Marta Puerto Plasencia. microrna sponges
|
|
- Bethany Burns
- 6 years ago
- Views:
Transcription
1 Marta Puerto Plasencia microrna sponges
2 Introduction microrna CircularRNA Publications Conclusions
3 The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5% of the genome. Non-protein-coding portion of the genome has shown to have functional consequences in development, physiology and human disease (cancer, neurodegenerative diseases ) micrornas.
4 4. Manel Esteller. Non-coding RNAs in human disease. Nature Reviews Genetics 12, (2011).
5 In humans, micrornas regulate expression of mrnas. micrornas guide the effector protein Argonaute complex (AGO) to mrnas of coding genes to repress their protein production. AGO proteins interact with micrornas and are involved in cytoplasmic post-transcriptional gene-silencing processes
6 Discovered in plants. circrna molecules stable in the cytoplasm: single-stranded viruses, such as hepatitis 6 virus or the plant viroids and virusoids. The first best known circrna is antisense to the mrna transcribed from the SRY gene highly expressed in testes.
7 In animals are an enigmatic class of RNA with unknown function. circrna contains mirna target sites and seems to be regulating the mirna activity. cirrna acts like mirna sponge.
8 CircRNA Micro RNA Micro RNA mrna mrna Protein Expression Protein Expression
9 8.Jeremy E et al. A Circuitous Route to Noncoding RNA Vol. 340 no pp (2013).
10
11 They sequence total RNA from a human cell retaining the spliced reads. Next, the mapp spiced reads to the reference genome. They detect circularization splicing from the reversed (head-to-tail) orientation of exons (ANTISENSE).
12 2. Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013).
13 Combining data from cell line HEK 293 and human leukocyte data they identifie 1950 cirrnas IN HUMANS cirrnas in mouse, 81 of mapped to human circrnas. To explore if circrnas exist in other animal they used sequencing data from various C. Elegans developmental detecting 724 circrnas
14 82,15% Inside coding transcripts 2. Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013).
15 2. Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013).
16 They intersect their catalogue of circrnas with transcript annotations and then look for conserved matches to mirna families. They found that circrna antisense to the cerebellar degenerationrelated protein 1 transcript was densely bound by microrna. cirs-7 has 74 conserved micror-7 seed matches. 63 conserved in at least one other species indicating that micror-7 binding sites are probably functional
17 cirs-7 functions as a micror-7 suppressor. micror-7 disruption increase levels of mir- 7 targets.
18 cirs-7 micror-7 mrna Protein Expression
19 They knockdown cirs-7 in HEK293 cells and monitor expression of published mir-7 targets. All mir-7 targets were low expressed.
20 In humans mir-7 is highly expressed in neuronal tissues, pancreas and pituitary gland. They quantified levels of cirs-7 and mir-7 across mouse tissues.
21 Evidence: cirs-7 is exclusively for adult and embryonic mouse brain. cirs-7 and mir-7 seem to interact specifically in neuronal tissues. Mir-7 Control Control CiRS-7 Scrambled 2. Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013).
22 In zebrafish, knockdown of mir-7 or expression of cir-7 causes midbrain defects. Evidence: mir-7 loss-of-function causes a specific reduction of midbrain size. Control Knockdown mir-7 or cir-7 expression 2.Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013).
23 cirs-7 post-transcriptional regulator by binding mir-7 in brain cirs-7 harbours 74 mir-7 seed matches, often deeply conserved. cirs-7 and mir-7 share specific expression domains in mouse embryonic brain cirs-7 suppress mir-7 activity resulting in increased levels of mir-7 targets and size brain decreases.
24 mir-7 is a key regulator of various cancer pathways (Thomas B. Hansen et al). mir-7 is involved in Parkinson s disease by direct targeting of a- synuclein protein expression (Junn E et al). cirs-7 probably serves as a crucial factor in the functioning of neurons as well as a responsible candidate in neurological disorders and brain tumor development.
25 CircularRNAs are imortant post-transcriptional regulators of gene expression acting by direct base pairing to microrna. micrornas regulates the expression of mrna usually by suppression.
