenalidomide)
Myelodysplastic Syndromes without Deletion 5q Cytogenetic Abnormality and REVLIMID (lenalidomide) INTRODUCTION Myelodysplastic syndromes (MDS) are a group of heterogeneous hematologic disorders
More informationAllogeneic Hematopoietic Stem-Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Neoplasms. Policy Specific Section:
Medical Policy Allogeneic Hematopoietic Stem-Cell Transplantation for Myelodysplastic Syndromes and Myeloproliferative Type: Medical Necessity and Investigational / Experimental Policy Specific Section:
More informationNational Horizon Scanning Centre. Azacitidine (Vidaza) for myelodysplastic syndrome. September 2007
Azacitidine (Vidaza) for myelodysplastic syndrome September 2007 This technology summary is based on information available at the time of research and a limited literature search. It is not intended to
More informationBone Marrow Transplantation in Myelodysplastic Syndromes. An overview for the Myelodysplasia Support Group of Ottawa
Bone Marrow Transplantation in Myelodysplastic Syndromes An overview for the Myelodysplasia Support Group of Ottawa Objectives Provide brief review of marrow failure Re emphasize the importance of predictions
More informationAcute Leukemia Diagnosis
Acute Leukemia Diagnosis Elizabeth A. Griffiths, MD Leukemia Service, Department of Medicine Roswell Park Cancer Institute SUNY-UB School of Medicine 3 841,390 843,820 Blood cancers are normal blood cells
More informationIPSS Modified 7/27/2011. WHO-Based Prognostic Scoring System (WPSS)
Advances in MDS Treatment: What s on the Horizon? New Prognostic Models and Therapies Jason Gotlib, MD, MS Assistant Professor of Medicine (Hematology) Stanford Cancer Center AA&MDSIF July 3, 011 WHO-Based
More informationASCO 2011: Leukemia. Disclosures
ASCO 2011: Leukemia E.J. Feldman M.D Weill-Cornell Medical College Disclosures Speaker does not report any affiliations 1 V617F JAK2 mutation in MPDs JAK STAT PATHWAY Signal transducers and activators
More informationTable 1: biological tests in SMD
Table 1: biological tests in SMD Tests Mandatory Recommended Under validation Morphology Marrow aspirate Marrow biopsy 1 Iron staining Quantification of dysplasia WHO 2008 Classification Cytogenetics Conventional
More informationCorrespondence should be addressed to Anas Khanfar;
Case Reports in Oncological Medicine, Article ID 949515, 4 pages http://dx.doi.org/10.1155/2014/949515 Case Report Durable Hematological and Major Cytogenetic Response in a Patient with Isolated 20q Deletion
More informationThe immunomodulatory agents lenalidomide and thalidomide for treatment of the myelodysplastic syndromes: A clinical practice guideline
Critical Reviews in Oncology/Hematology 85 (2013) 162 192 The immunomodulatory agents lenalidomide and thalidomide for treatment of the myelodysplastic syndromes: A clinical practice guideline Heather
More informationAIH, Marseille 30/09/06
ALLOGENEIC STEM CELL TRANSPLANTATION FOR MYELOID MALIGNANCIES Transplant and Cellular Therapy Unit Institut Paoli Calmettes Inserm U599 Université de la Méditerranée ée Marseille, France AIH, Marseille
More informationmyelodysplastic syndrome MDS MDS MDS
myelodysplastic syndrome MDS MDS 15 10 3 2004 15 MDS 400 2 65 61 70 MDS MDS 1 1 2 3 3 4 1 4 2 3 4 MDS 1982 Bennett French- American-BritishFAB 1 2 WHO 1999 3 2001 4 2002 Vardiman MDS 5 2WHO FAB refractory
More informationADVANCES IN THE MANAGEMENT OF MYELODYSPLASTIC SYNDROMES
ADVANCES IN THE MANAGEMENT OF MYELODYSPLASTIC SYNDROMES Corey Cutler, MD MPH FRCPC Associate Professor of Medicine, Harvard Medical School Dana-Farber Cancer Institute, Boston, MA HCT Outcomes - MDS 2001-2011
More informationTransplants for MPD and MDS
