Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China

Size: px
Start display at page:

Download "Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China"

Transcription

1 The Journal of International Medical Research 2007; 35: Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China W-J FANG 1, C-Z LIN 2, H-H ZHANG 3, J QIAN 1, L ZHONG 1 AND N XU 1 1 Department of Medical Oncology, and 2 Department of Coloproctological Surgery, The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, China; 3 Laboratory of Gene Diagnosis, The First People s Hospital, Hangzhou, China Colorectal cancer, a heterogeneous disease arising from a complex series of molecular changes, is one of the world s leading causes of cancer deaths. MicroRNAs (mirnas), an extensive class of small non-coding RNAs, have been implicated in cancer development and progression. One of the first mirnas to be identified was let-7 mirna, which has recently been found to be expressed at reduced levels in human lung cancer cells. We used a rapid stem-loop reverse transcription polymerase chain reaction method to quantify human let-7a mirna expression in samples of human colorectal cancer. This method was able to detect let-7a mirna in as little as 0.05 ng of total RNA from colorectal mucosa and its specificity was high (100%). Our results showed that the expression of let-7a mirna was considerably reduced in two of eight patients. To our knowledge, this is the first study of Chinese patients to show reduced expression of endogenous let-7 mirna in colorectal cancer. KEY WORDS: COLORECTAL CANCER; ONCOGENES; LET-7; RAS; MICRORNA Introduction Colorectal cancer is the third most common cancer worldwide after lung and breast cancers, accounting for an estimated new cancer cases and cancer deaths per year. 1 The pathogenesis of colorectal cancer has been extensively studied and is believed to arise through multiple factors, including pre-existing adenomatous polyps, poor diet choices and genetics. 2 MicroRNAs (mirnas), small non-coding RNA species, regulate the stability or translational efficiency of their target mrna and can be involved in the regulation of differentiation, proliferation or apoptosis. 3 5 One of the first mirnas to be identified, let- 7, is required for the timing of cell fate determination in Caenorhabditis elegans. 6 8 In humans, various let-7 genes have been reported to map to chromosomal sites implicated in a variety of cancers. 9 In particular, data from both in vivo and in vitro studies in the USA and Japan have shown reduced expression of let-7 mirnas in human colorectal cancer. 10,11 A successive functional analysis indicated that let-7 might act as one of the growth suppressive mirnas in human colorectal cancer. 11,12 716

2 In the current study we quantified the let- 7a mirna expression levels in eight patients with colorectal cancer using a real-time reverse transcription polymerase chain reaction (RT-PCR) technique. This was one of the first studies to investigate the expression of let-7 mirna in colorectal cancer among a Chinese population. Patients and methods PATIENTS AND TISSUE PREPARATION Tissue samples were collected from patients who had undergone surgery for a histologically diagnosed colorectal cancer at the First Affiliated Hospital of Zhejiang University (Hangzhou, China) between 2005 and Samples of colorectal cancer tissue and adjacent normal tissue were frozen immediately (within 10 min) after surgical resection. Written informed consent was obtained from each patient before entering the study. The study was approved by the ethics committee of The First Affiliated Hospital of Zhejiang University and was conducted in accordance with ethical principles stated in the most recent version of the Declaration of Helsinki or the applicable guidelines on good clinical practice, whichever gave greatest protection for the individual. EXTRACTION OF TOTAL RNA AND GENOMIC DNA Total RNA and genomic DNA were extracted from colorectal cancer tissues and from adjacent normal tissues. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagene, Hilden, Germany). Genomic DNA and total RNA were quantified using an ultraviolet spectrophotometer at a wavelength of 260 nm (UVPC2401, Shimadzu, Kyoto, Japan) and then 5 µg of normal gastric mucosal RNA was diluted to 500, 50, 5, 0.5, 0.05 and ng. The quantity of total RNA was measured according to the ratio of OD at 260 nm/ 280 nm. STEM-LOOP REVERSE TRANSCRIPTASE PRIMER AND TAQMAN MGB PROBE All of the oligonucleotide sequences that were used in this study are listed in Table 1. The stem-loop reverse transcriptase primer (let-7ap RT ), RT-PCR amplification primers (let-7apf and let-7apr) and the TaqMan MGB (minor groove binder) probe (let-7at) were designed according to Chen et al. 13 The let-7a mirna template sequence (let-7aseq) was accessed from mirbase: Sequences. 14 All primers and probes were synthesized by TABLE 1: The oligonucleotide sequences of the primers, probe and synthesized let-7a mirna template (let-7aseq) used in the study Name let-7ap RT let-7apf let-7apr let-7at let-7aseq Sequence GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTA GCCGCTGAGGTAGTAGGTTGTA GTGCAGGGTCCGAGGT (6-FAM)TGGATACGACAACTATAC(MGB) 6-UGAGGUAGUAGGUUGUAUAGUU-27(MIMAT ) 717

