Banking Pancreas Samples
|
|
- Austin Williams
- 6 years ago
- Views:
Transcription
1 Banking Pancreas Samples NIHR Liverpool Pancreas Biomedical Research Unit Pancreatic Cancer Biobank Tissue Blood Juice Liverpool Cancer Tissue Bank Clinical Trials Samples : Good Clinical Practice for laboratories Urine Saliva Acute Pancreatitis Biobank Chronic Pancreatitis Biobank OMICS techniques: transcriptomic, proteomic, genomic, other Aim: to develop new diagnostic approaches, therapies and treatments for patients with pancreatitis and pancreatic cancer.
2 NIHR Liverpool Pancreas Biomedical Research Unit Severely debilitating disease Inflammation of the Pancreas Dysregulation of digestive enzyme secretion Incidence cases per million population/year in the UK Severity Mild AP may require brief hospitalization and has very low mortality rate Severe AP can result in patients being critically ill with multiple organ dysfunction requiring intensive care monitoring. Mortality rate between 10-30% depending on the presence of sterile versus infected necrosis Transcriptomic Approach Jane Armstrong, Brian Lane Proteomic Approach Vickie Elliott
3 Mutation Screening Approach in Chronic Pancreatitis Aim: to find SNPs associated with chronic pancreatitis in genes linked to Fatty Acid Ethyl Ester metabolism 97 CP, 98 Ctrl 0.18 Mb sequenced per patient SNP 26 top hits selected for further analysis
4 Imaging of tissue Confocal imaging Electron micrograph imaging Confocal image: (a) mouse pancreatic acinar cells, (b) human pancreatic tissue section Electron micrograph of human pancreatic tissue Awais Muhammad Diane Latawiec
5 EPC-TM-NET The aim of EPC-TM-NET is to improve survival of pancreatic cancer patients by development and validation of better therapeutic strategies targeting the tumour microenvironment rather than the tumour cell alone Neoptolemos, Greenhalf, Costello
6 Pancreatic tumours are stoma rich Alpha-Smooth muscle actin Myofibroblasts in pancreatic tumour
7 Stroma impairs delivery of drugs to pancreatic tumour cells Sub-cutaneous transplanted KPC tumors KPC pancreatic tumors Confocal microscopy of doxorubicin delivery to mouse pancreatic tumors Olive KP, Jacobetz MA, Davidson CJ, et al. Inhibition of Hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer. Science 2009;324:
8 EPC-TM-NET The aim of EPC-TM-NET is to improve survival of pancreatic cancer patients by development and validation of better therapeutic strategies targeting the tumour microenvironment rather than the tumour cell alone Aims: 1. Quantify stroma 2. Correlate stroma with serum markers Neoptolemos, Greenhalf, Costello
9 Quantifying Stroma Developed a prtocol for profiling stromal levels using Tissue Micro Arrays This involves quantification of the following components: 1. Epithelia component (Cytokeratin) 2. Fibrotic component (Alpha SMA) 3. Lymphocytes (CD3, CD8) 4. Endothelial component (vascular CD31; lymphatic D2-40) 5. Macrophage component (CD68, CD206, CD204, HLA-DR) Quantification is both manual and automated (Definiens Tissue Studio)
10 Protocol for analysis Cut into ~190 x 3µm depth sections Analyse sections at 4 levels within the TMA (n=44 patients) 15 antibodies were tested for specificity and quality of staining 6 antibodies were selected that gave greatest information regarding stromal level Cytokine analysis was undertaken for these 44 patients by analysing matching serum samples using Luminex
11 Automation using Definiens Tissue Studio 11
12 COMPARISON OF DEFINIENS AND MANUAL SCORING By eye Definiens 50% 62.52% 60% 63.63% Dr Katharine hand
13 LYMPHATIC VESSEL CLASSIFICATION Small lymphatic vessels Large lymphatic vessels Tumour associated lymphatic vessels Stroma associated lymphatic vessels [D2-40/ haematoxylin] 13
14 Pan Macrophage (CD68) M1 Macrophage (CD68 & HLA-DR) M2 Macrophage (CD206) 14
15 STROMAL CORRELATIONS WITH SERUM PROTEINS DETECTION OF CYTOKINES USING LUMINEX 15
16 VALIDATION 48 pt TMA has been constructed to validate the stromal-cytokine associations observed TMA sectioned at 4μm and stained at 4 sections with antibodies Matched serum samples have been analysed using 27-panel Luminex