26 1. Gunter Meister. Argonaute proteins: functional insights and emerging roles.nature Reviews Genetics 14, (2013). 2. Memczak S, lens M, Elefsinioti A et al.circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 21;495(7441): (2013). 3. Thomas B. Hansen, Trine I. Jensen, Bettina H. Clausen et al. Natural RNA circles function as efficient microrna sponges. Nature 495, (2013). 4. Manel Esteller. Non-coding RNAs in human disease. Nature Reviews Genetics 12, (2011). 5. Capel, B. et al. Circular transcripts of the testis-determining gene Sry in adult mouse testis. Cell 73, (1993). 6. Junn E, Lee KW, Leong BS. Repression of alpha-synuclein expression and toxicity by microrna-7. Proc Natl Acad Sci U S A. 4;106(31): (2009). 7. Thomas B. Hansen, Jørgen Kjems and Christian K. Damgaard. Circular RNA and mir-7 in Cancer. Cancer Res 2013;73: (2013). 8. Jeremy E et al. A Circuitous Route to Noncoding RNA Vol. 340 no pp (2013).
27
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationBi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
More informationMicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationPhenomena first observed in petunia
Vectors for RNAi Phenomena first observed in petunia Attempted to overexpress chalone synthase (anthrocyanin pigment gene) in petunia. (trying to darken flower color) Caused the loss of pigment. Bill Douherty
More informationhe micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
More informationNOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationMicroRNA-mediated incoherent feedforward motifs are robust
The Second International Symposium on Optimization and Systems Biology (OSB 8) Lijiang, China, October 31 November 3, 8 Copyright 8 ORSC & APORC, pp. 62 67 MicroRNA-mediated incoherent feedforward motifs
More informationHigh AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationA Genetic Program for Embryonic Development
Concept 18.4: A program of differential gene expression leads to the different cell types in a multicellular organism During embryonic development, a fertilized egg gives rise to many different cell types
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationHOW AND WHY GENES ARE REGULATED HOW AND WHY GENES ARE REGULATED. Patterns of Gene Expression in Differentiated Cells
HOW AND WHY GENES ARE REGULATED 5 HOW AND WHY GENES ARE REGULATED 6 Every somatic cell in an organism contains identical genetic instructions. They all share the same genome. So what makes cells different
More informationMicroarray analysis reveals altered expression of multiple circular RNAs in the pathogenesis of esophageal squamous cell carcinoma
Original Article Microarray analysis reveals altered expression of multiple circular RNAs in the pathogenesis of esophageal squamous cell carcinoma Hao Chen, Bin Zheng, Lin Huang, Wei Zheng, Chun Chen
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationMicroRNAs: novel regulators in skin research
MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationMorphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
More informationCircular RNAs in cancer: old tree with new flowers
Review Article Circular RNAs in cancer: old tree with new flowers Yan Cao, Hui Cong, Xudong Wang, Rongrong Jing, Shaoqing Ju Center of Laboratory Medicine, Affiliated Hospital of Nantong University, Nantong
More informationGenomic explorations have offered us a great deal. Buried Treasure
18 Buried Treasure Noncoding DNA makes up the majority of our genomes, much of it being conserved and transcribed. Though the functions of small regulatory RNA molecules are well known, what about so-called
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More informationIslamic University Faculty of Medicine
Islamic University Faculty of Medicine 2012 2013 2 RNA is a modular structure built from a combination of secondary and tertiary structural motifs. RNA chains fold into unique 3 D structures, which act
More informationp53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs
p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs 2013, Katerina I. Leonova et al. Kolmogorov Mikhail Noncoding DNA Mammalian
More informationMilk micro-rna information and lactation
Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?
More informationPage 2. When sirna binds to mrna, name the complementary base pairs holding the sirna and mrna together. One of the bases is named for you. ...with...
Q1.Human immunodeficiency virus (HIV) particles have a specific protein on their surface.this protein binds to a receptor on the plasma membrane of a human cell and allows HIV to enter. This HIV protein
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationChapter 19: Viruses. 1. Viral Structure & Reproduction. What exactly is a Virus? 11/7/ Viral Structure & Reproduction. 2.
