Genetics of Breast and Ovarian Cancer: Risk Assessment, Screening, and Risk Reduction
|
|
- Andrew Harris
- 6 years ago
- Views:
Transcription
1 Genetics of Breast and Ovarian Cancer: Risk Assessment, Screening, and Risk Reduction Forum INCA-ASCO sobre Cancer Hereditario e Predisposicao Genetica ao Cancer Jeffrey N. Weitzel, M.D. Professor of Oncology and Population Sciences Director, Department of Clinical Cancer Genetics Cancer Screening & Prevention Program City of Hope Comprehensive Cancer Center and Beckman Research Institute
2 How Much Breast and Ovarian Cancer Is Hereditary? 15% -20% Breast Cancer 5% 7% ~10% Sporadic Family clusters Hereditary Ovarian Cancer ASCO
3 Advancing Age Early Menarche Lack of Exercise Alcohol Risks Related to Breast Cancer Overweight Hormone Replacement Therapy Gender Late Menopause Diet Close Relative Benign Breast Disease Age at First Birth Genetics Education & Income Ionizing Radiation??? Genetics Passive Smoke Chemicals -Work -Home -Garden -Recreation
4 Genetics and the Brave New World - or is it old world?
5 Finding Mutations is Difficult and Expensive BRCA1: 22 coding exons, > 5,500 bp AGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGAT TTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGAC CACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAA GTTTCTATCATCCAAAGTATGGGCTACAGAAACCGTGCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAGCGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATC AAGAATTGTTACAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCCAGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAATACTCATGCCAGCTC ATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTAGCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAGAGAAAAGAATGGAATAAGCAGAAACTGCCATGCTCAGA GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGGTTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAATATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTA AAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAAGACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCCACAGATAATACAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTG GCAGTTCAAAAGACTCCTGAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAGAAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCACAATTCAAAA GGCTTTAAGTATCCAT GCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACTGAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAACCTGCAACTGGAGCCAAGAAGAGTAACAAGCCA AATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTTACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGA GAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGTCGGGAAACAAGCATA GAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCAC TGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACGAAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATCTGCTAGAGGAAAACTTTGAGGAACATTC AATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAAATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAGCAGAACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGG GTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATCCTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCATGCATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAAT GACATTAAGGAAAGTTCTGCTGTTTTTAGCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAGAGAACTTATCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCT ACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGA AAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAGAGCAAAGCATGGATTCAAACTTAGGTGAAGCAGCATCTGGGTGTGAGAGTGAAACAAGCGTCTCTGAAGACTGCTCAGGGCTATCCTCTCAGAGTGACATTTTAACCACTCAGCAGAGGGATACCATGCAACATAACCTGATAAAGCTCCAG CAGGAAATGGCTGAACTAGAAGCTGTGTTAGAACAGCATGGGAGCCAGCCTTCTAACAGCTACCCTTCCATCATAAGTGACTCTTCTGCCCTTGAGGACCTGCGAAATCCAGAACAAAGCACATCAGAAAAAGCAGTATTAACTTCACAGAAAAGTAGTGAATACCCTATAAGCCAGAATCCAGAAGGCCTTTCTGCTGACAAGTTTGAGGTGTCTGCAGATAGTTCTACCAGTAAAAAT AAAGAACCAGGAGTGGAAAGGTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAGAATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGCAACAGCTGGAAGAGTCTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAGAGGGAACCCCTTACCTGGAATCTGGAAT CAGCCTCTTCTCTGATGACCCTGAATCTGATCCTTCTGAAGACAGAGCCCCAGAGTCAGCTCGTGTTGGCAACATACCATCTTCAACCTCTGCATTGAAAGTTCCCCAATTGAAAGTTGCAGAAT CTGCCCAGAGTCCAGCTGCTGCTCATACTACTGATACTGCTGGGTATAATGCAATGGAAGAAAGTGTGAGCAGGGAGAAGCCAGAATTGACAGCTTCAACAGAAAGGGTCAACA AAAGAATGTCCATGGTGGTGTCTGGCCTGACCCCAGAAGAATTTATGCTCGTGTACAAGTTTGCCAGAAAACACCACATCACTTTAACTAATCTAATTACTGAAGAGACTACTCATGTTGTTATGAAAACAGATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAAAATGGGTAGTTAGCTATTTCTGGGTGACCCAGTCTATTAAAGAAAGAAAAATG CTGAATGAGCATGATTTTGAAGTCAGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAAAGCGAGCAAGAGAATCCCAGGACAGAAAGATCTTCAGGGGGCTAGAAATCTGTTGCTATGGGCCCTTCACCAACATGCCCACAGATCAACTGGAATGGATGGTACAGCTGTGTGGTGCTTCTGTGGTGAAGGAGCTTTCATCATTCACCCTTGGCACAGGTGTCCACCCAATTG TGGTTGTGCAGCCAGATGCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACCCGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGATACCCCAGATCCCCCACAGCCACTACTGACTGCAG BRCA2: 26 coding exons, > 11,000 bp GGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGA TTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAAATGCCT ATTGGATCCAAAGAGAGGCCAACATTTTTTGAAATTTTTAAGACACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGC AAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGT TTCATACACCAAAGTTTGTGAAGGGTCGTCAGACACCAAAACATATTTCTGAAAGTCTAGGAGCTGAGGTGGATCCTGATATGTCTTGGTCAAGTTCTTTAGCTACACCACCCACCCTTAGTTCTACTGTGCTCATAGTCAGAAATGAAGAAGCATCTGAAACTGTATTTCCTCATGATACTACTGCTAATGTGAAAAGCTATTTTTCCAATCATGATGAAAGTCTGAAGAAAAATGATAGAT TTATCGCTTCTGTGACAGACAGTGAAAACACAAATCAAAGAGAAGCTGCAAGTCATGGATTTGGAAAAACATCAGGGAATTCATTTAAAGTAAATAGCTGCAAAGACCACATTGGAAAGTCAATGCCAAATGTCCTAGAAGATGAAGTATATGAAACAGTTGTAGATACCTCTGAAGAAGATAGTTTTTCATTATGTTTTTCTAAATGTAGAACAAAAAATCTACAAAAAGTAAGAACTAGCAA