3 Shanghai GeneCore BioTechnologies Co., Ltd, Shanghai, China. REVERSE TRANSCRIPTION The mirnas were converted into cdnas using SuperScript III reverse transcription kits (Invitrogen, Carlsbad, CA, USA). Into a microcentrifuge tube were added: 10 µl of total RNA or artificially synthesized let-7a mirna template (let-7aseq), 1.0 µl of 1.0 µmol stem-loop reverse transcriptase primer (let-7ap RT ), 1.0 µl of 10 mmol deoxyribonucleotide triphosphates (dntps) and 1.0 µl of water. This was mixed and heated at 65 C for 5 min followed by incubation on ice for 2 min. Then 4.0 µl of 5 first-strand buffer (250 mm Tris HCl [ph 8.3 at room temperature], 375 mm KCl, 15 mm MgCl 2 ), 1.0 µl of 0.1 M dithiothreitol (DTT), 1.0 µl of RNase inhibitor (RNaseOUT recombinant RNase inhibitor; Invitrogen) and 1.0 µl of SuperScript III reverse transcriptase were added and the reaction mixture was mixed thoroughly. The final reaction mixture (20 µl) was incubated for 60 min at 55 C and 15 min at 70 C. Reverse transcriptions included no-template (negative) controls. RT-PCR AMPLIFICATION The RT-PCR amplification was performed using a standard TaqMan PCR protocol on an Applied Biosystems 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The 50 µl PCR reaction mixture included 5.0 µl of reverse transcription product, 5.0 µl of 10 PCR buffer (500 mm KCl, 100 mm Tris HCl, ph 8.5) (Takara, Dalian, China), 1.0 µl of 10 mmol dntps (Takara), 7.0 µl of 25 mm Mg 2+ (Takara), 0.6 µl of AmpliTaq DNA polymerase (5 U/µl, Takara), 0.2 µl of TaqMan probe (let-7at, 10 µmol/µl), 1.5 µl of amplification primer I (let-7apf, 10 µmol/µl), 0.7 µl of amplification primer II (let-7apr, 10 µmol/µl) and 29 µl of autoclaved distilled water. The reaction mixture was incubated at 95 C for 10 min, followed by 40 amplification cycles of 15 s at 95 C and 1 min at 60 C. All reactions were run in duplicate. The threshold cycle (CT) was defined as the fractional cycle number at which the fluorescence passed a fixed threshold. TaqMan CT values were converted into absolute copy numbers using a standard curve derived from synthetic let- 7a mirna. We also quantified transcripts of β-actin as the endogenous RNA control and each sample was normalized on the basis of its β-actin content. 15 Results DYNAMIC RANGE AND SENSITIVITY OF let-7a mirna QUANTIFICATION The dynamic range and sensitivity of let-7a mirna quantification, evaluated by measuring the absorbance at 260 nm of step-wise dilutions (10 10, 10 9, 10 8, 10 7, 10 6, 10 5, 10 4, 10 3, 10 2, 10 1 and 1 copies/µl), indicated excellent linearity between the log of the target input and the CT value for the real-time PCR assay, that the assay had a dynamic range of at least eight orders of magnitude, and that it was capable of detecting as few as 10 copies of let-7a mirna (Fig. 1; r 2 = 0.996). The total RNA input ranged from to 5000 ng and the results demonstrated that the method could detect let-7a mirna in as little as 0.05 ng of total RNA from colorectal mucosa (Fig. 2). ASSAY SPECIFICITY Our results showed that the real-time PCR assay gave no fluorescence signal in the presence of 50 ng of human genomic DNA, demonstrating that it had high (100%) specificity for let-7a mirna and was not affected by the presence of non-specific genomic DNA. 718