Chapter 19: Viruses 1. Viral Structure & Reproduction 2. Bacteriophages 3. Animal Viruses 4. Viroids & Prions 1. Viral Structure & Reproduction Chapter Reading pp. 393-396 What exactly is a Virus? Viruses
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,
More informationREGULATED AND NONCANONICAL SPLICING
REGULATED AND NONCANONICAL SPLICING RNA Processing Lecture 3, Biological Regulatory Mechanisms, Hiten Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice site consensus sequences do have
More informationCRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012
CRS4 Seminar series Inferring the functional role of micrornas from gene expression data CRS4 Biomedicine Bioinformatics Paolo Uva July 11, 2012 Partners Pharmaceutical company Fondazione San Raffaele,
More informationChapter 19: Viruses. 1. Viral Structure & Reproduction. 2. Bacteriophages. 3. Animal Viruses. 4. Viroids & Prions
Chapter 19: Viruses 1. Viral Structure & Reproduction 2. Bacteriophages 3. Animal Viruses 4. Viroids & Prions 1. Viral Structure & Reproduction Chapter Reading pp. 393-396 What exactly is a Virus? Viruses
More informationHerpesviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics
Herpesviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped icosahedral capsid (T=16), diameter 125 nm Diameter of enveloped virion 200 nm Capsid
More informationPost-transcriptional and translational regulation of mrna-like long non-coding RNAs by micrornas in early developmental stages of zebrafish embryos
BMB Reports BMB Rep. 2017; 50(4): 226-231 www.bmbreports.org Post-transcriptional and translational regulation of mrna-like long non-coding RNAs by micrornas in early developmental stages of zebrafish
More informationMicroRNAs and Cancer
MicroRNAs and Cancer MicroRNAs are an abundant class of small (20-25 nucleotides) non-protein coding RNAs that function as negative gene regulators. The human genome contains up to 1000 micrornas which
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationPotential functions and implications of circular RNA in gastrointestinal cancer (Review)
7016 Potential functions and implications of circular RNA in gastrointestinal cancer (Review) XIAOXIA REN, YONGXING DU, LEI YOU * and YUPEI ZHAO * Department of General Surgery, Peking Union Medical College
More informationReview Article Circular RNAs in cancer: novel insights into origins, properties, functions and implications
Am J Cancer Res 2015;5(2):472-480 www.ajcr.us /ISSN:2156-6976/ajcr0003997 Review Article Circular RNAs in cancer: novel insights into origins, properties, functions and implications Jingqiu Li 1,2, Jie
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
More informationNuclear micrornas and their unconventional role in regulating non-coding RNAs
Protein Cell 2013, 4(5): 325 330 DOI 10.1007/s13238-013-3001-5 MINI-REVIEW Nuclear micrornas and their unconventional role in regulating non-coding RNAs Hongwei Liang, Junfeng Zhang, Ke Zen, Chen-Yu Zhang,
More informationSupplemental Figure 1. Small RNA size distribution from different soybean tissues.
Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences
More informationA View of Pre-mRNA Splicing from RNase R Resistant RNAs
Int. J. Mol. Sci. 2014, 15, 9331-9342; doi:10.3390/ijms15069331 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms A View of Pre-mRNA Splicing from
More informationFocus on the Concepts
Focus on the Concepts ~is chapter describes how genes are controlled and how this relates to differentiation, development, cloning, signal transduction, and what can happen when cells escape their normal
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationIn recent years, numerous studies have documented pervasive transcription
REVIEW doi:10.1038/nature12986 The multilayered complexity of cerna crosstalk and competition Yvonne Tay 1, John Rinn 2,3,4 & Pier Paolo Pandolfi 1 Recent reports have described an intricate interplay
More informationProgress in research on the role of circular RNAs in lung cancer
Chen et al. World Journal of Surgical Oncology (2018) 16:215 https://doi.org/10.1186/s12957-018-1515-2 REVIEW Progress in research on the role of circular RNAs in lung cancer Yang Chen 2, Shuzhen Wei 1,
More informationAlternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
More informationHuman Genome Complexity, Viruses & Genetic Variability
Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you
More informationMicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationChapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
More informationProcessing of RNA II Biochemistry 302. February 13, 2006
Processing of RNA II Biochemistry 302 February 13, 2006 Precursor mrna: introns and exons Intron: Transcribed RNA sequence removed from precursor RNA during the process of maturation (for class II genes:
More informationCircular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.