GACTAGGAAAAAAATTTTCCATGAAGCAAACGCTGATGAATGTGAAAAATCTAAAAACCAAGTGAAAGAAAAATACTCATTTGTATCTGAAGTGGAACCAAATGATACTGATCCATTAGATTCAAATGTAGCACATCAGAAGCCCTTTGAGAGTGGAAGTGACAAAATCTCCAAGGAAGTTGTACCGTCTTTGGCCTGTGAATGGTCTCAACTAACCCTTTCAGGTCTAAATGGAGCCCAGA TGGAGAAAATACCCCTATTGCATATTTCTTCATGTGACCAAAATATTTCAGAAAAAGACCTATTAGACACAGAGAACAAAAGAAAGAAAGATTTTCTTACTTCAGAGAATTCTTTGCCACGTATTTCTAGCCTACCAAAATCAGAGAAGCCATTAAATGAGGAAACAGTGGTAAATAAGAGAGATGAAGAGCAGCATCTTGAATCTCATACAGACTGCATTCTTGCAGTAAAGCAGGCAATAT CTGGAACTTCTCCAGTGGCTTCTTCATTTCAGGGTATCAAAAAGTCTATATTCAGAATAAGAGAATCACCTAAAGAGACTTTCAATGCAAGTTTTTCAGGTCATATGACTGATCCAAACTTTAAAAAAGAAACTGAAGCCTCTGAAAGTGGACTGGAAATACATACTGTTTGCTCACAGAAGGAGGACTCCTTATGTCCAAATTTAATTGATAATGGAAGCTGGCCAGCCACCACCACACAG AATTCTGTAGCTTTGAAGAATGCAGGTTTAATATCCACTTTGAAAAAGAAAACAAATAAGTTTATTTATGCTATACATGATGAAACATCTTATAAAGGAAAAAAAATACCGAAAGACCAAAAATCAGAACTAATTAACTGTTCAGCCCAGTTTGAAGCAAATGCTTTTGAAGCACCACTTACATTTGCAAATGCTGATTCAGGTTTATTGCATTCTTCTGTGAAAAGAAGCTGTTCACAGAATGA TTCTGAAGAACCAACTTTGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTTCTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAAAACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCAGGAAGGACAGTGTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAG GTCTTGGCTGCAGCATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGAAAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGGATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACAAGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTC CCATGGAAAAGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTGAAAAATACATGAGAGTAGCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATCTAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATCCAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCT AATGAAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAAACAGACTTGACTTGTGTAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAACAAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAAATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCT TGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCTTAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAATCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAACAATATCCTACTAGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAAAGAAA CTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAGTTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATTTTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATTACAGAACTTTCTACTATATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATATTGCAGAAGAG TACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTGAGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAGACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGAAAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTAGGGGCTTTTAT TCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAGCTGTGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATCCAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAAATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATAATATTGAAATGACTAC TGGCACTTTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATACTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTGATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGCTATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAAACACTCAGATTAAAGAAGAT TTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAGAAGCATGTCATGGTAATACTTCAAATAAAGAACAGTTAACTGCTACTAAAACGGAGCAAAATATAAAAGATTTTGAGACTTCTGATACATTTTTTCAGACTGCAAGTGGGAAAAATATTAGTGTCGCCAAAGAGTCATTTAATAAAATTGTAAATTTCTTTGATCAGAAACCAGAAGAATTGCATAACTTTTCCTTAAATTCTGA ATTACATTCTGACATAAGAAAGAACAAAATGGACATTCTAAGTTATGAGGAAACAGACATAGTTAAACACAAAATACTGAAAGAAAGTGTCCCAGTTGGTACTGGAAATCAACTAGTGACCTTCCAGGGACAACCCGAACGTGATGAAAAGATCAAAGAACCTACTCTGTTGGGTTTTCATACAGCTAGCGGGAAAAAAGTTAAAATTGCAAAGGAATCTTTGGACAAAGTGAAAAACCTTT TTGATGAAAAAGAGCAAGGTACTAGTGAAATCACCAGTTTTAGCCATCAATGGGCAAAGACCCTAAAGTACAGAGAGGCCTGTAAAGACCTTGAATTAGCATGTGAGACCATTGAGATCACAGCTGCCCCAAAGTGTAAAGAAATGCAGAATTCTCTCAATAATGATAAAAACCTTGTTTCTATTGAGACTGTGGTGCCACCTAAGCTCTTAAGTGATAATTTATGTAGACAAACTGAAAAT CTCAAAACATCAAAAAGTATCTTTTTGAAAGTTAAAGTACATGAAAATGTAGAAAAAGAAACAGCAAAAAGTCCTGCAACTTGTTACACAAATCAGTCCCCTTATTCAGTCATTGAAAATTCAGCCTTAGCTTTTTACACAAGTTGTAGTAGAAAAACTTCTGTGAGTCAGACTTCATTACTTGAAGCAAAAAAATGGCTTAGAGAAGGAATATTTGATGGTCAACCAGAAAGAATAAATACTGC AGATTATGTAGGAAATTATTTGTATGAAAATAATTCAAACAGTACTATAGCTGAAAATGACAAAAATCATCTCTCCGAAAAACAAGATACTTATTTAAGTAACAGTAGCATGTCTAACAGCTATTCCTACCATTCTGATGAGGTATATAATGATTCAGGATATCTCTCAAAAAATAAACTTGATTCTGGTATTGAGCCAGTATTGAAGAATGTTGAAGATCAAAAAAACACTAGTTTTTCCAAAGT AATATCCAATGTAAAAGATGCAAATGCATACCCACAAACTGTAAATGAAGATATTTGCGTTGAGGAACTTGTGACTAGCTCTTCACCCTGCAAAAATAAAAATGCAGCCATTAAATTGTCCATATCTAATAGTAATAATTTTGAGGTAGGGCCACCTGCATTTAGGATAGCCAGTGGTAAAATCGTTTGTGTTTCACATGAAACAATTAAAAAAGTGAAAGACATATTTACAGACAGTTTCAGT AAAGTAATTAAGGAAAACAACGAGAATAAATCAAAAATTTGCCAAACGAAAATTATGGCAGGTTGTTACGAGGCATTGGATGATTCAGAGGATATTCTTCATAACTCTCTAGATAATGATGAATGTAGCACGCATTCACATAAGGTTTTTGCTGACATTCAGAGTGAAGAAATTTTACAACATAACCAAAATATGTCTGGATTGGAGAAAGTTTCTAAAATATCACCTTGTGATGTTAGTTTGG AAACTTCAGATATATGTAAATGTAGTATAGGGAAGCTTCATAAGTCAGTCTCATCTGCAAATACTTGTGGGATTTTTAGCACAGCAAGTGGAAAATCTGTCCAGGTATCAGATGCTTCATTACAAAACGCAAGACAAGTGTTTTCTGAAATAGAAGATAGTACCAAGCAAGTCTTTTCCAAAGTATTGTTTAAAAGTAACGAACATTCAGACCAGCTCACAAGAGAAGAAAATACTGCTATAC GTACTCCAGAACATTTAATATCCCAAAAAGGCTTTTCATATAATGTGGTAAATTCATCTGCTTTCTCTGGATTTAGTACAGCAAGTGGAAAGCAAGTTTCCATTTTAGAAAGTTCCTTACACAAAGTTAAGGGAGTGTTAGAGGAATTTGATTTAATCAGAACTGAGCATAGTCTTCACTATTCACCTACGTCTAGACAAAATGTATCAAAAATACTTCCTCGTGTTGATAAGAGAAACCCAGA GCACTGTGTAAACTCAGAAATGGAAAAAACCTGCAGTAAAGAATTTAAATTATCAAATAACTTAAATGTTGAAGGTGGTTCTTCAGAAAATAATCACTCTATTAAAGTTTCTCCATATCTCTCTCAATTTCAACAAGACAAACAACAGTTGGTATTAGGAACCAAAGTCTCACTTGTTGAGAACATTCATGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTAAAAATGGAAATTGGTAAAA CTGAAACTTTTTCTGATGTTCCTGTGAAAACAAATATAGAAGTTTGTTCTACTTACTCCAAAGATTCAGAAAACTACTTTGAAACAGAAGCAGTAGAAATTGCTAAAGCTTTTATGGAAGATGATGAACTGACAGATTCTAAACTGCCAAGTCATGCCACACATTCTCTTTTTACATGTCCCGAAAATGAGGAAATGGTTTTGTCAAATTCAAGAATTGGAAAAAGAAGAGGAGAGCCCCTTAT CTTAGTGGGAGAACCCTCAATCAAAAGAAACTTATTAAATGAATTTGACAGGATAATAGAAAATCAAGAAAAATCCTTAAAGGCTTCAAAAAGCACTCCAGATGGCACAATAAAAGATCGAAGATTGTTTATGCATCATGTTTCTTTAGAGCCGATTACCTGTGTACCCTTTCGCACAACTAAGGAACGTCAAGAGATACAGAATCCAAATTTTACCGCACCTGGTCAAGAATTTCTGTCTAA ATCTCATTTGTATGAACATCTGACTTTGGAAAAATCTTCAAGCAATTTAGCAGTTTCAGGACATCCATTTTATCAAGTTTCTGCTACAAGAAATGAAAAAATGAGACACTTGATTACTACAGGCAGACCAACCAAAGTCTTTGTTCCACCTTTTAAAACTAAATCACATTTTCACAGAGTTGAACAGTGTGTTAGGAATATTAACTTGGAGGAAAACAGACAAAAGCAAAACATTGATGGACAT GGCTCTGATGATAGTAAAAATAAGATTAATGACAATGAGATTCATCAGTTTAACAAAAACAACTCCAATCAAGCAGCAGCTGTAACTTTCACAAAGTGTGAAGAAGAACCTTTAGATTTAATTACAAGTCTTCAGAATGCCAGAGATATACAGGATATGCGAATTAAGAAGAAACAAAGGCAACGCGTCTTTCCACAGCCAGGCAGTCTGTATCTTGCAAAAACATCCACTCTGCCTCGAATC TCTCTGAAAGCAGCAGTAGGAGGCCAAGTTCCCTCTGCGTGTTCTCATAAACAGCTGTATACGTATGGCGTTTCTAAACATTGCATAAAAATTAACAGCAAAAATGCAGAGTCTTTTCAGTTTCACACTGAAGATTATTTTGGTAAGGAAAGTTTATGGACTGGAAAAGGAATACAGTTGGCTGATGGTGGATGGCTCATACCCTCCAATGATGGAAAGGCTGGAAAAGAAGAATTTTATA GGGCTCTGTGTGACACTCCAGGTGTGGATCCAAAGCTTATTTCTAGAATTTGGGTTTATAATCACTATAGATGGATCATATGGAAACTGGCAGCTATGGAATGTGCCTTTCCTAAGGAATTTGCT AATAGATGCCTAAGCCCAGAAAGGGTGCTTCTTCAACTAAAATACAGATATGATACGGAAATTGATAGAAGCAGAAGATCGGCTATAAAAAAGATAATGGAAAGGGATGACACAGC TGCAAAAACACTTGTTCTCTGTGTTTCTGACATAATTTCATTGAGCGCAAATATATCTGAAACTTCTAGCAATAAAACTAGTAGTGCAGATACCCAAAAAGTGGCCATTATTGAACTTACAGATGGGTGGTATGCTGTTAAGGCCCAGTTAGATCCTCCCCTCTTAGCTGTCTTAAAGAATGGCAGACTGACAGTTGGTCAGAAGATTATTCTTCATGGAGCAGAACTGGTGGGCTCTCCTG ATGCCTGTACACCTCTTGAAGCCCCAGAATCTCTTATGTTAAAGATTTCTGCTAACAGTACTCGGCCTGCTCGCTGGTATACCAAACTTGGATTCTTTCCTGACCCTAGACCTTTTCCTCTGCCCTTATCATCGCTTTTCAGTGATGGAGGAAATGTTGGTTGTGTTGATGTAATTATTCAAAGAGCATACCCTATACAGTGGATGGAGAAGACATCATCTGGATTATACATATTTCGCAAT GAAAGAGAGGAAGAAAAGGAAGCAGCAAAATATGTGGAGGCCCAACAAAAGAGACTAGAAGCCTTATTCACTAAAATTCAGGAGGAATTTGAAGAACATGAAGAAAACACAACAAAACCATATTTACCATCACGTGCACTAACAAGACAGCAAGTTCGTGCTTTGCAAGATGGTGCAGAGCTTTATGAAGCAGTGAAGAATGCAGCAGACCCAGCTTACCTTGAGGGTTATTTCAGTGAA GAGCAGTTAAGAGCCTTGAATAATCACAGGCAAATGTTGAATGATAAGAAACAAGCTCAGATCCAGTTGGAAATTAGGAAGGCCATGGAATCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGTTGCGTATTGTAAGCTATTCAAAAAAAGAAAAAGATTCAGTTATACTGAGTATTTGGCGTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAA GAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAACTCAGTATCAACAACTACCGGTTTCAGATGAAATTTTATTTCAGATTTACCAGCCACGGGAGCCCCTTCACTTCAGCAAATTTTTAGATCCAGACTTTCAGCCATCTTGTTCTGAGGTGGACCTAATAGGATTTGTCGTTTCTGTTGTGAAAAAAACA GGACTTGCCCCTTTCGTCTATTTGTCAGACGAATGTTACAATTTACTGGCAATAAAGTTTTGGATAGACCTTAATGAGGACATTATTAAGCCTCATATGTTAATTGCTGCAAGCAACCTCCAGTGGCGACCAGAATCCAAATCAGGCCTTCTTACTTTATTTGCTGGAGATTTTTCTGTGTTTTCTGCTAGTCCAAAAGAGGGCCACTTTCAAGAGACATTCAACAAAATGAAAAATACTGTT GAGAATATTGACATACTTTGCAATGAAGCAGAAAACAAGCTTATGCATATACTGCATGCAAATGATCCCAAGTGGTCCACCCCAACTAAAGACTGTACTTCAGGGCCGTACACTGCTCAAATCATTCCTGGTACAGGAAACAAGCTTCTGATGTCTTCTCCTAATTGTGAGATATATTATCAAAGTCCTTTATCACTTTGTATGGCCAAAAGGAAGTCTGTTTCCACACCTGTCTCAGCCCA GATGACTTCAAAGTCTTGTAAAGGGGAGAAAGAGATTGATGACCAAAAGAACTGCAAAAAGAGAAGAGCCTTGGATTTCTTGAGTAGACTGCCTTTACCTCCACCTGTTAGTCCCATTTGTACATTTGTTTCTCCGGCTGCACAGAAGGCATTTCAGCCACCAAGGAGTTGTGGCACCAAATACGAAACACCCATAAAGAAAAAAGAACTGAATTCTCCTCAGATGACTCCATTTAAAAAA TTCAATGAAATTTCTCTTTTGGAAAGTAATTCAATAGCTGACGAAGAACTTGCATTGATAAATACCCAAGCTCTTTTGTCTGGTTCAACAGGAGAAAAACAATTTATATCTGTCAGTGAATCCACTAGGACTGCTCCCACCAGTTCAGAAGATTATCTCAGACTGAAACGACGTTGTACTACATCTCTGATCAAAGAACAGGAGAGTTCCCAGGCCAGTACGGAAGAATGTGAGAAAAATAA GCAGGACACAATTACAACTAAAAAATATATCTAAGCATTTGCAAAGGCGACAATAAATTATTGACGCTTAACCTTTCCAGTTTATAAGACTGGAATATAATTTCAAACCACACATTAGTACTTATGTTGCACAATGAGAAAAGAAATTAGTTTCAAATTTACCTCAGCGTTTGTGTATCGGGCAAAAATCGTTTTGCCCGATTCCGTATTGGTATACTTTTGCTTCAGTTGCATATCTTAAAACT AAATGTAATTTATTAACTAATCAAGAAAAACATCTTTGGCTGAGCTCGGTGGCTCATGCCTGTAATCCCAACACTTTGAGAAGCTGAGGTGGGAGGAGTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACATAGGGAGACCCCCATCTTTACGAAGAAAAAAAAAAAGGGGAAAAGAAAATCTTTTAAATCTTTGGATTTGATCACTACAAGTATTATTTTACAATCAACAAAATG GTCATCCAAACTCAAACTTGAGAAAATATCTTGCTTTCAAATTGACACTA 2000 Myriad Genetic Laboratories
6 BRCA1 and BRCA2 On chromosomes 17 and 13, respectively Autosomal dominant transmission Proteins have a role in genomic stability >2,000 different mutations, polymorphisms, and variants distributed over both genes BRCA1 Nonsense Missense Splice-site Breast Cancer Information Core
7
8 BRCA1- and BRCA2-Associated Cancers: Lifetime Risk Breast cancer 50%-85% (often early age at onset) Second primary breast cancer 40%-60% Ovarian cancer 15%-45% Absolute risk likely to be higher than 10% - Prostate cancer Absolute risk 10% or lower - Male breast cancer - Fallopian tube cancer - Pancreatic cancer (BRCA2) ASCO
9 HEREDITARY BREAST AND OVARIAN CANCER Br- 45 BRCA1 4184del4 81 Br Br- >50 Pr Br Ov
10 Clinical Management of BRCA Mutation-Negative Patients Negative BRCA1 and/or BRCA2 test result NO Member of family w/ known BRCA1 or BRCA2 mutation? YES Emphasize empirically increased risk of breast and/or ovarian cancer Provide individualized risk-management plan Emphasize risk of sporadic cancer Encourage adherence to population screening guidelines ASCO
11 Contribution of known genes to explaining familial aggregation of breast cancer BRCA1 BRCA2 TP53 PTEN ATM CHEK2,BRIP1,PALB2 CASP8 Other familial risk factors (genes, environment) 8 WGA SNPs