17 Acknowledgements Katharine Hand Awais Muhammad Jane Armstrong Diane Latawiec Vicki Elliott Claire Jenkinson Anthony Evans Fiona Campbell Brian Lane Victoria Shaw Christopher Halloran Paula Ghaneh Bill Greenhalf Robert Sutton Dan Palmer Syed Hussain Ross Sibson John Neoptolemos
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationRath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published
More informationApplying Tissue Phenomics to Colorectal Clinical Questions
Applying Tissue Phenomics to Colorectal Clinical Questions International Symposium for Tissue Phenomics San Francisco October 2014 Peter Caie Senior Research Fellow University of St Andrews Systems Pathology
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More informationStergios Moschos, MD
Stergios Moschos, MD Clinical Associate Professor of Medicine Department of Medicine Division of Hematology/Oncology University of North Carolina at Chapel Hill Solid Tumor with one of the Highest Mutation
More informationHOW TO FIND THE PROJECT. Different ways Reference from your Mentor National Societies ESMO pathway Try to find your way
HOW TO FIND THE PROJECT Different ways Reference from your Mentor National Societies ESMO pathway Try to find your way Educational Fellowships Translational Research Unit Visit Clinical Unit Visits Palliative
More informationAs outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
More informationThe Role of Smo in Pancreatic cancer. Honors Research Thesis
The Role of Smo in Pancreatic cancer Honors Research Thesis Presented in Fulfillment of the Requirements for Graduation with Honors Research Distinction in Microbiology in the Undergraduate Colleges of
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationFOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH
FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response
More informationPhenotypic analysis of primary colorectal cancer to inform the management of metastatic disease
Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Paul Sutton CR(UK) Clinical Research Training Fellow Chester Colorectal Research Disclosures Holder of CR(UK)
More informationStem cells and Cancer. John Glod. December 2, 2009
Stem cells and Cancer John Glod Lehigh University Lehigh University December 2, 2009 The Tumor Microenvironment Littlepage et al Cancer Cell 2005 Cancer Stem Cells A small group of cells within the larger
More informationCD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
More informationBlockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease. Sunali Goyal MD
Blockade of Prolymphangiogenic VEGF-C suppresses Dry Eye Disease Sunali Goyal MD Mentor: Reza Dana, MD, MPH, MSc Claes Dohlman Chair in Ophthalmology Director, Cornea & Refractive Surgery Massachusetts
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationSupplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationChapter Pages Transmission
Chapter 19.2 Pages 442-448 Transmission Immunity There are three lines of defense: 1 The skin and mucous membranes are a nonspecific barrier to infection. 2 Macrophages attack pathogens that enter the
More information14 delegates from a variety of specialities attended the one-day workshop, held at Imperial College London.
Early Detection Biomarkers workshop Workshop Report Workshop summary 14 delegates from a variety of specialities attended the one-day workshop, held at Imperial College London. Chaired by Prof. Bob Brown
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationINTRODUCTION. This material is quoted from below PDF and modified.
INTRODUCTION While drug response profiling of cancer cells in two-dimensional culture has been a mainstay of predictive biomarker discovery and anti-cancer drug development, there are aspects of tumor
More informationPOLYTECHNIC OF NAMIBIA SCHOOL OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES BIOMEDICAL SCIENCES PROGRAMME
ᄋセM@セ @ POLYTECHNIC OF NAMIBIA SCHOOL OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES BIOMEDICAL SCIENCES PROGRAMME QUALIFICATION(S): Bachelor of Biomedical Sciences QUALIFICATION CODE: 50BBMS
More informationRole of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress
3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative
More informationLymphoid tissue. 1. Central Lymphoid tissue. - The central lymphoid tissue (also known as primary) is composed of bone morrow and thymus.