Transplants for MPD and MDS The question is really who to transplant, with what and when. Focus on myelofibrosis Jeff Szer Royal Melbourne Hospital Myelodysplasia Little needs to be said Despite new therapies
More informationTreatment of Myelodysplastic Syndromes in Elderly Patients
Adv Ther (2011) 28(Suppl.2):1-9. DOI 10.1007/s12325-011-0001-9 REVIEW Treatment of Myelodysplastic Syndromes in Elderly Patients Jesus Feliu Sanchez Received: December 14, 2010 / Published online: March
More informationMyelodysplastic Syndrome: Let s build a definition
1 MDS: Diagnosis and Treatment Update Gail J. Roboz, M.D. Director, Leukemia Program Associate Professor of Medicine Weill Medical College of Cornell University The New York Presbyterian Hospital Myelodysplastic
More informationMyeloproliferative Disorders: Diagnostic Enigmas, Therapeutic Dilemmas. James J. Stark, MD, FACP
Myeloproliferative Disorders: Diagnostic Enigmas, Therapeutic Dilemmas James J. Stark, MD, FACP Medical Director, Cancer Program and Palliative Care Maryview Medical Center Professor of Medicine, EVMS
More informationYour Speaker. Outline 10/2/2017. Myelodysplastic Syndromes and Myeloid Neoplasms. Introduction and classifications Epidemiology Presentation Workup
Myelodysplastic Syndromes and Myeloid Neoplasms Abdulraheem Yacoub, MD Associate Professor Of Medicine Clinical Director of Ambulatory Hematology clinics The University of Kansas Cancer Center Your Speaker
More informationShould patients with higher risk MDS (or AML in «early relapse») proceed directly to allo SCT without prior chemotherapy?
Should patients with higher risk MDS (or AML in «early relapse») proceed directly to allo SCT without prior chemotherapy? Pierre Fenaux Cohem 2012 Barcelona Should patients with higher risk MDS (or AML
More informationJeanne Palmer February 26, 2017 Mayo Clinic, Phoenix, AZ
Jeanne Palmer February 26, 2017 Mayo Clinic, Phoenix, AZ What is acute leukemia? Cancer of the white blood cells Acute leukemia- Acute myelogenous leukemia Acute myeloid leukemia Myelofibrosis- Blast phase
More informationDisrupting the Cell Cycle to Treat AML and MDS Rodman & Renshaw Conference
CYC 682 Disrupting the Cell Cycle to Treat AML and MDS Rodman & Renshaw Conference September 2014 Disclaimer This presentation contains forward-looking statements within the meaning of the safe harbor
More informationWestwood Kansas Forum November 7, 2015 Part 1 Page 1 of 13
Westwood Kansas Forum November 7, 2015 Part 1 Page 1 of 13 Speakers: Suman Kambhampati, MD Jean Ridgeway, DNP, APN, NP-C, AOCN Suman Kambhampati, MD: The purpose of today s talk is basically to give you
More informationMyelodysplastic Syndromes (MDS) Enhancing the Nurses Role in Management
Myelodysplastic Syndromes (MDS) Enhancing the Nurses Role in Management Christa Roe, RN, BS, OCN Malignant Hematology Department H Lee Moffitt Cancer Center & Research Tampa, Florida Agenda MDS Disease
More informationJeanne Palmer, MD Mayo Clinic, Arizona
Setting the stage for Transplant in MPN Jeanne Palmer, MD Mayo Clinic, Arizona What will be covered What is a bone marrow transplant? When to start thinking about bone marrow transplant Timing of transplant
More informationErythropoiesis Stimulating Agents (ESA)
Erythropoiesis Stimulating Agents (ESA) Policy Number: Original Effective Date: MM.04.008 04/15/2007 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST Integration 06/01/2015 Section: Prescription
More informationCombination Therapies in Higher-risk MDS
Combination Therapies in Higher-risk MDS Mikkael A. Sekeres, MD, MS Associate Professor of Medicine Director, Leukemia Program Taussig Cancer Institute U.S. Classification of MDS Patients 26% 18% 23% 15%
More informationMyelodyspastic Syndromes
Myelodyspastic Syndromes SUPPLEMENTARY APPENDIX Complex or monosomal karyotype and not blast percentage is associated with poor survival in acute myeloid leukemia and myelodysplastic syndrome patients
