Zytomed Systems GmbH

Size: px
Start display at page:

Download "Zytomed Systems GmbH"

Transcription

1

2 Zytomed Systems GmbH Anhaltiner Straße Berlin hone Fax

3 2

4 Content ositive control list for primary antibodies... 5 Information about Zytomed Systems antibodies Selected rimary MAX-Line antibodies...66 Detection ZytoChem lus olymer detection kits and reagents Double Stain olymer detection kits ZytoChem lus Streptavidin Biotin detection kits and reagents Ancillary reagents Epitope retrieval Chromogenic substrates Diluents, buffers and miscellaneous Cell Control Arrays Cell Control Arrays Information Master list for Immunhistochemistry

5 4

6 Compilation of positive controls for primary antibodies used in immunohistochemistry Antigen/Antibody Beta rotein Zeta rotein ACTH Actin (Muscle) Actin (Muscle, an) Actin alpha (Sarcomeric) Actin alpha (Skeletal Muscle) Actin alpha (Smooth Muscle) Actinin alpha Adenovirus ADH-5 (Breast Marker Double Stain Cocktail) AF (Alpha Fetoprotein) Akt1 Akt1/2 Albumin (HSA) Aldh 1a1 (Alkohol Dehydrogenase 1) ALK /p80 (Anaplastic Lymphoma Kinase) Alpha-1-Antichymotrypsin Alpha-1-Antitrypsin (AAT) Alpha-2-Macroglobulin Amylin (eptide) Amyloid A Component Amyloid Beta (A4) Amyloid Beta-rotein Amyloid recursor rotein (A) Androgen Receptor Annexin A1 Annexin IV AC (Adenomatous olyposis Coli) ATM (Ataxia Telangiectasia Mutated) BAG-1/RA46/HA1 Bak Bax BCA-225 (BRST-1) BCL2 BCL6 BCL10 BCL-X BCL-XL BCR beta-hcg BG-1 recursor (Blood Group Antigen) BG-2 A (Blood Group Antigen) BG-3 B (Blood Group Antigen) BG-4 0 (Blood Group Antigen) BG-5 Lewis a (Blood Group Antigen) BG-6 Lewis b (Blood Group Antigen) BG-7 Lewis x (Blood Group Antigen) BG-8 Lewis y (Blood Group Antigen) BOB.1 BRCA1 C3d C4d CA 19-9 (Colon) CA 72.4 Antigen/TAG-72 (BRST-3) ositive control rostate carcinoma, liver tumour ituitary gland Skeletal muscle Skeletal muscle Skeletal muscle Skeletal muscle Leiomyosarcoma Skeletal muscle Adenovirus-infected tissue Fetal liver Liver Colon carcinoma, breast carcinoma ALK-positive lymphoma ancreas Kidney Alzheimer brain Alzheimer brain Brain rostate carcinoma Hairy cell leukaemia Liver Colon carcinoma Hodgkin s Lymphoma Hodgkin s lymphoma Hodgkin s lymphoma Drug-sensitive cell line (MCF-7), fetal intestine lacenta Kidney, ureter Kidney, ureter Kidney Colon, colon carcinoma Colon, colon carcinoma Colon carcinoma Kidney Colon carcinoma, lymph node Ovary carcinoma Graft rejection after kidney transplantation Graft rejection after kidney transplantation Colon carcinoma Antigen/Antibody CA 125 Antigen Cadherin (an) Cadherin 17 E-Cadherin Calbindin Calcitonin Caldesmon (HMW) Calmodulin-dependend rotein Kinase IV Calpain Calpastatin Calponin Calretinin Carbonic Anhydrase IX (CA IX) Caspase 1 Caspase 3 (C32) Caspase 3, cleaved (C32) Caspase 6 (MCH2) Caspase 8 (FLICE) Caspase 9 (Apaf-3) Caspase 10 (FLICE2) Catenin (alpha) Catenin (beta) Catenin (delta), p120 Catenin (gamma) (lakoglobin) Cathepsin D Cat Scratch Disease Caveolin-1 CCR7 CD1a CD2 CD3 CD3 zeta CD4 CD5 CD7 CD8 CD9 CD10 (CALLA) CD11c CD14 CD15 CD19 CD20 CD21 CD23 CD25 CD29 (Integrin-beta1) CD30 (Ki-1) CD31 (ECAM-1) CD34 (Endothelial cells) CD35 (CR1) (Dentritic Reticulum) ositive control Ovary carcinoma, colon carcinoma Colon carcinoma Ductal breast carcinoma Kidney Thyroid gland Skeletal muscle Brain Mesothelioma lacenta Clear cell RCC, colon carcinoma, apoptotic cells Stomach Stomach, tonsil Liver carcinoma Bartonella henselae-infected tissue Lung carcinoma Small intestine Histiozytosis X, tonsil Jurkat cells, tonsil, mantle cell lymphoma Small intestine, tonsil Hairy cell leukaemia, diffuse large-cell B-cell lymphoma Reed-Sternberg cells, tonsil Cerebellum Small intestine, tonsil lacenta, tonsil 5