More informationCross species analysis of genomics data. Computational Prediction of mirnas and their targets
02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods
More informationIdentification of mirnas in Eucalyptus globulus Plant by Computational Methods
International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational
More informationV16: involvement of micrornas in GRNs
What are micrornas? V16: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,
More informationCellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19
Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 1 MicroRNA biogenesis 1. Pri mirna: primary mirna 2. Drosha: RNaseIII 3. DCR 1: Dicer 1 RNaseIII
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationStudying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
More informationLesson Flowchart. Why Gene Expression Regulation?; microrna in Gene Regulation: an overview; microrna Genomics and Biogenesis;
micrornas Lesson Flowchart Why Gene Expression Regulation?; microrna in Gene Regulation: an overview; microrna Genomics and Biogenesis; How do micrornas function? micrornas and complex cellular circuits;
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationComputational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
More informationEpigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN
Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural
More informationClinical Development of ABX464, drug candidate for HIV Functional Cure. Chief Medical Officer ABIVAX
Clinical Development of ABX464, drug candidate for HIV Functional Cure Jean-Marc Steens, MD Chief Medical Officer ABIVAX 1 DECLARATION OF CONFLICT OF INTEREST GSK ABIVAX 2 ABX464: Mechanism of Action ABX464
More informationProcessing of RNA II Biochemistry 302. February 14, 2005 Bob Kelm
Processing of RNA II Biochemistry 302 February 14, 2005 Bob Kelm What s an intron? Transcribed sequence removed during the process of mrna maturation (non proteincoding sequence) Discovered by P. Sharp
More informationmicrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
More informationLast time we talked about the few steps in viral replication cycle and the un-coating stage:
Zeina Al-Momani Last time we talked about the few steps in viral replication cycle and the un-coating stage: Un-coating: is a general term for the events which occur after penetration, we talked about
More informationEukaryotic small RNA Small RNAseq data analysis for mirna identification
Eukaryotic small RNA Small RNAseq data analysis for mirna identification P. Bardou, C. Gaspin, S. Maman, J. Mariette, O. Rué, M. Zytnicki INRA Sigenae Toulouse INRA MIA Toulouse GenoToul Bioinfo INRA MaIAGE
More informationSupplementary information for: Human micrornas co-silence in well-separated groups and have different essentialities
Supplementary information for: Human micrornas co-silence in well-separated groups and have different essentialities Gábor Boross,2, Katalin Orosz,2 and Illés J. Farkas 2, Department of Biological Physics,
More informationGene Regulation - 4. One view of the Lactose Operon
Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression Differential Expression of Genes Prokaryotes and eukaryotes precisely regulate gene expression in response to environmental conditions In multicellular eukaryotes,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
More informationUtility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationCircular RNA hsa_circ_ may have potential as a prognostic biomarker for patients with hepatocellular carcinoma
ONCOLOGY LETTERS 17: 2091-2098, 2019 Circular RNA hsa_circ_0078602 may have potential as a prognostic biomarker for patients with hepatocellular carcinoma PEISI KOU 1*, CHENYUE ZHANG 2*, JIAMAO LIN 3 and
More informationFayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia
1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia
More informationHuman breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping
Human breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping Melanie Rae Simpson PhD candidate Department of Public Health and General Practice Norwegian University of
More informationTranscription and RNA processing
Transcription and RNA processing Lecture 7 Biology 3310/4310 Virology Spring 2018 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at the
More information[12-14], circrna. , circrna. 1 circrna. 1.1 circrna
31 6, 2018 11 Vol.31 No.6, Nov. 2018 JOURNAL OF NINGBO UNIVERSITY ( NSEE ) RNA 1, 2, 1* 1. 315020; 2., 315211 : RNA RNA, RNA RNA, 5 3 polya. RNA, circrna., circrna,. RNA,. RNA. : RNA; RNA; ; : R58 : A
More informationCircular RNA: a new star in neurological diseases
International Journal of Neuroscience ISSN: 0020-7454 (Print) 1543-5245 (Online) Journal homepage: http://www.tandfonline.com/loi/ines20 Circular RNA: a new star in neurological diseases Tao-Ran Li, Yan-Jie
More informationTRANSCRIPTION. DNA à mrna
TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationResearch Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
More informationmir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
More informationProfiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
More informationGénétique des DCP. Deciphering the molecular bases of ciliopathies. Estelle Escudier, INSERM U 681 Serge Amselem, INSERM U 654
Génétique des DCP Estelle Escudier, INSERM U 681 Serge Amselem, INSERM U 654 Deciphering the molecular bases of ciliopathies Linkage analyses Candidate gene approaches Chromosome abnormalities Comparative
More informationPolyomaviridae. Spring
Polyomaviridae Spring 2002 331 Antibody Prevalence for BK & JC Viruses Spring 2002 332 Polyoma Viruses General characteristics Papovaviridae: PA - papilloma; PO - polyoma; VA - vacuolating agent a. 45nm
More informationHuman Genome: Mapping, Sequencing Techniques, Diseases
Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer
More information