12 Li-Fraumeni Syndrome Bilateral Breast, Breast, 36 Osteosarcoma, 22 Leukemia, 33 TP53-mutation carrier Affected with cancer Breast, 28 Soft tissue sarcoma, 7 Brain tumor, 32 Leukemia, 6 ASCO
13
14 Cancer Screening & Prevention Program Genetic Predisposition Testing Is a Multi-Step Process Identify at-risk patients Provide pretest counseling Obtain informed consent Select and offer test Disclose results Provide post-test counseling and follow-up
15 Caso 2 63a Ca Mama 47a Ca pélvico? 50a Ca Mama 48a Ca Mama 39a 37a 34a 38a Ca Mama Goldim/2011
16
17 When to Suspect a Hereditary Cancer Syndrome Cancer in 2 or more close relatives (on same side of family) Early age at diagnosis Multiple primary tumors Bilateral or multiple rare cancers Constellation of tumors consistent with specific cancer syndrome (eg, breast and ovary)
18 Influence of BRCA1 Genotype on Histopathology in Breast Cancer (BC) Less likely to express estrogen receptor or Her2/neu Have a high nuclear grade Show less tubule formation Have a higher mitotic count Medullary histology more common (~ 6%) More BRCA1 mutations in triple negative DCIS is less associated with BRCA1 than BRCA2 BRCA testing may be appropriate for triple negative BC or early onset DCIS, especially if family history of BC and/or OC Eisinger et al. Cancer Res 56:471, 1996; Claus et al, JAMA 293: , 2005; Breast Cancer Linkage Consortium. Lancet 349:1505, 1997; Kandel (ASCO), 2006
19 Clinical Management of BRCA Mutation-Positive Patient Cancer Screening & Prevention Program Possible testing for other adult relatives Positive BRCA1 or BRCA2 test result Prophylactic surgery Targeted Therapy Increased surveillance Chemoprevention
20 Dense Breast Tissue Size? Time Mammo
21 Warner et al. JCO 19: , 2001
22 MRI and Breast Cancer Detection in BRCA Carriers - Sensitivity N with mutations Invasive cancers % by MRI % by mammogram Warner (2004) Kriege (2004) MARIBS (2005) % 31% % 33% % 23% TOTAL % 30% Breast MRI is the standard of care for high risk patients
23 Cumulative incidence of early-stage (stages 0 to I) breast cancer in magnetic resonance imaging (MRI) screened cohort and comparison group (competing risk model). Diagnosis stage 0-I Warner E et al. JCO 2011;29:
24 Cumulative incidence of stages II to IV breast cancer in magnetic resonance imaging (MRI) screened cohort and comparison group (competing risk model). Diagnosis stage II-IV Warner E et al. JCO 2011;29:
25 New Primary Cancer Risk and Modifiers Among 491 BRCA Carriers 10-year contralateral breast cancer risk 43.4% for BRCA1; 34.6% for BRCA2 Age 50 at diagnosis: HR 0.63; 95% CI Tamoxifen use: HR 0.59; 95% CI Oophorectomy: HR 0.44; 95% CI year ovarian cancer risk after breast cancer: 12.7% for BRCA1, 6.8% for BRCA2 (p=0.03) Ovarian cancer was the cause of death in 25% of the Stage I breast cancer patients Metcalfe et al. J Clin Oncol 2004, 22: Gyn Onc 2005; 96:
26 Options for breast cancer patients with BRCA mutations Surgical options for the breast therapeutic mastectomy versus breast conservation therapy on affected breast risk reduction mastectomy on contralateral breast Hormonal risk reduction options BSO tamoxifen Screening mammography MRI
27 Decisions, decisions Oncologic Consultation Treatment Genetic Cancer Risk Assessment Prevention
28 Summary of various reproductive factors and the risk of breast cancer in BRCA mutation carriers* Reproductive factor BRCA1 BRCA2 Ref Age at menarche: >15 years versus <11 years OR (95%CI) P OR (95%CI) P 0.46 ( ) ( ) 0.32 [1] Parity versus nulliparity 0.94 ( ) ( ) 0.12 [2] Increasing parity: trend per childbirth Breastfeeding: >1 year versus no breastfeeding Oophorectomy: < age 40 versus no oophorectomy 0.94 ( ) ( ) 0.05 [2] 0.55 ( ) ( ) 0.83 [3] 0.36 ( ) ( ) 0.49 [4] * All from the same cohort of women: Control subjects N = 1816; Case subjects N = 1816; BRCA1=1405 (77.4%); BRCA2=411 (22.6%), for each group. 1. Kotsopoulos et al. (2005), Cancer Causes Control, 16: Cullinane et al. (2005), International Journal of Cancer, 117: Jernstrom et al. (2004), J Natl Cancer Inst, 96: Eisen et al. (2005), J Clin Oncol, 23:
29 Options for BRCA1, BRCA2 Carrier Prophylactic Oophorectomy Chemoprevention CA125 Screening CASH study. N Engl J Med 316:650, Rosenberg, et al. Am J Epidemiol 139:654, Ursin, et al. Cancer Res 57:3678, Narod, et al, NEJM 339:424, Narod, et al. JNCI 94:1773, 2002.
30 Penetrance of Ovarian, Fallopian Tube, and Peritoneal Cancer Among Carriers of BRCA1 and BRCA2 mutations Finch, A. et al. JAMA 2006;296:
31 Oophorectomy Reduces Ovarian Cancer, Breast Cancer, and All Cause Mortality Greatest breast cancer risk reduction among BRCA1 mutation carriers without a prior dx of breast cancer who had their oophorectomy < age 50 HR: 0.15 (95% CI )
32 Oophorectomy Reduces All-Cause Mortality
33 Cost Per Year of Life with Prophylactic Surgery Compared with Surveillance According to Different Cancer Risk Profiles Cancer Risks* RRSO RRM RRSO and RRM 85% BC, 63% OC Cost-saving $1,271 Cost-saving 56% BC, 16% OC Cost-saving $ 336 Cost-saving NOTE: Calculated with future costs and years of survival discounted at a rate of 3%. Cost-saving denotes negative net costs and increased survival. Abbreviations: BC, breast cancer; OC, ovarian cancer; RRSO, risk reduction salpingo-oophorectomy; RRM, risk reduction mastectomy. *Risks represent the probability over 40 years of developing cancer in 30-year-old BRCA-positive patients. Grann et al. Decision Analysis of Prophylactic Mastectomy and Oophorectomy in BRCA1-Positive or BRCA2-positive Patients. JCO 16: , 1998
34 I M OUT OF ESTROGEN AND I AM NOT HAPPY ABOUT IT
35 HRT after RRSO in BRCA Carriers: Is it safe? Short term HRT after RRSO does not compromise breast cancer risk reduction Armstrong et al. J Clin Oncol 22: , 2005.