7 Antigen/Antibody ositive control Antigen/Antibody ositive control CD40 CD43 (Leukosialin, Sialophorin) CD44 (H-CAM) CD45 (LCA) CD45RA CD45RB CD45RO CD56 (N-CAM, NKH1, SCLC) CD57 (NK cells) CD61 (Integrin beta 3) CD63 (NK-I/C3) CD68 (Macrosialin, macrophage antigen) CD74 CD79a CD95 (Fas, Apo-1) CD95L (FAS Ligand) CD178 CD99/MIC2 (Ewing s sarcoma) CD105 (Endoglin, TGF beta 1/3 Receptor) CD117 (c-kit) CD138 (Syndecan-1) CD163 CD274 (B7-H1) CDC25A CDC25B CDC25C CDC37 CDC47 Cdk2 (Cyclin dependent Kinase 2) Cdk4 (Cyclin dependent Kinase 4) Cdk5 (Cyclin dependent Kinase 5) CDw75 (B-Cell) CDX1 CDX2 CEA (Carcinoembryonic Antigen, CD66e) c-fos CFTR Cholecystokinin (26-33) Chromogranin A CITED-1 (CB, CREB-binding protein, p300) Claudin 1 Claudin 2 Claudin 3 Claudin 4 Claudin 5 Claudin 7 Claudin 10 c- Met (Hepatocyte Growth Factor Receptor) c-myc Collagen IV Connexin 43 COX-1 (Cyclooxygenase 1) COX-2 (Cyclooxygenase 2) c-ten CUL-1 CUL-2 CUL-3 Cyclin A Lymph node, tonsil Lymph node, tonsil Small-cell lung carcinoma, neuroblastoma Lymph node, tonsil Melanoma Small intestine rostate Ewing sarcoma, pancreas, stroma tumour (GIST) lasmocytoma, tonsil Lung, lung, skeletal muscle Thymus Liposarcoma Brain Small intestine Colon carcinoma Colon carcinoma Skin ancreas Small intestine ancreas apillary thyroid gland carcinoma Skin, breast carcinoma Colon carcinoma, ovary carcinoma, tonsil Small intestine Ovary carcinoma, tonsil Colon carcinoma, lung Colon carcinoma Brain, skeletal muscle Skin Heart Skin Colon carcinoma, breast carcinoma Liver carcinoma Cyclin B1 Cyclin D1 (BCL-1) Cyclin D3 Cyclin E Cyr61 Cystatin A Cytokeratin (Acidic) Cytokeratin (Basic) Cytokeratin (HMW) Cytokeratin (OSCAR) Cytokeratin (an) Cytokeratin an lus Cytokeratin (Wide Spectrum) Cytokeratin 4 Cytokeratin 5 Cytokeratin 5 & 6 Cytokeratin 5 & 8 Cytokeratin 5 & 14 Cytokeratin 6 Cytokeratin 7 Cytokeratin 8 Cytokeratin 8 & 18 Cytokeratin 10 Cytokeratin 10 & 13 Cytokeratin 13 Cytokeratin 14 Cytokeratin 15 Cytokeratin 16 Cytokeratin 17 Cytokeratin 18 Cytokeratin 19 Cytokeratin 20 Cytomegalovirus (CMV) Desmin Desmoglein 3 DHFR (Dihydrofolate Reductase) DNA olymerase B DOG1 Dysferlin Dystrophin E2F-1 Transcription Factor E2F-4 Transcription Factor E-Cadherin EGFr (Epidermal Growth Factor Receptor) Elastin EMA (Epithelial Membrane Antigen) enos (endothelial NO-Synthase) Epithelial Specific Antigen (ESA, Ep-CAM) Epstein Barr Virus (EBV)(Cocktail)(LM-1) ERAB ERCC1 ERG ERK1 (Extracellular Regulated Kinase) ERK2 (Extracellular Regulated Kinase) Estrogen Receptor Estrogen Receptor beta Ezrin (p81, Cytovillin) F4/80 Factor VIII Related Antigen (v. Willebrand Factor), tonsil, mantle cell lymphoma, tonsil, tonsil, placenta lacenta Brain Skin Skin Skin, prostate Bladder, skin, liver, breast carcinoma Skin, tonsil Skin, adenocarcinoma Skin Skin Skin Skin, prostate Skin, lung Skin, prostate Skin Skin, breast carcinoma Skin Skin, breast carcinoma Skin Skin Skin Skin, squamous cell carcinoma Skin Skin, squamous cell carcinoma Skin Skin, lung carcinoma, breast carcinoma Skin, colon carcinoma Colon carcinoma CMV-infected tissue Leiomyoma Squamous cell carcinoma of lung Testicles Gastrointestinal stroma tumour Skeletal muscle Skeletal muscle, tonsil, tonsil Ductal breast carcinoma lacenta, squamous cell carcinoma Heart Colon carcinoma, breast carcinoma Vascular endothelia EBV-infected tissue Alzheimer brain, lung carcinoma rostate carcinoma, ovary, endometrium Lung Mouse lung 6