4 A Rn B Cycle number 36 Threshold cycle No of copies of let-7a mirna FIGURE 1: Dynamic range and sensitivity of the let-7a mirna assay. (A) Amplification curve of the synthesized let-7a mirna. The assay exhibited high sensitivity and a broad dynamic range between the signal of 10 1 and 10 8 copies of input template and the no-template control background. (B) Standard curve of the let-7a mirna (r 2 = 0.996; slope = 2.923; intercept = ) let-7a mirna EXPRESSION IN COLORECTAL CANCER To confirm whether levels of let-7 mirna were reduced in human colorectal cancer in the Chinese population, we examined the expression of mature let-7 mirna and β-actin in eight patients with colorectal cancer. The expression of let-7 mirna in tumour tissues was considerably down-regulated by over 90% in two of the eight patients (patients 2 and 5) compared with the expression in adjacent normal tissues from the same patient (Table 2; Fig. 3). 719

5 A Rn Cycle number B Threshold cycle RNA (ng) FIGURE 2: The total RNA dynamic range and sensitivity of the let-7a mirna assay. (A) Amplification plot showing six orders of magnitude of colorectal mucosa total RNA. The total RNA range tested was from to 5000 ng per stem-loop RT-PCR reaction. (B) Correlation of total RNA input to the threshold cycle values for the let-7a mirna assay Discussion Colorectal cancer is one of the leading causes of cancer deaths in the world, reflecting the need for a better understanding of the mechanisms that underlie its development. Changes in the levels of mirna expression have been implicated in the development of cancer as indicated by recent evidence of consistent differential expression levels between tumours and normal tissues of different lineages. 16 In contrast, the level of expression of mrna markers cannot be used to define tumours. 17 Studies have indicated however that, unlike mrna expression, a 720

6 modest number of mirnas (200 in total) might be sufficient to classify human cancers. 16 The let-7 gene family was the first group of onco-mirnas shown to regulate the expression of oncogenes, specifically the Ras genes. 18 Ras proteins are membraneassociated GTPases, which are signalling proteins that regulate cellular growth and differentiation. 18 About 15 30% of human tumours possess mutations in their Ras genes, and activating mutations that result in the increased expression of Ras cause cellular transformation. 19,20 A mirna that regulates the expression level of these potentially oncogenic proteins would, therefore, be predicted to control the rate of cellular proliferation. It is also plausible that the loss of mirna control of Ras could lead to over-expression of Ras and tumour formation. A recent study supports this notion as it found that the expression of let-7 and the level of Ras protein in human lung cancer tissues were negatively correlated; hence a poorer disease prognosis occurred when the let-7 level was low and the Ras level was high. 21 As real-time PCR is a gold standard for gene expression studies, 22,23 we designed a novel real-time RT-PCR method using a stemloop reverse transcriptase primer combined with conventional TaqMan PCR for let-7 mirna quantification. We found reduced expression of let-7 mirnas in two out of eight colorectal cancer patients in our study, which is consistent with previous reports. 10,11 Our findings further support the idea that members of the let-7 mirna family might function as important tumour suppressors. In summary, our findings suggest that reduced expression of let-7 mirna might be involved in the pathogenesis of human colorectal cancer. The reduction in let-7 mirna expression, however, was only TABLE 2: Expression of let-7a mirna in colorectal cancer tissue compared with adjacent normal tissue in eight patients Colorectal cancer tissue (T) Normal tissue (N) Patient OD Total RNA Let-7a load OD Total RNA Let-7a load No. 260 nm/280 nm (µg) CT let-7a (copies/µg) 260 nm/280 nm (µg) CT let-7a (copies/µg) T/N T/N, difference in let-7a expression between tumour and normal tissues; CT, threshold cycle defined as the fractional cycle number at which fluorescence passed a fixed threshold. 721