1. Central Lymphoid tissue Lymphoid tissue - The central lymphoid tissue (also known as primary) is composed of bone morrow and thymus. Bone Morrow - The major site of hematopoiesis in humans. - Hematopoiesis
More informationEndogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationAccelerate Your Research with Conversant Bio
Accelerate Your Research with Conversant Bio 400+ Participating MDs 50+ Partner sites for tissue procurement Continuous expansion of sourcing capabilities Closely monitored chain of custody Full regulatory
More informationCatechin s anti-angiogenic effects in epithelial ovarian cancer
Catechin s anti-angiogenic effects in epithelial ovarian cancer Brian Krug Background Epithelial ovarian cancer (EOC) is a common and lethal malignancy of the female reproductive tract (2). Often detected
More informationJournal Club Semmler Lorenz
Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to
More informationPoster No: 319. Dr Nicola Annels University of Surrey, UK
Phase I/II CANON study: Oncolytic immunotherapy for the treatment of Non- Muscle Invasive Bladder (NMIBC) Cancer using Intravesical Coxsackievirus A21. Poster No: 319 Dr Nicola Annels University of Surrey,
More informationExploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
University of Windsor Scholarship at UWindsor UWill Discover Undergraduate Conference UWill Discover 2016 Mar 29th, 4:00 PM - 5:00 PM Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
More informationTranslating Tissue Phenomics and Big Data Distillation to Clinical Histopathology
International Symposium for Tissue Phenomics 2016 Translating Tissue Phenomics and Big Data Distillation to Clinical Histopathology Dr Peter Caie Senior Research Fellow QUAntitative and Digital (QUAD)
More informationWelcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures.
Welcome Nanostring Immuno-Oncology Summit September 21st, 2017 1 FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. Agenda 4:00-4:30
More informationBiomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia
Biomarkers in drug discovery and development Margit Wissenbach, PhD Dir Business Development Scandinavia Aptuit: A Truly Integrated R&D Offering Integrated Discovery Integrated Development IND Candidate
More informationDeanery of Clinical Sciences Funding Challenge Launch
Deanery of Clinical Sciences Funding Challenge Launch Doug Gibson (Little France Postdoc Society) Kate Farrow (Deanery Postgraduate Manager) 12.30 Welcome, food and drink 12.40-13.00 Introduction to Funding
More informationBiomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
More informationSupplementary Information
Supplementary Information Lymphatic endothelial cells support tumor growth in breast cancer Esak Lee a, Niranjan B. Pandey a, and Aleksander S. Popel a,b a Department of Biomedical Engineering, Johns Hopkins
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupporting Information
Supporting Information CD200 Expressing Human Basal Cell Carcinoma Cells Initiate Tumor Growth Chantal S Colmont 1, Antisar BenKetah 1, Simon H Reed 2, Nga Voong 3, William Telford 3, Manabu Ohyama 4,
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationSmall Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment
Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:
More informationFish Skin Grafts Promote Superior Cell Ingrowth Compared to Amnion Allografts, Human Cadaver Skin and Mammalian Extracellular Matrix (ECM)
Fish Skin Grafts Promote Superior Cell Ingrowth Compared to Amnion Allografts, Human Cadaver Skin and Mammalian Extracellular Matrix (ECM) Christopher L. Winters, DPM American Health Network Indianapolis,
More informationLurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients
Lurie Cancer Center (LCC) OncoSET: Bringing Real-Time Precision Medicine to Patients Massimo Cristofanilli, MD Professor of Medicine Associate Director of Translational Research and Precision Medicine
More informationWDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
More information16 Innate Immunity: M I C R O B I O L O G Y. Nonspecific Defenses of the Host. a n i n t r o d u c t i o n
ninth edition TORTORA FUNKE CASE M I C R O B I O L O G Y a n i n t r o d u c t i o n 16 Innate Immunity: Nonspecific Defenses of the Host PowerPoint Lecture Slide Presentation prepared by Christine L.