8 Antigen/Antibody ositive control Antigen/Antibody ositive control Factor XIIIa (Fibrinoligase, lasma Transglutaminase) Fas-Associated hosphatase (FA-1) FBXW7 Endometrial adenocarcinoma FGFr1 (Fibroplast Growth Factor Receptor) FGFr2 (Fibroplast Growth Factor Receptor) FGFr3 (Fibroplast Growth Factor Receptor) Fibronectin Fli-1 FLI (Flice Inhibitor rotein) Follicular Dendritic Cells (FDC) FOXA1 FOX3 FOX4 (Forkhead BOX 4) Fra2 (Fos Related Antigen 2) FSH (Follicle Stimulating Hormone) Galectin-3 Gamma Glutamylcysteine Synthase (GCS) Gastrin GATA-3 GCDF-15 (BRST-2) GFA (Glial Fibrillary Acidic rotein) Glial Derived Neurotrophic Factor Glucagon GLUT1 (Glucose Transporter 1) GLUT3 (Glucose Transporter 3) Glutamat Decarboxylase 65 Glycophorin A Glycophorin C (CD236R) Glypican-3 GNB2 (Guanine nucleotide binding protein 2) Granulocyte (Myeloid Cell Marker) Granzyme B Growth Hormone, human (hgh) Hairy Cell Leukemia HCG (Human Chorionic Gonadotropin) HDAC1 (Histone Deacetylase 1) HDAC2 (Histone Deacetylase 2) Heat Shock rotein 60 (HS60) Heat Shock rotein 70 (HS70) Helicobacter pylori Hemoglobin A Hepatitis B Core Antigen (HBcAg) Hepatitis B Surface Antigen (HBsAg) Hepatitis C Virus (HCV) Hepatocyte (Hepar1) Hepatocyte Factor Homologue-4 HER2 (c-erbb-2) Extracellulär domain HER2 (c-erbb-2) Intracellulär domain HER3 (c-erbb-3) HER4 (c-erbb-4) Heregulin (NDF, GGF, Neuregulin) HGAL HHV8 (Human Herpes Virus) HIF-1 alpha ( Hypoxia Inducible Factor-1 alpha) HLA-DR, D, DQ, DX HMGA2 HV 16, L1 (apilloma virus Type 16) HSV I (Herpes Simplex Virus) lacenta lacenta Lung squamous cell carcinoma Liver cell carcinoma Kidney Angiosarcoma Colon carcinoma, placenta Lymph node, thyroid gland, tonsil Lung rostate carcinoma ituitary gland Thyroid gland Kidney, testicles Stomach Breast, urothelial carcinoma, salivary gland Astrocytome, brain Brain tumour ancreas lacenta ancreas Erythrocytes Liver cell carcinoma lacenta Lymph node, tonsil Hodgkin s lymphoma, tonsil ituitary gland lacenta H. pylori-infected tissue Bone marrow, spleen, placenta HBV-infected liver HBV-infected liver HCV-infected liver Liver Lung, skeletal muscle rostate carcinoma, lymph node HHV8-infected tissue Lymph node, tonsil HV 16-infected tissue HSV I-infected tissue HSV I & II (Herpes Simplex Virus) HSV II (Herpes Simplex Virus) Huntingtin-Interacting rotein 1 (HI-1) IgA IgD IgE IgG IgG4 IgM IKAROS Inhibin, alpha INI-1 inos (inducible NO-Synthase) Insulin Insulin-Like Growth Factor 1 Receptor (IGF1R) Insulin Receptor Substrate (IRS) Integrin beta 3 (CD61) Integrin beta 5 Involucrin IO-38 (roliferation Marker) JAK3 J-Chain Kappa Light Chain Ki-67 KOC/L523S K-RAS Ksp-Cadherin Ku (p70) Lactogen (lacental) Lambda Light Chain Laminin Langerin LK26 LMO2 LA (Lymphocyte hosphatase-associated hosphoprotein) Lung Related rotein, MV (Major Vault rotein) Luteinizing Hormone (LH) Lymphatic Endothelium Marker (D2-40, odoplanin) Lysozyme (Muraminidase) LYVE-1 Macrophage MAdL MAGE-1 Mammaglobin MART-1 (MelanA) Mast Cell Chymase Mast Cell Tryptase MCL-1 (Myeloid Cell Leukemia) MCM2 MCM5 MDM2 (Murine Double Minute 2) MDR1 (Multi Drug Resistance rotein, pg170j) MDR1+3 (Multi Drug Resistance rotein) MEF-2 HSV I & II-infected tissue HSV II-infected tissue Colon carcinoma Ovary, testicles Brain, astrocytome, endothelial cells Lung ancreas, placenta Colon carcinoma Small intestine, bone marrow Skin Spleen, tonsil Colon carcinoma, tonsil, tonsil rostate carcinoma, placenta Colon carcinoma Kidney lacenta Skin Langerhans cells Ovary carcinoma, adrenal gland ituitary gland Lymphatic endothelia (tonsil or appendix) Lymphatic endothelia (tonsil or appendix) Lymph node, tonsil Adenocarcinoma of lung Melanoma, tonsil Melanoma Cervix carcinoma, liposarcoma Colon, liver, kidney Adrenal cortex Brain 7