7 A 1g x copies/µl Patient No. B 1g x copies/µl Tumour tissues Non-tumour tissues Patient No. FIGURE 3: (A) Expression of let-7 mirna in samples of colorectal cancer and normal adjacent tissue from eight patients showing expression in tumour samples from patients 2 and 5 was considerably down-regulated compared with the normal tissues. (B) β-actin expression as an internal standard using real-time PCR according to Xie et al. 15 showed no difference between colorectal cancer samples and normal tissues observed in two out of eight cases, so these findings should be interpreted with caution. A larger scale study will be necessary to clarify further the role of let-7 mirna in human colorectal cancer development and diagnosis. Acknowledgements We thank Mrs J Fan (Laboratory of Gene Diagnosis, The First People s Hospital, Hangzhou, China) for her kind assistance in performing these experiments. This work was supported by the Basic Research Project (2006 G20518) and the Department of Education, Zhejiang Province, China. W Fang and C Lin contributed equally to the work described in this paper. Conflicts of interest No conflicts of interest were declared in relation to this paper. Received for publication 31 May 2007 Accepted subject to revision 4 June 2007 Revised accepted 3 August 2007 Copyright 2007 Field House Publishing LLP References 1 Kamangar F, Dores GM, Anderson WF: Patterns of cancer incidence, mortality, and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world. J Clin Oncol 2006; 24: Jass JR, Whitehall VL, Young J, et al: Emerging concepts in colorectal neoplasia. Gastroenterology 2002; 123: Ambros V: MicroRNA pathways in files and worms: growth, death, fat, stress, and timing. Cell 2003; 113: Bartel DP: MicroRNA: genomics, biogenesis, mechanism, and function. Cell 2004; 116: Ambros V: The functions of animal micrornas. Nature 2004; 431: Pasquinelli A, Reinhart B, Slack F, et al: Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000; 408: Reinhart BJ, Slack FJ, Basson M, et al: The 21- nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000; 403: Lee RC, Feinbaum RL, Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs 722

8 with antisense complementarity to lin-14. Cell 1993; 75: Calin GA, Sevignani C, Dumitru CD, et al: Human microrna genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci USA 2004; 101: Gaur A, Jewell DA, Liang Y, et al: Characterization of microrna expression levels and their biological correlates in human cancer cell lines. Cancer Res 2007; 67: Akao Y, Nakagawa Y, Naoe T: Let-7 microrna functions as a potential growth suppressor in human colon cancer cells. Biol Pharm Bull 2006; 29: Johnson SM, Grosshans H, Shingara J, et al: RAS is regulated by the let-7 microrna family. Cell 2005; 120: Chen C, Ridzon DA, Broome AJ, et al: Real-time quantification of micrornas by stem-loop RT- PCR. Nucleic Acids Res 2005; 33: e mirbase: Sequences: Wellcome Trust, Sanger Institute. acc=mi Xie D, Nakachi K, Wang H, et al: Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features. Cancer Res 2001; 61: Lu J, Getz G, Miska EA, et al: MicroRNA expression profiles classify human cancers. Nature 2005; 435: Ramaswamy S, Tamayo P, Rifkin R, et al: Multiclass cancer diagnosis using tumor gene expression signatures. Proc Natl Acad Sci USA 2001; 98: Esquela-Kerscher A, Slack FJ: Oncomirs: micrornas with a role in cancer. Nature Rev Cancer 2006; 6: McKay IA, Marshall CJ, Cales C, et al: Transformation and stimulation of DNA synthesis in NIH-3T3 cells are a titratable function of normal p21n-ras expression. EMBO J 1986; 5: Pulciani S, Santos E, Long LK, et al: Ras gene amplification and malignant transformation. Mol Cell Biol 1985; 5: Takamizawa J, Konishi H, Yanagisawa K, et al: Reduced expression of the Let-7 micrornas in human lung cancers in association with shortened postoperative survival. Cancer Res 2004; 64: Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2[-Delta Delta C(T)] method. Methods 2001; 25: Heid CA, Stevens J, Livak KJ, et al: Real time quantitative PCR. Genome Res 1996; 6: Author s address for correspondence Dr N Xu Department of Medical Oncology, The First Affiliated Hospital, College of Medicine, Zhejiang University, 79 QingChun Road, Hangzhou , China. xunong@medmail.com.cn 723