More informationComplex role for the immune system in initiation and progression of pancreatic cancer
Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v20.i32.11160 World J Gastroenterol 2014 August 28; 20(32): 11160-11181 ISSN 1007-9327
More informationPBS Class #2 Introduction to the Immune System part II Suggested reading: Abbas, pgs , 27-30
PBS 803 - Class #2 Introduction to the Immune System part II Suggested reading: Abbas, pgs. 15-25, 27-30 Learning Objectives Compare and contrast the maturation of B and T lymphocytes Compare and contrast
More informationTissue Microarray - Human Pancreas Carcinoma
Provitro GmbH Charitéplatz 1 tel +49.30.450 578 358 sales@provitro.de Charité Campus Mitte 10117 Berlin fax +49.30.450 578 919 www.provitro.de Tissue Microarray - Human Pancreas Carcinoma Cat.-No.: 401
More informationHigh throughput screening of nanotoxicity based on oxidative stress paradigm
December 11 28 High throughput screening of nanotoxicity based on oxidative stress paradigm Saji George Dr Andre Nel s lab Dept. of Medicine (Division of Nanomedicine) UCLA December 11 28 Growing nanotech
More informationTissue Microarray - Human Pancreas Carcinoma
Tissue Microarray - Human Pancreas Carcinoma Cat.-No.: PACA0909-2-OL (2 slides), PACA0909-5-OL (5 slides) Lot: 097P a b c d e f g h 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Technical Information: 96 Spots - Spot
More informationSupplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Soheila Sharghi-Namini 1, Evan Tan 1,2, Lee-Ling Sharon Ong 1, Ruowen Ge 2 * and H. Harry Asada 1,3
More informationDOWNLOAD OR READ : TUMOR BIOLOGY REGULATION OF CELL GROWTH DIFFERENTIATION AND GENETICS IN CANCER PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : TUMOR BIOLOGY REGULATION OF CELL GROWTH DIFFERENTIATION AND GENETICS IN CANCER PDF EBOOK EPUB MOBI Page 1 Page 2 tumor biology regulation of cell growth differentiation and genetics
More informationONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY. Brian W. Soper, Ph.D. Senior Technical Information Scientist
ONCO-HU TM MICE FOR IMMUNOTHERAPEUTIC DRUG DISCOVERY Brian W. Soper, Ph.D. Senior Technical Information Scientist Presentation Outline Capabilities Humanization Hu-NSG TM versus Hu-NSG TM -SGM3 Immuno-oncology
More informationLymphoid System: cells of the immune system. Answer Sheet
Lymphoid System: cells of the immune system Answer Sheet Q1 Which areas of the lymph node have most CD3 staining? A1 Most CD3 staining is present in the paracortex (T cell areas). This is towards the outside
More informationQuantitative analysis of mast cells in invasive ductal carcinoma
ISSN: 2347-3215 Volume 2 Number 12 (December-2014) pp. 91-96 www.ijcrar.com Quantitative analysis of mast cells in invasive ductal carcinoma M.N.Divyarani*, M.L.Harendra Kumar, B.V.Swaroop raj, and U.D.Manoranjan
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of Accreditation 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Eye Pathology 1 st Floor, Cayton Street Building UCL Institute of Ophthalmology 11-43 Bath Street
More informationA Tour of the Cell. Chapter 6. Active Lecture Questions for use with Classroom Response Systems Biology, Seventh Edition Neil Campbell and Jane Reece
Chapter 6 A Tour of the Cell Active Lecture Questions for use with Classroom Response Systems Biology, Seventh Edition Neil Campbell and Jane Reece Edited by William Wischusen, Louisiana State University
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationAbstract. Background. Objective
Molecular epidemiology of clinical tissues with multi-parameter IHC Poster 237 J Ruan 1, T Hope 1, J Rheinhardt 2, D Wang 2, R Levenson 1, T Nielsen 3, H Gardner 2, C Hoyt 1 1 CRi, Woburn, Massachusetts,
More informationBone Marrow Stroma in Myelodysplastic Syndromes
Bone Marrow Stroma in Myelodysplastic Syndromes Universidad de Salamanca Prof Mª M Consuelo del Cañizo Hematology Dept. University Hospital, Salamanca SPAIN Bone marrow stroma in MDS Introduction Mesenchymal
More informationChapter 16 Lymphatic System and Immunity. Lymphatic Pathways. Lymphatic Capillaries. network of vessels that assist in circulating fluids
Chapter 16 Lymphatic System and Immunity network of vessels that assist in circulating fluids closely associated with the cardiovascular system transports excess fluid away from interstitial spaces transports
More informationHuman Body. The student knows that the human body is made of systems with structure and functions that are related.