9 Antigen/Antibody ositive control Antigen/Antibody ositive control Melanoma (pan, MART-1+HMB45+Tyrosinase) Melanoma (HMB45) Melanoma Associated Antigen Mesothelin Mesothelioma MGMT Microglia (Iba1) MI-1alpha MiTF (Microphthalmia Transcription Factor) MLH1 MM-1 (Matrix Metalloproteinase 1) MM-2 (Matrix Metalloproteinase 2) MM-3 (Matrix Metalloproteinase 3) MM-7 (Matrix Metalloproteinase 7) MM-9 (Matrix Metalloproteinase 9) MM-10 (Matrix Metalloproteinase 10) MM-11 (Matrix Metalloproteinase 11) MM-14/MT-MM (Matrix Metalloproteinase 14) MM-15/MT2-MM (Matrix Metalloproteinase 15) MM-19 (Matrix Metalloproteinase 19) MM-23 (Matrix Metalloproteinase 23) MSH2 (MutS homologue 2) MSH3 (MutS homologue 3) MSH6 (MutS homologue 6) mtor MUC1 (Mucin 1, CD227) MUC2 (Mucin 2) MUC 5AC (Mucin 5AC) MUC18 (CD146) MUM1 rotein Myelin Basic rotein (MB) Myeloperoxidase (MO) Myo D1 Myogenin Myoglobin Myosin Napsin A NCK2 N-Cadherin (Cadherin 2) Nephrin Neurofilament H (200 kda) Neurofilament l & H (70/200 kda) NF kappa B (p50) NF kappa B (p65) (rel A) NGF-Receptor Nkx3.1 enos (endothelial NO-Synthase) inos (inducible NO-Synthase) unos (universal NO-Synthase) Notch-1 Nrf2 (TCF 11) NSE (Neuron Specific Enolase) Nucleophosmin (NM, Numatrin) Occludin Oct-1 (Octamer Binding Transcription Factor 1) Melanoma Melanoma Melanoma Mesothelioma Mesothelioma Colon carcinoma, tonsil Brain Lung carcinoma Melanoma Colon, melanoma, tonsil, placenta, placenta, placenta, placenta, placenta, placenta lacenta, placenta lacenta lacenta lacenta Colon carcinoma, tonsil Colon carcinoma, tonsil Colon carcinoma, tonsil Small intestine Stomach Angiosarcoma lasma cells, tonsil Brain Spleen, tonsil Rhabdomyosarcoma Skeletal muscle Skeletal muscle Adenocarcinoma of the lung ituitary gland Kidney Brain Brain Testicles lacenta, prostate Neurofibroma rostate carcinoma Vascular endothelia Lung lacenta