More informationMyelodysplastic syndromes: 2018 update on diagnosis, risk-stratification and management
Received: 2 October 2017 Accepted: 2 October 2017 DOI: 10.1002/ajh.24930 ANNUAL CLINICAL UPDATES IN HEMATOLOGICAL MALIGNANCIES Myelodysplastic syndromes: 2018 update on diagnosis, risk-stratification and
More informationTreatment of low risk MDS
Treatment of low risk MDS Matteo G Della Porta Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy matteo.della_porta@hunimed.eu International Prognostic Scoring
More informationHCT for Myelofibrosis
Allogeneic HSCT for MDS and Myelofibrosis Sunil Abhyankar, MD Professor Medicine, Medical Director, Pheresis and Cell Processing University of Kansas Hospital BMT Program April 27 th, 213 HCT for Myelofibrosis
More informationWhat you need to know about MDS. The Myelodysplastic Syndromes. Stuart Goldberg MD
What you need to know about MDS The Myelodysplastic Syndromes Stuart Goldberg MD The Myelodysplastic Syndromes are a group of bone marrow failure diseases The bone marrow is the factory that makes blood
More informationBlast transformation in chronic myelomonocytic leukemia: Risk factors, genetic features, survival, and treatment outcome
RESEARCH ARTICLE Blast transformation in chronic myelomonocytic leukemia: Risk factors, genetic features, survival, and treatment outcome AJH Mrinal M. Patnaik, 1 Emnet A. Wassie, 1 Terra L. Lasho, 2 Curtis
More informationNew and Emerging Strategies in the Treatment of Patients with Higher risk Myelodysplastic Syndromes (MDS)
Welcome to Managing Myelodysplastic Syndromes. My name is David Steensma. I am an Associate Professor of Medicine at Harvard Medical School and a faculty member in the Adult Leukemia Program at Dana Farber
More informationDisclosure Slide. Research Support: Onconova Therapeutics, Celgene
Oral Rigosertib Combined with Azacitidine in Patients with Acute Myeloid Leukemia (AML) and Myelodysplastic Syndromes (MDS): Effects in Treatment Naïve and Relapsed- Refractory Patients Shyamala C. Navada,
More informationMaintaining Long-Term Efficacy in the Elderly MDS Patient with Poor Performance Status
Hi, my name is Dr. Hetty Carraway. I am a staff physician at the Taussig Cancer Institute at the Cleveland Clinic. Welcome to Managing MDS. 1 As you all are aware, many of our patients with MDS are in
More information5/21/2018. Disclosures. Objectives. Normal blood cells production. Bone marrow failure syndromes. Story of DNA
AML: Understanding your diagnosis and current and emerging treatments Nothing to disclose. Disclosures Mohammad Abu Zaid, MD Assistant Professor of Medicine Indiana University School of Medicine Indiana
More informationWhat s a Transplant? What s not?
What s a Transplant? What s not? How to report the difference? Daniel Weisdorf MD University of Minnesota Anti-cancer effects of BMT or PBSCT [HSCT] Kill the cancer Save the patient Restore immunocompetence
More informationImpact of Comorbidity on Quality of Life and Clinical Outcomes in MDS
Current Therapeutic and Biologic Advances in MDS A Symposium of The MDS Foundation ASH 2014 Impact of Comorbidity on Quality of Life and Clinical Outcomes in MDS Peter Valent Medical University of Vienna
More informationBone Marrow Transplantation and the Potential Role of Iomab-B
Bone Marrow Transplantation and the Potential Role of Iomab-B Hillard M. Lazarus, MD, FACP Professor of Medicine, Director of Novel Cell Therapy Case Western Reserve University 1 Hematopoietic Cell Transplantation
More informationSTEM CELL TRANSPLANTATION FOR ACUTE MYELOID LEUKEMIA
STEM CELL TRANSPLANTATION FOR ACUTE MYELOID LEUKEMIA Coverage for services, procedures, medical devices and drugs are dependent upon benefit eligibility as outlined in the member's specific benefit plan.