Serum mirna expression profile as a prognostic biomarker of stage II/III

Serum mirna expression profile as a prognostic biomarker of stage II/III Serum mirna expression profile as a prognostic biomarker of stage II/III colorectal adenocarcinoma Jialu Li a,b,, Yang Liu c,, Cheng Wang d,, Ting Deng a,, Hongwei Liang b, Yifei Wang e, Dingzhi Huang

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

micrornas (mirna) and Biomarkers

micrornas (mirna) and Biomarkers micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

Ling Xu, Wei-Qi Dai, Xuan-Fu Xu, Fan Wang, Lei He, Chuan-Yong Guo*

Ling Xu, Wei-Qi Dai, Xuan-Fu Xu, Fan Wang, Lei He, Chuan-Yong Guo* DOI:http://dx.doi.org/10.7314/APJCP.2012.13.7.3203 RESEARCH ARTICLE Effects of Multiple-target Anti-microRNA Antisense Oligodeoxyribonucleotides on Proliferation and Migration of Gastric Cancer Cells Ling

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us. Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

High AU content: a signature of upregulated mirna in cardiac diseases

High AU content: a signature of upregulated mirna in cardiac diseases https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

MicroRNA-mediated incoherent feedforward motifs are robust

MicroRNA-mediated incoherent feedforward motifs are robust The Second International Symposium on Optimization and Systems Biology (OSB 8) Lijiang, China, October 31 November 3, 8 Copyright 8 ORSC & APORC, pp. 62 67 MicroRNA-mediated incoherent feedforward motifs

More information

mir-17 in imatinib resistance and response to tyrosine kinase inhibitors in chronic myeloid leukemia cells

mir-17 in imatinib resistance and response to tyrosine kinase inhibitors in chronic myeloid leukemia cells JBUON 2013; 18(2): 437-441 ISSN: 1107-0625 www.jbuon.com E-mail: info@jbuon.com ORIGINAL ARTICLE mir-17 in imatinib resistance and response to tyrosine kinase inhibitors in chronic myeloid leukemia cells

More information

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets (TaqMan Real-time ' FAM ' BHQ1

More information

Small RNA existed in commercial reverse transcriptase: primary evidence of functional small RNAs

Small RNA existed in commercial reverse transcriptase: primary evidence of functional small RNAs Protein Cell 15, 6(1):1 5 DOI 1.17/s13238-14-116-2 Small RNA existed in commercial reverse transcriptase: primary evidence of functional small RNAs Jie Xu, Xi Chen, Donghai Li, Qun Chen, Zhen Zhou, Dongxia

More information

MicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction

MicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction www.muthjm.com Muthanna Medical Journal 2016; 3(1):23-33 MicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction Shoroq Mohammed AL-Temimi 1* Abstract

More information

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Association of mir-21 with esophageal cancer prognosis: a meta-analysis

Association of mir-21 with esophageal cancer prognosis: a meta-analysis Association of mir-21 with esophageal cancer prognosis: a meta-analysis S.-W. Wen 1, Y.-F. Zhang 1, Y. Li 1, Z.-X. Liu 2, H.-L. Lv 1, Z.-H. Li 1, Y.-Z. Xu 1, Y.-G. Zhu 1 and Z.-Q. Tian 1 1 Department of

More information

Expression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological staging of the cancer

Expression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological staging of the cancer European Review for Medical and Pharmacological Sciences 2016; 20: 1283-1287 Expression level of microrna-195 in the serum of patients with gastric cancer and its relationship with the clinicopathological

More information

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets Real- (TaqMan time ' FAM ' BHQ1

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.

More information

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

MicroRNA in Cancer Karen Dybkær 2013

MicroRNA in Cancer Karen Dybkær 2013 MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.