Colon carcinoma, breast carcinoma lacenta ancreas Lung, A431 cells Oct-2 (Octamer Binding Transcription Factor 2) Oct-3/Oct-4 (Octamer Binding Transcription Factor 3/4) Oct-4 (Octamer Binding Transcription Factor 4) Osteopontin p14 (ARF) p14 (ARF)/p16 beta p15 (ink4b) p19 (ink4d) p21 (ros, WAF1) p27 (KI1) p34 (CDC2) p40 p53 p56 DOK2 p57 (KI2) p59 (Fyn) p62 DOK1 p63 p120 (Catenin delta) 504S (AMACR) 504S & p63 (IN Cocktail) an Basal-Cell Cocktail (p63 & Cytokeratin 5/14) an B Cocktail (CD20 & AX-5) ancreatic olypeptide ar-4 (rostate Apoptosis Response) arathyroid Hormone (TH) arathyroid Hormone Receptor 1 (THr) AX-2 AX-5 AX-8 axillin CNA (roliferating Cell Nuclear Antigen) D-1 DGF (latelet Derived Growth Factor) DGF (beta-chain) (latelet Derived Growth Factor) DGFr-alpha (CD140a) DGFr-beta (CD140b) D-L1 erforin hosphohistone H3 (phh3) hospholipase C beta 1 hospholipase C gamma 2 hosphoprotein (an) (S/T/Y) hosphotyrosine I3K/p85 I3K/p110 beta IN Cocktail (504S & p63) LA (lacental Alkaline hosphatase) ML rotein M22 (eripheral Myelin rotein) MS2 neumocystis carinii odocin odoplanin rogesterone Receptor Seminoma Seminoma Stomach carcinoma, osteosarcoma, cervix carcinoma Cervix carcinoma, fibroadenoma of breast Colon carcinoma Colon carcinoma Colon carcinoma, tonsil Colon carcinoma Squamous cell carcinoma of lung Colon carcinoma, breast carcinoma Colon carcinoma, placenta Lymphoma Skin, squamous cell carcinoma, prostate rostate carcinoma rostate carcinoma rostate, breast ancreas Alzheimer brain, myocardium arathyroid gland Kidney cell carcinoma Kidney cell carcinoma Colon carcinoma Lymph node, tonsil, lymph node Angiosarcoma Ovary carcinoma Ovary carcinoma, lung adenocarcinoma Spleen, tonsil Brain Hodgkin s lymphoma lacenta, lacenta rostate carcinoma Seminoma Lymphoma Nerve tissue Colorectal carcinoma Infected lung tissue Kidney Lymphatic endothelia 8