Human Body The student knows that the human body is made of systems with structure and functions that are related. Cells Cells are the smallest living structures. All living things are made up of one or
More informationWhole Blood. Lab 29A. Blood. Plasma. Whole Blood. Formed Elements. Plasma: Fluid component. Formed elements: Cells and fragments
Whole Blood Lab 29A. Blood Plasma: Fluid component Water (90%) Dissolved plasma proteins Other solutes Formed elements: Cells and fragments RBCs (carry Oxygen) WBCs (immunity) Platelets (cell fragments
More informationDigestive system L 4. Lecturer Dr. Firdous M. Jaafar Department of Anatomy/Histology section
Digestive system L 4 Lecturer Dr. Firdous M. Jaafar Department of Anatomy/Histology section objectives 1-Describe the structure of liver. 2-Define liver lobule, and identify its zones. 3-Define portal
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationLayered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue
Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to
More informationJournal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
More informationn A m I 8 I A U n I V ER SI TV"Y OF SCIEnCE AnD TECHnOLOGY3Y
n A m I 8 I A U n I V ER SI TV"Y OF SCIEnCE AnD TECHnOLOGY3Y FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES QUALIFICATION: BACHELOR OF BIOMEDICAL SCIENCES QUALIFICATION CODE: SOBBMS
More information40th European Congress of Cytology Liverpool, UK, 2-5 th October 2016
40th European Congress of Cytology Liverpool, UK, 2-5 th October 2016 EUS FNA of abdominal organs: An approach to reporting and triage for ancillary testing Date and time: Sunday 2 nd October 2016 15.00-16.30
More informationTRAINING PROGRAMME1 ST YEAR BDS CLASS (19 TH BDS COURSE) VENUE: LECTURE HALL NO 6
WEEK 1 19-12-2016 20-12-2016 21-12-2016 22-12-2016 Drill / PT / Games Drill / PT / Games Intro to curriculum & evaluation system Lt Col Umbreen Ahmed Homeostasis-I Homeostasis-II Cell Membrane / Cell organelle
More informationDIGESTIVE SYSTEM II ACCESSORY DIGESTIVE ORGANS
DIGESTIVE SYSTEM II ACCESSORY DIGESTIVE ORGANS Dr. Larry Johnson Texas A& M University Objectives Distinguish between the parotid and submandibular salivary glands. Understand and identify the structural
More informationPaneth Cells. Road Map to the Finish. No Review this Friday. Today 11/29 Finish digestion/accessory organs. Wednesday 12/1 Immune System I
Road Map to the Finish No Review this Friday Today 11/29 Finish digestion/accessory organs Wednesday 12/1 Immune System I Paneth Cells - base of intestinal glands -! large -! intense acidophilic granules
More informationDevelopment of Autonomous Control Mechanism for Patients Suffering Glycemic Abnormalities as a Result of Traumatic Injury or Critical Illness
Development of Autonomous Control Mechanism for Patients Suffering Glycemic Abnormalities as a Result of Traumatic Injury or Critical Illness Hava Siegelmann, Ph.D. Program Manager Information Innovation
More informationMAN IN HEALTH AND DISEASES
MAN IN HEALTH AND DISEASES TOPICS COVERED: DIGESTION, HOMOESTASIS AND IMMUNITY QUESTIONS WITH ANSWERS - 1 MARK 1. What is digestion? 2. Name the type of muscle present in the tongue. 3. What is uvula?
More informationSUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationRecent advances in breast cancers
Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response
More informationInterleukin-20 is associated with delayed healing in diabetic wounds
Interleukin-20 is associated with delayed healing in diabetic wounds Phillip Finley, PhD Integrated and Applied Sciences Program Biology and Statistics/Research Methodology Normal Healing Body s natural
More informationBIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationSupplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
More informationUnit title: The Immune Response System
Unit title: The Immune Response System Unit code: M/601/0228 QCF level: 5 Credit value: 15 Aim This unit develops an understanding of the function and manipulation of the immune system and its abnormalities.
More informationCHMP Oncology Working Party Workshop on: Histology Independent Indications in Oncology. Non-clinical models: Tumour Models - Proof of Concept
CHMP Oncology Working Party Workshop on: Histology Independent Indications in Oncology Non-clinical models: Tumour Models - Proof of Concept Edward C. Rosfjord Pfizer Worldwide R. & D. 14 December 2017
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationSecondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
More informationSupplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationReviewing Immunotherapy for Bladder Carcinoma In Situ
Reviewing Immunotherapy for Bladder Carcinoma In Situ Samir Bidnur Dept of Urologic Sciences, Grand Rounds March 1 st, 2017 Checkpoint Inhibition and Bladder Cancer, an evolving story with immunotherapy
More informationSupplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
More informationImmune system. Aims. Immune system. Lymphatic organs. Inflammation. Natural immune system. Adaptive immune system
Aims Immune system Lymphatic organs Inflammation Natural immune system Adaptive immune system Major histocompatibility complex (MHC) Disorders of the immune system 1 2 Immune system Lymphoid organs Immune
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More informationMugimane Manjanatha, Ph.D
Genotoxicity of Doxorubicin in F344 Rats by Combining the Comet Assay, Peripheral Blood Micronucleus Test, and Pathway-Focused Gene Expression Profiling Mugimane Manjanatha, Ph.D FDA/NCTR/DGMT DISCLAIMER
More informationFlow Cytometry Core Facility
Flow Cytometry Core Facility cell analysis & cell sorting Carolyn O Connor Director, Flow Cytometry Core Facility Salk.edu/fccf coconnor@salk.edu S A L K I N S T I T U T E F O R B I O L O G I C A L S T
More informationLiver Disease NASH/Fibrosis Model
Liver Disease NASH/Fibrosis Model Please contact: Dipti Deshpande PhD ddeshpande@woodlandpharma.com or Carol Gebert PhD cgebert@woodlandbiosciences.com 617-513-5280 Liver Diseases Comprise a Growing Market
More informationCurrent Fellow Projects
INDIANA UNIVERSITY Hematology Oncology Fellowship IU HEMATOLOGY ONCOLOGY FELLOWSHIP PROGRAM Division of Hematology Oncology IU department of Medicine 535 Barnhill Drive, Room 473 Indianapolis, IN 46202
More informationRelapse Cytogenetics Overview of ALLR3 genetics Introduction to the IntReALL trial. Anthony V Moorman Leukaemia Research Cytogenetics Group
Relapse Cytogenetics Overview of ALLR3 genetics Introduction to the IntReALL trial Anthony V Moorman Leukaemia Research Cytogenetics Group Overview of ALLR3 Parker et al, Lancet 2010; 376: 2009 17 Mitoxantrone
More informationNew therapies for pancreatic cancer treatment:
New therapies for pancreatic cancer treatment:! Targeting of surface proteins! Development of nanoparticles CRRET laboratory Growth factors and angiogenesis School of Sciences and Technologies University
More informationTEST INFORMATION Test: CarrierMap GEN (Genotyping) Panel: CarrierMap Expanded Diseases Tested: 311 Genes Tested: 299 Mutations Tested: 2647
Ordering Practice Jane Smith John Smith Practice Code: 675 Miller MD 374 Broadway New York, NY 10000 Physician: Dr. Frank Miller Report Generated: 2016-02-03 DOB: 1973-02-19 Gender: Female Ethnicity: European
More information