More informationInduction Therapy & Stem Cell Transplantation for Myeloma
Induction Therapy & Stem Cell Transplantation for Myeloma William Bensinger, MD Professor of Medicine, Division of Oncology University of Washington School of Medicine Director, Autologous Stem Cell Transplant
More informationDepartment of Leukemia, The University of Texas M.D. Anderson Cancer Center, Houston, Texas; 2 Sunesis Pharmaceuticals, Inc, South San Francisco
Phase I/II Study of Vosaroxin and Decitabine in Newly Diagnosed Older Patients with Acute Myeloid Leukemia (AML) and High Risk Myelodysplastic Syndrome (MDS) Naval Daver 1, Hagop Kantarjian 1, Guillermo
More informationCurrent guidelines for management of INT- 2/high risk MDS
ELASTIC Current guidelines for management of INT- 2/high risk MDS If fit (i.e. HCT-CI and performance status< 3), consider for early allo BMT with/without prior AML induction therapy If unfit consider
More informationMyelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data
Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative
More informationGuidelines for diagnosis and management of Adult Myelodysplastic Syndromes (MDS)
Guidelines for diagnosis and management of Adult Myelodysplastic Syndromes (MDS) Author: Dr A Pillai, Consultant Haematologist On behalf of the Haematology CNG Re- Written: February 2011, Version 2 Revised:
More informationMyelodysplastic syndromes
Haematology 601 Myelodysplastic syndromes The myelodysplastic syndromes are a group of disorders predominantly affecting elderly people, leading to ineffective haematopoiesis, and they have the potential
More informationOncology Highlights: Leukemia & Myelodysplastic Syndromes
Oncology Highlights: Leukemia & Myelodysplastic Syndromes Jorge Cortes, MD Department of Leukemia The University of Texas, M.D. Anderson Cancer Center Highlights of the Day Leukemia & MDS AML: The field
More informationKevin Kelly, MD, Phd Acute Myeloid and Lymphoid Leukemias
Kevin Kelly, MD, Phd Acute Myeloid and Lymphoid Leukemias Relevant financial relationships in the past twelve months by presenter or spouse/partner. Speakers bureau: Novartis, Janssen, Gilead, Bayer The
More informationTHE LEUKEMIAS. Etiology:
The Leukemias THE LEUKEMIAS Definition 1: malignant transformation of the pluripotent stem cell, successive expansion of the malignant clone from the bone marrow to the tissues Definition 2: Heterogenous
More informationMyelodysplastic Syndromes: Challenges to Improving Patient and Caregiver Satisfaction
Supplement issue Myelodysplastic Syndromes: Challenges to Improving B. Douglas Smith, MD Division of Hematologic Malignancies, Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Johns Hopkins
More informationHEMATOLOGIC MALIGNANCIES BIOLOGY
HEMATOLOGIC MALIGNANCIES BIOLOGY Failure of terminal differentiation Failure of differentiated cells to undergo apoptosis Failure to control growth Neoplastic stem cell FAILURE OF TERMINAL DIFFERENTIATION
More informationThe Changing Face of MDS: Advances in Treatment
Thank you very much again for listening to me. We are going to be talking now in terms of therapy of MDS or The Changing Face of MDS Advances in Treatment. My name is Guillermo Garcia-Manero. I am a Professor
More informationBackground CPX-351. Lancet J, et al. J Clin Oncol. 2017;35(suppl): Abstract 7035.
Overall Survival (OS) With Versus in Older Adults With Newly Diagnosed, Therapy-Related Acute Myeloid Leukemia (taml): Subgroup Analysis of a Phase 3 Study Abstract 7035 Lancet JE, Rizzieri D, Schiller
More informationWhat s new in Blood and Marrow Transplant? Saar Gill, MD PhD Jan 22, 2016
What s new in Blood and Marrow Transplant? Saar Gill, MD PhD Jan 22, 2016 Division of Hematology-Oncology University of Pennsylvania Perelman School of Medicine 1 Who should be transplanted and how? Updates
More informationBlood Cancers. Blood Cells. Blood Cancers: Progress and Promise. Bone Marrow and Blood. Lymph Nodes and Spleen
Blood Cancers: Progress and Promise Mike Barnett & Khaled Ramadan Division of Hematology Department of Medicine Providence Health Care & UBC Blood Cancers Significant health problem Arise from normal cells
More informationNeutrophil Recovery: The. Posttransplant Recovery. Bus11_1.ppt
Neutrophil Recovery: The First Step in Posttransplant Recovery No conflicts of interest to disclose Bus11_1.ppt Blood is Made in the Bone Marrow Blood Stem Cell Pre-B White cells B Lymphocyte T Lymphocyte
More informationReduced-intensity Conditioning Transplantation
Reduced-intensity Conditioning Transplantation Current Role and Future Prospect He Huang M.D., Ph.D. Bone Marrow Transplantation Center The First Affiliated Hospital Zhejiang University School of Medicine,
More informationDepartment of Leukemia, The University of Texas M.D. Anderson Cancer Center, Houston, Texas; 2 Sunesis Pharmaceuticals, Inc, South San Francisco
Phase I/II Study of Vosaroxin and Decitabine in Newly Diagnosed Older Patients with Acute Myeloid Leukemia (AML) and High Risk Myelodysplastic Syndrome (MDS) Naval Daver 1, Hagop Kantarjian 1, Guillermo
More information