36 Genetic status is on the cusp of helping to determine composition of breast and ovarian cancer treatment regimens
37 Survival of epithelial invasive ovarian cancer patients by stage and BRCA mutation status Chetrit, A. et al. J Clin Oncol; 26:
38 The first targeted therapy for BRCA carriers Phase II therapeutic trials with relatively non-toxic oral PARP inhibitor in BRCA+ breast or ovarian cancer patients with recurrent disease
39 Poly (ADP-ribose) polymerase (PARP) A key regulator of DNA damage repair processes Involved in DNA base-excision repair (BER) Binds directly to DNA damage Produces large branched chains of poly(adp-ribose) Attracts and assists BER repair effectors XRCC1 PNK Polß Lig3
40 PARP inhibition and tumor-selective synthetic lethality DNA damage (SSBs) DNA replication (accumulation of DNA DSBs) PARP PARP inhibition Normal cell with functional HR pathway HR-deficient tumor cell (e.g. BRCA 1/2 -/- ) HR-mediated DNA repair Cell survival Tumor-selective cytotoxicity Cell death Impaired HRmediated DNA repair DSB, double-strand break; HR, homologous recombination SSB, single-strand break Farmer H et al. Nature 2005;434: Bryant HE et al. Nature 2005;434: McCabe N et al. Cancer Res 2006;66:
41 Best % change from baseline in target BC lesions by prior chemotherapy Olaparib 400 mg bid cohort ORR, n (%) 11 (42) CR, n (%) 1 (4) PR, n (%) 10 (39) Previous anthracycline, taxane and capecitabine Best % change from baseline * * * * * Increasing tumor shrinkage * 100 *Prior platinum Tx Tutt et al. J Clin Oncol 27:15s, 2009 (suppl; abstr 5500)
42 ASCO/NCCN Guidelines for Cancer Predisposition Testing Genetic test result will change medical care and is standard management Examples Familial adenomatous polyposis Multiple endocrine neoplasia 2 Von Hippel-Lindau disease Hereditary nonpolyposis colorectal cancer Hereditary breast and ovarian cancer APC RET VHL Gene MLH1, MSH2, MSH6 BRCA1, BRCA2 Modified from ASCO Statement. J Clin Oncol, 2003 ASCO
43 NCCN Guidelines consensus advice NCCN Guidelines Version
44
45 Summary: Hereditary Breast and Ovarian Cancer There are advances in protocols for screening (MRI) and risk reduction (RRSO, RRM, GnRHA) Prophylactic surgery reduces cancer risk Mastectomy reduces risk of breast cancer > 90% Oophorectomy reduces the risk of breast cancer > 50% Reduces all cause mortality Salpingo-oophorectomy reduces the risk of ovarian cancer > 80% Synthetic lethality is emerging as a targeted therapeutic strategy in BRCA-associated cancer
46 Summary (cont): Hereditary Breast and Ovarian Cancer Documented efficacy of interventions for BRCA mutation carriers drives medical necessity and liability issues, making GCRA a standard of care GCRA along with risk reduction interventions are costeffective tools for increasing quality-adjusted life
47 "He is a better physician that keeps diseases off us, than he that cures them being on us; prevention is so much better than healing because it saves the labour of being sick. Thomas Adams,1618
Germline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues
Germline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues Jeffrey N. Weitzel, M.D. Cancer Screening & Prevention Program Timeline of Important Events in DNA Patenting (Top) and
More informationGermline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues
Germline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues Jeffrey N. Weitzel, M.D. Cancer Screening & Prevention Program Risk Factors for Breast Cancer Aging Family history Early
More informationGermline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues
Germline Mutations Hereditary Breast and Ovarian Cancer Risk and Management Issues Jeffrey N. Weitzel, M.D. Cancer Screening & Prevention Program Risks Related to Breast Cancer Advancing Age! Early Menarche!
More informationHEREDITY & CANCER: Breast cancer as a model
HEREDITY & CANCER: Breast cancer as a model Pierre O. Chappuis, MD Divisions of Oncology and Medical Genetics University Hospitals of Geneva, Switzerland Genetics, Cancer and Heredity Cancers are genetic
More informationJill Stopfer, MS, CGC Abramson Cancer Center University of Pennsylvania
Jill Stopfer, MS, CGC Abramson Cancer Center University of Pennsylvania Aging Family history Early menarche Late menopause Nulliparity Estrogen / Progesterone use after menopause More than two alcoholic
More informationHereditary Gynecologic Cancer 15 Years of Progress
Hereditary Gynecologic Cancer 15 Years of Progress Bethan Powell, M. D. Kaiser Permanente UCSF Gynecologic Cancer Risk Program Hereditary Gynecologic Cancer Syndromes BRCA 1 and 2: ovarian Lynch: ovarian/endometrial
More informationThe Genetics of Breast and Ovarian Cancer Prof. Piri L. Welcsh
The Genetics of Breast Piri L. Welcsh, PhD Research Assistant Professor University of Washington School of Medicine Division of Medical Genetics 1 Genetics of cancer All cancers arise from genetic and
More informationHereditary Breast and Ovarian Cancer Rebecca Sutphen, MD, FACMG
Hereditary Breast and Ovarian Cancer 2015 Rebecca Sutphen, MD, FACMG Among a consecutive series of 11,159 women requesting BRCA testing over one year, 3874 responded to a mailed survey. Most respondents
More informationPrimary Care Approach to Genetic Cancer Syndromes
Primary Care Approach to Genetic Cancer Syndromes Jason M. Goldman, MD, FACP FAU School of Medicine Syndromes Hereditary Breast and Ovarian Cancer (HBOC) Hereditary Nonpolyposis Colorectal Cancer (HNPCC)
More informationPredictive and Diagnostic Testing for Cancer in Women. Aparna Rajadhyaksha MD
Predictive and Diagnostic Testing for Cancer in Women Aparna Rajadhyaksha MD Hereditary Cancer s in Women BRCA1 &2 Other Breast Cancer Genes Li Fraumeni PTEN CHEK2 BRCA1&2 t BRCA1 is part of a complex
More informationKey Recommendations. Gynecologic management of women with inherited risk of gynecologic cancer
Gynecologic management of women with inherited risk of gynecologic cancer C. Bethan Powell MD Kaiser Permanente Northern California Gynecologic Oncology Program Lead, Kaiser Permanente Northern California
More informationManagement of BRCA Positive Breast Cancer. Archana Ganaraj, MD February 17, 2018 UPDATE ON WOMEN S HEALTH
Management of BRCA Positive Breast Cancer Archana Ganaraj, MD February 17, 2018 UPDATE ON WOMEN S HEALTH The number of American women who have lost their lives to breast cancer outstrips the total number
More informationInherited Breast and Ovarian Cancer: 20 Years of Progress and Future Directions
Inherited Breast and Ovarian Cancer: 20 Years of Progress and Future Directions Noah D. Kauff, MD, FACOG Director, Clinical Cancer Genetics Duke Cancer Institute / Duke University Health System Disclosures
More informationRisk-reducing Surgery in BRCA mutation carriers
Risk-reducing Surgery in BRCA mutation carriers Daerim St. Mary s Hospital Department of Surgery, Breast Care Center Hereditary Breast Ovarian Cancer Clinic Sung-Won Kim, MD, PhD, FACS Overview of HBOC
More informationObjectives. Case Study #1 1/28/14. A Collaborative Practice Approach to Genetic Testing in Cancer: Translating Science Into Clinical Practice
A Collaborative Practice Approach to Genetic Testing in Cancer: Translating Science Into Clinical Practice Heather Hampel, MS, CGC Associate Director, Division of Human Genetics Professor, Department of
More informationGermline Genetic Testing for Breast Cancer Risk
Kathmandu, Bir Hospital visit, August 2018 Germline Genetic Testing for Breast Cancer Risk Evidence-based Genetic Screening Rodney J. Scott Demography in New South Wales (total population ~ 7,000,000)
More informationProphylactic Mastectomy State of the Art
Memorial Sloan-Kettering Cancer Center 1275 York Avenue, New York, NY 10065 6 th Brazilian Breast Cancer Conference Sao Paulo, Brazil 9 March 2012 Prophylactic Mastectomy State of the Art Monica Morrow
More informationCarrier Frequency. Breast Cancer and Treatment Options in Patients with BRCA1/2 mutations. Olivia Pagani On behalf of Bella Kaufman
Breast Cancer and Treatment Options in Patients with BRCA1/2 mutations Olivia Pagani On behalf of Bella Kaufman Carrier Frequency Prevalence of an altered disease gene in a given population 1 Background
More informationBreast Cancer and Treatment Options in Patients with BRCA1/2 mutations. Olivia Pagani On behalf of Bella Kaufman
Breast Cancer and Treatment Options in Patients with BRCA1/2 mutations Olivia Pagani On behalf of Bella Kaufman Carrier Frequency Prevalence of an altered disease gene in a given population Background
More informationManagement of BRCA mutation carriers
Management of BRCA mutation carriers Clinical Case Presentation Shani Paluch-Shimon, MBBS, MSc Head, Breast Cancer Service for Young Women Oncology Institute Sheba Medical Center, Israel esmo.org DISCLOSURES
More informationHBOC Syndrome A review of BRCA 1/2 testing, Cancer Risk Assessment, Counseling and Beyond.