More information

MicroRNAs: novel regulators in skin research

MicroRNAs: novel regulators in skin research MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers

More information

Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies

Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies. 2014. Supplemental Digital Content 1. Appendix 1. External data-sets used for associating microrna expression with lung squamous cell

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

Evaluation of altered expression of mir-9 and mir-106a as an early diagnostic approach in gastric cancer

Evaluation of altered expression of mir-9 and mir-106a as an early diagnostic approach in gastric cancer Original Article Evaluation of altered expression of mir-9 and mir-106a as an early diagnostic approach in gastric cancer Khadije Shirmohammadi, Sareh Sohrabi, Zahra Jafarzadeh Samani, Hosein Effatpanah,

More information

ipsogen BCR-ABL1 Mbcr Kit Handbook

ipsogen BCR-ABL1 Mbcr Kit Handbook March 2015 ipsogen BCR-ABL1 Mbcr Kit Handbook 52 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM 7000, 7700, or 7900HT SDS, Applied Biosystems 7500 Real-Time PCR System,

More information

Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA

Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA Original Article Clinical significance of serum mir-21 in breast cancer compared with CA153 and CEA Jianjian Gao, Qingyun Zhang, Jianjun Xu, Lijuan Guo, Xuefeng Li Key Laboratory of Carcinogenesis and

More information

Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma

Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma C.H. Zeng, B. Guo, J. Chen, W.M. He and Q.L. Luo Ophthalmology Department of West China Hospital, Sichuan University, Sichuan,

More information

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital

More information

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Expression and significance of mir-21 in multiple myeloma patients

Expression and significance of mir-21 in multiple myeloma patients Expression and significance of mir-21 in multiple myeloma patients J.H. Wang 1, W.W. Zhou 1, B.X. Liu 1, D.L. Man 1, Z.D. Yang 1, F.R. Liu 2 and H. Shang 1 1 The Laboratory Medicine of First Affiliated

More information

microrna analysis for the detection of autologous blood transfusion in doping control

microrna analysis for the detection of autologous blood transfusion in doping control microrna analysis for the detection of autologous blood transfusion in doping control Application note Doping Control Authors Francesco Donati*, Fiorella Boccia, Xavier de la Torre, Alessandra Stampella,

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Expression levels of microrna-375 in pancreatic cancer

Expression levels of microrna-375 in pancreatic cancer BIOMEDICAL REPORTS 1: 393-398, 2013 Expression levels of microrna-375 in pancreatic cancer SHIDUO SONG *, JIAN ZHOU *, SONGBING HE, DONGMING ZHU, ZIXIANG ZHANG, HUA ZHAO, YI WANG and DECHUN LI Department

More information

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin

More information

Post-transcriptional regulation of an intronic microrna

Post-transcriptional regulation of an intronic microrna Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology

More information

Association of microrna 21 With Biological Features and Prognosis of Neuroblastoma

Association of microrna 21 With Biological Features and Prognosis of Neuroblastoma Special Report Association of microrna 21 With Biological Features and Prognosis of Neuroblastoma Yaodong Zhou, MD, and Bo Sheng, MD Background: The aim of this study was to assess the differences in microrna

More information

Kit for assay of thioredoxin

Kit for assay of thioredoxin FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are

More information

Let-7a microrna functions as a potential tumor suppressor in human laryngeal cancer

Let-7a microrna functions as a potential tumor suppressor in human laryngeal cancer ONCOLOGY REPORTS 22: 1189-1195, 2009 Let-7a microrna functions as a potential tumor suppressor in human laryngeal cancer XIAO-BO LONG 1*, GUANG-BIN SUN 2*, SHUANG HU 1, GENG-TIAN LIANG 2, NAN WANG 1, XIN-HAO

More information

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng, The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Viruses Tomasz Kordula, Ph.D.