HBOC Syndrome A review of BRCA 1/2 testing, Cancer Risk Assessment, Counseling and Beyond. Conni Murphy, ARNP Cancer Risk Assessment and Genetics Program Jupiter Medical Center Learning Objectives Identify
More informationUpdates in Cancer Genetics & Genomics
Updates in Cancer Genetics & Genomics Jennifer R. Klemp, PhD, MPH, MA Associate Professor of Medicine, Division of Clinical Oncology Director, Cancer Survivorship Co-Program Leader, Cancer Prevention and
More informationAssessment and Management of Genetic Predisposition to Breast Cancer. Dr Munaza Ahmed Consultant Clinical Geneticist 2/7/18
Assessment and Management of Genetic Predisposition to Breast Cancer Dr Munaza Ahmed Consultant Clinical Geneticist 2/7/18 Overview The role of the Cancer Genetics team NICE guidelines for Familial Breast
More informationVirtual Journal Club. Ovarian Cancer. Reference Slides. Platinum-Sensitive Recurrent Ovarian Cancer: Making the Most of Emerging Targeted Therapies
Virtual Journal Club Ovarian Cancer Reference Slides Platinum-Sensitive Recurrent Ovarian Cancer: Making the Most of Emerging Targeted Therapies Mansoor R. Mirza, MD Copenhagen University Hospital Rigshospitalet
More informationInformation for You and Your Family
Information for You and Your Family What is Prevention? Cancer prevention is action taken to lower the chance of getting cancer. In 2017, more than 1.6 million people will be diagnosed with cancer in the
More informationBRCA mutation carrier patient: How to manage?
BRCA mutation carrier patient: How to manage? Clinical Case Presentation Katarzyna Sosińska-Mielcarek Department of Oncology and Radiotherapy University Clinical Center Gdansk, Poland esmo.org DISCLOSURE
More informationBSO, HRT, and ERT. No relevant financial disclosures
BSO, HRT, and ERT Jubilee Brown, MD Professor & Associate Director, Gynecologic Oncology Levine Cancer Institute at the Carolinas HealthCare System Charlotte, North Carolina No relevant financial disclosures
More informationHereditary Cancer Update Strengthening Linkages Workshop April 22, 2017
Hereditary Cancer Update Strengthening Linkages Workshop April 22, 2017 Renée Perrier, MD MSc FRCPC Clinical Assistant Professor University of Calgary, Department of Medical Genetics Medical Director,
More informationInherited Ovarian Cancer Diagnosis and Prevention
Inherited Ovarian Cancer Diagnosis and Prevention Dr. Jacob Korach - Deputy director Gynecologic Oncology (past chair - Israeli Society of Gynecologic Oncology) Prof. Eitan Friedman - Head, Oncogenetics
More informationBiology Response Controversies and Advances
Biology Response Controversies and Advances in BRCA related ovarian cancer Lessons learned and future directions Michael Friedlander The Prince of Wales Hospital and Royal Hospital for Women Sydney BREAST-CANCER
More informationPARP inhibitors for breast cancer
PARP inhibitors for breast cancer Mark Robson, MD Memorial Sloan Kettering Cancer Center Agenda Mechanism of action Clinical studies Resistance mechanisms Future directions Poly (ADP-ribose) Polymerases
More informationBreast Cancer Risk and Prevention
Diagnosis and Treatment of Patients with Primary and Metastatic Breast Cancer Breast Cancer Risk and Prevention Breast Cancer Risk and Prevention Versions 2003 2012: Schmutzler with Albert / Blohmer /
More informationAllinaHealthSystems 1
Overview Biology and Introduction to the Genetics of Cancer Denise Jones, MS, CGC Certified Genetic Counselor Virginia Piper Cancer Service Line I. Our understanding of cancer the historical perspective
More informationFactors Associated with Early Versus Late Development of Breast and Ovarian Cancer in BRCA1 and BRCA2 Positive Women
Texas Medical Center Library DigitalCommons@The Texas Medical Center UT GSBS Dissertations and Theses (Open Access) Graduate School of Biomedical Sciences 5-2010 Factors Associated with Early Versus Late
More informationBreast Cancer Statistics
1 in 8 Breast Cancer Statistics Incidence Mortality Prevalence 2 Breast Cancer Incidence Breast Cancer Mortality Breast Cancer Prevalence ~$100,000 Female Breast Anatomy Breasts consist mainly of fatty
More informationBreast Cancer Risk and Prevention
Diagnosis and Treatment of Patients with Primary and Metastatic Breast Cancer Breast Cancer Risk and Prevention Breast Cancer Risk and Prevention Version 2003: Kiechle / Schmutzler Versions 2004 2011:
More informationGermline Testing for Hereditary Cancer with Multigene Panel
Germline Testing for Hereditary Cancer with Multigene Panel Po-Han Lin, MD Department of Medical Genetics National Taiwan University Hospital 2017-04-20 Disclosure No relevant financial relationships with
More informationFAQ-Protocol 3. BRCA mutation carrier guidelines Frequently asked questions
ULast updated: 09/02/2015 Protocol 3 BRCA mutation carrier guidelines Frequently asked questions UQ: How accurate are the remaining lifetime and 5 year breast cancer risks in the table? These figures are
More information6/8/17. Genetics 101. Professor, College of Medicine. President & Chief Medical Officer. Hereditary Breast and Ovarian Cancer 2017
Genetics 101 Hereditary Breast and Ovarian Cancer 2017 Rebecca Sutphen, MD, FACMG Professor, College of Medicine President & Chief Medical Officer INVASIVE CANCER GENETICALLY ALTERED CELL HYPERPLASIA DYSPLASIA
More information1. Collaborative Group on Epidemiological Studies of Ovarian Cancer. Ovarian cancer and oral contraceptives: collaborative reanalysis of data from 45
1 2 3 1. Collaborative Group on Epidemiological Studies of Ovarian Cancer. Ovarian cancer and oral contraceptives: collaborative reanalysis of data from 45 epidemiological studies including 23,257 women
More informationGenetic Risk Assessment for Cancer
Genetic Risk Assessment for Cancer Jennifer Siettmann, MS CGC Certified Genetic Counselor Banner MD Anderson Cancer Center Objectives Describe the role of genetic counseling and genetic testing in patient
More informationpatient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015
patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 BRCA1 and BRCA2 Mutations Cancer is a complex disease thought to be caused by several different factors. A few types of cancer
More informationObjectives: Describe poly-adp-ribose polymerase (PARP) inhibitors mechanism of action.
1 2 3 Role of PARP Inhibitors in Metastatic Breast Cancer Catie Chatowsky, PharmD PGY1 Pharmacy Resident Disclosure: I have nothing to disclose. Objectives: Describe poly-adp-ribose polymerase (PARP) inhibitors
More informationOBJECTIVES 8/25/2017. An attempt to organize the chaos
High Risk for Breast Cancer and Genetics: Who? What? Where? When? An attempt to organize the chaos Presented at Winds of Change Conference November 3, 2017 by Carol Hager, MSN, CRNP and Allison Haener,
More informationBRCA2 gene. Associated Syndrome Name: Hereditary Breast and Ovarian Cancer syndrome (HBOC) BRCA2 Summary Cancer Risk Table. BRCA2 gene Overview
BRCA gene Associated Syndrome Name: Hereditary Breast and Cancer syndrome (HBOC) BRCA Summary Cancer Risk Table Male Breast GENETIC RISK Female Breast Elevated Risk Elevated Risk BRCA gene Overview Hereditary
More informationRisk Assessment, Genetics, and Prevention
Risk Assessment, Genetics, and Prevention Katherine D. Crew, MD MS Director, Clinical Breast Cancer Prevention Program Columbia University Medical Center 1 Outline Breast cancer risk factors Hereditary
More informationRole of genetic testing in familial breast cancer outside of BRCA1 and BRCA2
Role of genetic testing in familial breast cancer outside of BRCA1 and BRCA2 Introduction Most commonly diagnosed cancer in South African women and the second most commonly diagnosed cancer in Black women
More informationGEN ETICS AN D GEN OM ICS IN CANCER PREVENTION AN D TREATM EN T. Robert Nathan Slotnick MD PhD Director, Medical Genetics and Genomics
GEN ETICS AN D GEN OM ICS IN CANCER PREVENTION AN D TREATM EN T Robert Nathan Slotnick MD PhD Director, Medical Genetics and Genomics The Medical/Surgical/Radiation Oncologist s View of Genetics Cancer
More informationHereditary breast cancer who to refer to a cancer genetics clinic and how to counsel patients with
Hereditary breast cancer who to refer to a cancer genetics clinic and how to counsel patients with positive and negative results? SAMO Workshop Luzern 3./4.10.2014 Dr. med. Barbara Bolliger TumorTumor-
More informationHereditary Cancer Update: What do GPOs need to know?
Hereditary Cancer Update: What do GPOs need to know? Mary McCullum, RN, MSN, CON(C) Nurse Educator, Hereditary Cancer Program BC Cancer Agency October 1, 2016 Conflict of Interest Disclosure Nothing to
More informationSo, now, that we have reviewed some basics of cancer genetics I will provide an overview of some common syndromes.
Hello. My name is Maureen Mork and I m a Certified Genetic Counselor in the Clinical Cancer Genetics Program at The University of Texas MD Anderson Cancer Center. I ll be lecturing today on the Cancer
More informationRisk Assessment and Risk Management
Risk Assessment and Risk Management Epworth Benign Breast Disease Symposium Dr Laura Chin-Lenn 12 November 2016 Why identify those at increased risk of breast cancer? Should I be worried? 1 Why identify
More informationGenetic Risk Assessment for Cancer
Genetic Risk Assessment for Cancer Jennifer Siettmann, MS CGC Certified Genetic Counselor/Cancer Risk Counselor Banner Good Samaritan Cancer Screening & Prevention Program Objectives Describe the role
More informationBrian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology
Brian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology Epithelial Ovarian Cancer - Standard Current Treatment: Surgery with De-bulking + Platinum-Taxane based Chemotherapy - No
More informationGynecologic Cancers are many diseases. Gynecologic Cancers in the Age of Precision Medicine Advances in Internal Medicine. Speaker Disclosure:
Gynecologic Cancer Care in the Age of Precision Medicine Gynecologic Cancers in the Age of Precision Medicine Advances in Internal Medicine Lee-may Chen, MD Department of Obstetrics, Gynecology & Reproductive
More informationWhat All of Us Should Know About Cancer and Genetics
What All of Us Should Know About Cancer and Genetics Beth A. Pletcher, MD, FAAP, FACMG Associate Professor of Pediatrics UMDNJ- New Jersey Medical School Disclosures I have no relevant financial relationships
More informationGynecologic Cancers are many diseases. Speaker Disclosure: Gynecologic Cancer Care in the Age of Precision Medicine. Controversies in Women s Health
Gynecologic Cancer Care in the Age of Precision Medicine Gynecologic Cancers in the Age of Precision Medicine Controversies in Women s Health Lee-may Chen, MD Department of Obstetrics, Gynecology & Reproductive
More informationInhibidores de PARP Una realidad? dónde y cuando?
Inhibidores de PARP Una realidad? dónde y cuando? Alberto Ocana Hospital Universitario Albacete Centro Regional Investigaciones Biomédicas CIC-Salamanca DNA repair mechanisms DNA is continually exposed
More informationCancer Genomics 101. BCCCP 2015 Annual Meeting
Cancer Genomics 101 BCCCP 2015 Annual Meeting Objectives Identify red flags in a person s personal and family medical history that indicate a potential inherited susceptibility to cancer Develop a systematic
More informationBRCAplus. genetic testing for hereditary breast cancer
BRCAplus genetic testing for hereditary breast cancer Developed in collaboration with Fox Chase Cancer Center and the Arcadia University Genetic Counseling Program. Causes of Hereditary Breast Cancer familial
More informationReference #: SYS-PC-VPCI-CG-002. Origination Date: June 2012 Next Review Date: April 2019 Effective Date: April 2016
Oncology Service Line-Allina Health System-wide Consensus Guidelines: Identification of Breast Cancer Patients at Risk for Inherited Cancer Risks These guidelines apply to clinical interventions that have
More informationMANAGEMENT OF HIGH RISK BREAST PATIENTS DR PAMELA THOMPSON BREAST PHYSICIAN, FSH
MANAGEMENT OF HIGH RISK BREAST PATIENTS DR PAMELA THOMPSON BREAST PHYSICIAN, FSH HIGH RISK MANAGEMENT OBJECTIVES Be alert to FHx Breast and/or Ovarian cancer Know how to perform a risk assessment Be aware
More informationCentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION
CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION CentoCancer our most comprehensive oncogenetics panel for hereditary mutations Hereditary pathogenic variants confer an increased risk of developing
More informationChristine Garcia, MD 1, Liisa Lyon, MS 2, Ramey D. Littell, MD 1 and C. Bethan Powell, MD 1
American College of Medical Genetics and Genomics Comparison of risk management strategies between women positive for a BRCA variant of unknown significance and women with known BRCA deleterious mutations
More informationWHAT IS A GENE? CHROMOSOME DNA PROTEIN. A gene is made up of DNA. It carries instructions to make proteins.
WHAT IS A GENE? CHROMOSOME E GEN DNA A gene is made up of DNA. It carries instructions to make proteins. The proteins have specific jobs that help your body work normally. PROTEIN 1 WHAT HAPPENS WHEN THERE
More informationSo, Who are the appropriate individuals that should consider genetic counseling and genetic testing?
Hello, I m Banu Arun, Professor of Breast Medical Oncology and Co-Director of Clinical Cancer Genetics at the University of Texas MD Anderson Cancer Center. Today I will be discussing with you Hereditary
More informationDoes Cancer Run in Your Family?