Viruses Tomasz Kordula, Ph.D. Viruses Tomasz Kordula, Ph.D. Resources: Alberts et al., Molecular Biology of the Cell, pp. 295, 1330, 1431 1433; Lehninger CD Movie A0002201. Learning Objectives: 1. Understand parasitic life cycle of

More information

ipsogen BCR-ABL1 mbcr Kit Handbook

ipsogen BCR-ABL1 mbcr Kit Handbook March 2015 ipsogen BCR-ABL1 mbcr Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM, LightCycler, and SmartCycler instruments 670023 QIAGEN GmbH, QIAGEN Strasse

More information

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Y.-B. Deng, H.-J. Qin, Y.-H. Luo, Z.-R. Liang and J.-J. Zou

More information

Glycosyltransferase Activity Kit

Glycosyltransferase Activity Kit Glycosyltransferase Activity Kit Catalog Number EA001 This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS

More information

mir-129b suppresses cell proliferation in the human lung cancer cell lines A549 and H1299

mir-129b suppresses cell proliferation in the human lung cancer cell lines A549 and H1299 mir-129b suppresses cell proliferation in the human lung cancer cell lines A549 and H1299 L. Zheng, Y.X. Qi, S. Liu, M.L. Shi and W.P. Yang Department of Respiratory Medicine, People s Hospital of Laiwu

More information

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ

More information

Shangqiu Medical College, Shangqiu, China 2. Corresponding author: M.Z. Zhang

Shangqiu Medical College, Shangqiu, China 2. Corresponding author: M.Z. Zhang Comparison of the expression of human equilibrative nucleotide transporter 1 (hent1) and ribonucleotide reductase subunit M1 (RRM1) genes in seven non-hodgkin lymphoma cell lines H.B. Zhao 1,2, X.F. Zhang

More information

mirna in Plasma Exosome is Stable under Different Storage Conditions

mirna in Plasma Exosome is Stable under Different Storage Conditions Molecules 2014, 19, 1568-1575; doi:10.3390/molecules19021568 Article OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules mirna in Plasma Exosome is Stable under Different Storage Conditions

More information

Identification of Suitable Reference Genes for qpcr Analysis of Serum microrna in Gastric Cancer Patients

Identification of Suitable Reference Genes for qpcr Analysis of Serum microrna in Gastric Cancer Patients DOI 10.1007/s10620-011-1981-7 ORIGINAL ARTICLE Identification of Suitable Reference Genes for qpcr Analysis of Serum microrna in Gastric Cancer Patients Jianning Song Zhigang Bai Wei Han Jun Zhang Hua

More information

ipsogen BCR-ABL1 Mbcr Kit Handbook

ipsogen BCR-ABL1 Mbcr Kit Handbook March 2015 ipsogen BCR-ABL1 Mbcr Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, ABI PRISM, LightCycler, and SmartCycler instruments 670123 QIAGEN GmbH, QIAGEN Strasse

More information

Supplementary webappendix

Supplementary webappendix Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et

More information

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

Implications of microrna-197 downregulated expression in esophageal cancer with poor prognosis

Implications of microrna-197 downregulated expression in esophageal cancer with poor prognosis Implications of microrna-197 downregulated expression in esophageal cancer with poor prognosis T.-Y. Wang 1, S.-G. Liu 2, B.-S. Zhao 2, B. Qi 2, X.-G. Qin 2 and W.-J. Yao 2 1 Department of Biochemistry

More information

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01. PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

ipsogen BCR-ABL1 Mbcr IS-MMR Kit Handbook

ipsogen BCR-ABL1 Mbcr IS-MMR Kit Handbook July 2016 ipsogen BCR-ABL1 Mbcr IS-MMR Kit Handbook 24 Version 1 Quantitative in vitro diagnostics For use with Rotor-Gene Q, Applied Biosystems, ABI PRISM, and LightCycler instruments 670723 QIAGEN GmbH,

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays

Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays C. Litterst 1, H. Martinez, B. Iverson and R. Nuňez 1 Bio-Rad Laboratories, Life Science

More information

A novel and universal method for microrna RT-qPCR data normalization

A novel and universal method for microrna RT-qPCR data normalization A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,

More information

Microsart Calibration Reagent

Microsart Calibration Reagent Instructions for Use Microsart Calibration Reagent Prod. No. SMB95-2021 Mycoplasma arginini Prod. No. SMB95-2022 Mycoplasma orale Prod. No. SMB95-2023 Mycoplasma gallisepticum Prod. No. SMB95-2024 Mycoplasma