Does Cancer Run in Your Family? A Patient s Guide to Hereditary Breast and Ovarian Cancer Syndrome What is Hereditary Cancer? Most cancers occur in people who do not have a strong family history of that
More informationHereditary Aspects of Pancreatic Cancer
Pancreatic Cancer Seminar San Francisco, CA Hereditary Aspects of Pancreatic Cancer Genetic Risk Assessment and Counseling for Familial Pancreatic Cancer February 3, 2016 Amie Blanco, MS, CGC Gordon and
More informationCancer statistics (US)
Disclosure I have no financial relationships to disclose Biology and Introduction to the Genetics of Cancer Vickie Matthias Hagen, MS, CGC Certified Genetic Counselor Virginia Piper Cancer Service Line
More informationCancer Prevention & Control in Adolescent & Young Adult Survivors
+ Cancer Prevention & Control in Adolescent & Young Adult Survivors NCPF Workshop July 15-16, 2013 Patricia A. Ganz, MD UCLA Schools of Medicine & Public Health Jonsson Comprehensive Cancer Center + Overview
More informationBREAST CANCER BREAST CANCER
BREAST CANCER George Raptis, M.D., M.B.A Division of Medical Oncology & Hematology College of Physicians & Surgeons Columbia University BREAST CANCER Epidemiology - Commonest cancer in women - About 235,000
More informationSpectrum of Care Options for Women at High Risk for Breast and Ovarian Cancer
Spectrum of Care Options for Women at High Risk for Breast and Ovarian Cancer Sheryl G.A. Gabram, MD, MBA, FACS Professor of Surgery, Emory University Director, High Risk Assessment Program Winship Cancer
More informationBreast Cancer: Selected Topics for the Primary Care Clinician
Breast Cancer: Selected Topics for the Primary Care Clinician Leah Karliner, MD MAS October 2009 Primary Care Medicine: Principles and Practice OUTLINE Incidence and Mortality Risk Factors and Risk Reduction/Prevention
More informationHereditary Cancer Risk Assessment for Gynecological Cancers. FarrNezhatMD.com
Hereditary Cancer Risk Assessment for Gynecological Cancers FarrNezhatMD.com Image credit: PLOS blogs 5-10% hereditary 10-20% 70-80% sporadic Genetic Changes and Cancer Cancer begins with a genetic
More informationCANCER GENETICS PROVIDER SURVEY
Dear Participant, Previously you agreed to participate in an evaluation of an education program we developed for primary care providers on the topic of cancer genetics. This is an IRB-approved, CDCfunded
More informationDr Marion Harris (Medical Oncologist)
Dr Marion Harris (Medical Oncologist) 1. Cancer genetic testing and surveillance for familial breast and colorectal cancer What does an FCC do? Collect, assess and VERIFY a FHx of cancer Questionnaire
More informationCorporate Medical Policy Genetic Testing for Breast and Ovarian Cancer
Corporate Medical Policy Genetic Testing for Breast and Ovarian Cancer File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_breast_and_ovarian_cancer 8/1997 8/2017
More informationBREAST CANCER. Dawn Hershman, MD MS. Medicine and Epidemiology Co-Director, Breast Program HICCC Columbia University Medical Center.
BREAST CANCER Dawn Hershman, MD MS Florence Irving Assistant Professor of Medicine and Epidemiology Co-Director, Breast Program HICCC Columbia University Medical Center Background Breast cancer is the
More informationTargeting DNA repair in BRCA 1/2 and Triple Negative Breast Cancer
Targeting DNA repair in BRCA 1/2 and Triple Negative Breast Cancer Andrew Tutt, MB ChB, PhD Consultant Oncologist/Director Breakthrough Breast Cancer Research Unit King s Health Partners Academic Health
More informationDieta Brandsma, Department of Neuro-oncology, Netherlands Cancer Institute, Amsterdam, The Netherlands
What is hot in breast cancer brain metastases? Dieta Brandsma, Department of Neuro-oncology, Netherlands Cancer Institute, Amsterdam, The Netherlands 8th Annual Brain Metastases Research and Emerging Therapy
More informationGenetic Panel Testing and Implications for Cancer Care
Genetic Panel Testing and Implications for Cancer Care Dana Zakalik, M.D. Nancy and James Grosfeld Cancer Genetics Center Professor, OUWB Medical School MCC Board of Directors Meeting September 28, 2016
More informationManaging Moderate Penetrance
Managing Moderate Penetrance Thomas Slavin, MD, FACMG Assistant Clinical Professor, Department of Medical Oncology, Division of Clinical Cancer Genetics Program Member, Cancer Control and Population Sciences
More information6 Week Course Agenda. Today s Agenda. Ovarian Cancer: Risk Factors. Winning the War 11/30/2016 on Women s Cancer Gynecologic Cancer Prevention
6 Week Course Agenda Winning the War 11/30/2016 on Women s Cancer Gynecologic Cancer Prevention Lee-may Chen, MD Director, Division of Gynecologic Oncology Professor Department of Obstetrics, Gynecology
More informationThe best way of detection of and screening for breast cancer in women with genetic or hereditary risk
The best way of detection of and screening for breast cancer in women with genetic or hereditary risk Ingrid Vogelaar Introduction Each year almost 1.2 million women are diagnosed with breast cancer worldwide.
More informationTargeted therapy & Tumor molecular profile. Anton Tikhonov V Bioinformatics Summer School, 2017
Targeted therapy & Tumor molecular profile Anton Tikhonov V Bioinformatics Summer School, 2017 What exactly is targeted therapy? It has target It was rationally designed Its target was discovered before
More informationInterpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining
Stains for Tumor Classification p53 p16 WT1 HMGA2 P53 Mutations are Ubiquitous in High Grade Serous Carcinoma Source Ahmed et al Australian Ovarian Cancer Study Cancer Genome Atlas Research Network Cases
More informationCorporate Medical Policy
Corporate Medical Policy Moderate Penetrance Variants Associated with Breast Cancer in File Name: Origination: Last CAP Review: Next CAP Review: Last Review: moderate_penetrance_variants_associated_with_breast_cancer_
More informationOverview and future horizons of PARP inhibitors in BRCAassociated. Judith Balmaña
Overview and future horizons of PARP inhibitors in BRCAassociated breast cancer Judith Balmaña PARP inhibitors: Mechanism of action Clinical development: Monotherapy In combination with chemotherapy Ongoing
More informationOverview of peculiarities and therapeutic options for patients with breast cancer and a BRCA germline mutation
Overview of peculiarities and therapeutic options for patients with breast cancer and a BRCA germline mutation Dr Niklas Loman PhD MD Consultant oncologist Skåne University Hospital Lund, Suecia Prognosis
More informationPrevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D.
Prevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D. Hereditary Cancer Center, Peking University Cancer Hospital 1 Breast cancer
More informationOvarian Cancer Causes, Risk Factors, and Prevention
Ovarian Cancer Causes, Risk Factors, and Prevention Risk Factors A risk factor is anything that affects your chance of getting a disease such as cancer. Learn more about the risk factors for ovarian cancer.
More informationProphylactic Mastectomy
Prophylactic Mastectomy Policy Number: Original Effective Date: MM.06.010 01/01/2009 Line(s) of Business: Current Effective Date: HMO; PPO 08/24/2012 Section: Surgery Place(s) of Service: Inpatient I.
More informationThe impact of hereditary breast and ovarian cancer (HBOC) syndrome testing on patient management and your practice
The impact of hereditary breast and ovarian cancer (HBOC) syndrome testing on patient management and your practice Use BRACAnalysis as a guide in your medical and surgical management BRACAnalysis testing
More informationExpert Interview: Inherited Susceptibility to Cancer with Dr. Nicoleta Voian
Expert Interview: Inherited Susceptibility to Cancer with Dr. Nicoleta Voian ANNOUNCER OPEN: Welcome to CME on ReachMD. This segment, entitled Inherited Susceptibility to Cancer: What Do Primary Care Providers
More informationpatient education Fact Sheet
patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations OCTOBER 2017 BRCA1 and BRCA2 Mutations Cancer is caused by several different factors. A few types of cancer run in families. These types are
More informationCase 1. BREAST CANCER From Diagnosis to Treatment: The Role of Primary Care
BREAST CANCER From Diagnosis to Treatment: The Role of Primary Care Leah Karliner, MD MAS University of California San Francisco Primary Care Medicine Update 2009 April 2009 Case 1 AR, a 60 year old African
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Fong PC, Boss DS, Yap TA, et al. Inhibition of poly(adp-ribose)
More informationBreast Cancer. Dr. Andres Wiernik 2017
Breast Cancer Dr. Andres Wiernik 2017 Agenda: The Facts! (Epidemiology/Risk Factors) Biological Classification/Phenotypes of Breast Cancer Treatment approach Local Systemic Agenda: The Facts! (Epidemiology/Risk
More informationBreast MRI: Friend or Foe?
Breast MRI: Friend or Foe? UCSF Postgraduate Course May 18, 2013 Cheryl Ewing, MD Clinical Professor of Surgery UCSF Department of Surgery APPLEGATE HAS DOUBLE MASTECTOMY IN CANCER SCARE DIAGNOSED WITH
More information