More information

MicroRNA Cancer qpcr Array

MicroRNA Cancer qpcr Array MicroRNA Cancer qpcr Array Array Layout Pre-designed set of 95 MicroRNA detection Primers U6 snrna Normalization transcript Selection of Candidate MicroRNAs for Cancer Array Sample References of MicroRNA

More information

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk

More information

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based

More information

Expression Analysis of mir-21 and mir-221 in Cancerous Tissues from Iranian Patients with Gastric Cancer

Expression Analysis of mir-21 and mir-221 in Cancerous Tissues from Iranian Patients with Gastric Cancer Iranian Biomedical Journal 19 (4): 188-193 (October 2015) DOI: 10.7508/ibj.2015.04.001 Expression Analysis of mir-21 and mir-221 in Cancerous Tissues from Iranian Patients with Gastric Cancer Hosein Effatpanah

More information

Influenza A viruses Detection with real time RT-PCR reagents

Influenza A viruses Detection with real time RT-PCR reagents Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza

More information

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer

RD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer www.sysmex-europe.com RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

More information

microrna PCR System (Exiqon), following the manufacturer s instructions. In brief, 10ng of

microrna PCR System (Exiqon), following the manufacturer s instructions. In brief, 10ng of SUPPLEMENTAL MATERIALS AND METHODS Quantitative RT-PCR Quantitative RT-PCR analysis was performed using the Universal mircury LNA TM microrna PCR System (Exiqon), following the manufacturer s instructions.

More information

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza

More information

developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success

developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success micrornas developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success Dr. Carola Wagner IMGM Laboratories GmbH Martinsried, Germany qpcr 2009 Symposium

More information

Santosh Patnaik, MD, PhD! Assistant Member! Department of Thoracic Surgery! Roswell Park Cancer Institute!

Santosh Patnaik, MD, PhD! Assistant Member! Department of Thoracic Surgery! Roswell Park Cancer Institute! Santosh Patnaik, MD, PhD Assistant Member Department of Thoracic Surgery Roswell Park Cancer Institute MicroRNA biology, techniques and applications History Biogenesis Nomenclature Tissue specificity Mechanisms

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Overregulation of microrna-212 in the poor prognosis of esophageal cancer patients

Overregulation of microrna-212 in the poor prognosis of esophageal cancer patients Overregulation of microrna-212 in the poor prognosis of esophageal cancer patients B. Qi 1, S.G. Liu 1, X.G. Qin 1, W.J. Yao 1, J.G. Lu 1, L. Guo 1, T.Y. Wang 2, H.C. Li 1 and B.S. Zhao 1 1 Department

More information

The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation

The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation European Review for Medical and Pharmacological Sciences 2018; 22: 405-411 The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation X.-H. LIU, J. WANG, Y.-H. DONG Department

More information

Identification of mirnas in Eucalyptus globulus Plant by Computational Methods

Identification of mirnas in Eucalyptus globulus Plant by Computational Methods International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational

More information

Section D: The Molecular Biology of Cancer

Section D: The Molecular Biology of Cancer CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty

More information

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407

SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA

More information

mir-125a-5p expression is associated with the age of breast cancer patients

mir-125a-5p expression is associated with the age of breast cancer patients mir-125a-5p expression is associated with the age of breast cancer patients H. He 1 *, F. Xu 2 *, W. Huang 1, S.Y. Luo 1, Y.T. Lin 1, G.H. Zhang 1, Q. Du 1 and R.H. Duan 1 1 The State Key Laboratory of

More information

Original Article Serum expression of mirna-103, a potential diagnostic and prognostic biomarker for colorectal cancer

Original Article Serum expression of mirna-103, a potential diagnostic and prognostic biomarker for colorectal cancer Int J Clin Exp Med 2016;9(7):14212-14218 www.ijcem.com /ISSN:1940-5901/IJCEM0024943 Original Article Serum expression of mirna-103, a potential diagnostic and prognostic biomarker for colorectal cancer

More information