10 Antigen/Antibody ositive control Antigen/Antibody ositive control rohibitin rolactin (LTH, Luteotropic Hormone) rotein Gene roduct 9.5 (G9.5, UCH-L1) SA (rostate Specific Antigen) sa (rostatic Acid hosphatase) sca (rostate Stem Cell Antigen) SMA (rostate Specific Membrane Antigen) TEN (MMAC1,TE1) U.1 Ran Ras RCAS (BAG9) RCC1 (Regulator of Chromosome Condensation1) Renal Cell Carcinoma, gp200 (RCC) Ret Oncoprotein Retinoblastoma (Rb) R0C1 RA (p34) (Replication rotein A) RRM1 (Ribonucleotide Reductase M1 olypeptide) S6 Ribosomal S100 S100A4 S100 SALL4 SATB2 Secretagogin Serotonin Smad3 SMAD4 (DC4) Somatostatin Receptor 1 (SSTR1) Somatostatin Receptor 2A (SSTR2A) Somatostatin Receptor 5 (SSTR5) SOX2 SOX4 SOX9 SOX10 SOX11 SOX14 STAT3 STAT5a STAT6 Stathmin Surfactant Apoprotein-A Survivin Synaptophysin Syndecan-1 (CD138) Syntaxin 1A Synuclein (alpha) Synuclein (beta) (hosphoneuroprotein 14) Synuclein (an) TAG-72 (Tumor associated Glycoprotein) TAU T-bet TdT (Terminal Deoxynucleotidyl Transferase) Tenascin C TGF alpha (Transforming Growth Factor) TGF beta I (Transforming Growth Factor) Heart ituitary gland ancreatic carcinoma, tonsil rostate rostate rostate carcinoma rostate rostate, breast carcinoma Lymph node, tonsil Mamma, Hela- or A431 cells Colon carcinoma Kidney, kidney cell carcinoma Small intestine, Colon carcinoma, lacenta Melanoma, nerve tissue Melanoma Ductal adenocarcinoma of pancreas Seminoma Colorectal adenocarcinoma ancreas, brain Small intestine lacenta rostate ancreas including Langerhans cells ancreas including Langerhans cells Newborn brain Brain Testicles Malignant melanoma, melanocytes Mantle cell lymphoma Fetal tissue, breast carcinoma, Jurkat-cells Lung carcinoma Lymphoma ancreas Brain Brain Brain Colon carcinoma, breast carcinoma Alzheimer brain Thymus, hairy cell leukaemia Squamous cell carcinoma, tonsil, appendix Small intestine lacenta TGF beta I Receptor TGF beta II (Transforming Growth Factor) TGF beta III (Transforming Growth Factor) TGF beta III Receptor Thioredoxin Reductase 2 (TrxR2) Thrombin R Thrombospondin (TS) Thymidine hosphorylase Thymidylate Synthase Thyroglobulin Thyroid Hormone Receptor alpha 1/2 Thyroid Hormone Receptor beta Thyroid eroxidase (TO) TIE-1 TIM-1 (Tissue Inhibitor of Metalloproteinase) TIM-2 (Tissue Inhibitor of Metalloproteinase) TIM-3 (Tissue Inhibitor of Metalloproteinase) TNF (alpha) TNFr-2 (Tumor Necrosis Factor Receptor 2) Topoisomerase II (alpha) Topoisomerase II (beta) Toxoplasma gondii TRADD Transferrin Transglutaminase II Treponema pallidum Trypsin TSH (Thyroid Stimulating Hormone) TTF-1 (Thyroid Transcription Factor 1) Tubulin, alpha Tubulin, beta Tyrosinase Ubiquitin unos (universal NO-Synthase) Upstream Transcription Factor 2 (USF2) Urocortin Uroplakin II Uroplakin III VEGF-A (Vascular Endothelial Growth Factor) VEGFr-1 (Flt-1) VEGFr-2 (Flk-1) VEGFr-3 (Flt-4) VGSC Villin Vimentin Vinculin WNT1 WT1 (Wilm s Tumor rotein-1) XRCC1 XRCC2 ZA-70 ZO-3 lacenta Small intestine lacenta lacenta Colorectal carcinoma ancreas Colon carcinoma Thyroid gland Colon carcinoma Thyroid gland, ovary carcinoma Colon carcinoma, pancreas carcinoma, lacenta, lacenta Spleen, mantle cell lymphoma Infected brain tissue Liver carcinoma Liver Infected tissue ancreas ituitary gland Lung, thyroid gland Skin, lung Skin, lung Melanoma Alzheimer brain Umbilical cord, placenta ituitary gland Urothelial tissue Urothelial tissue Urothelial carcinoma, Astrocytome, haemangiosarcoma Angiosarcoma Angiosarcoma lacenta, breast carcinoma Brain Small intestine, kidney Skin, melanoma, sarcoma Skin Wilm s tumour Testicles Testicles Small intestine This information is supplied without liability. 9

11 Selected rimary for formalin-fixed paraffin-embedded tissue sections Zytomed Systems offers a broad range of antibodies suitable for diagnostics. Usually, our antibodies are available in concentrated and ready-to-use format. All antibodies mentioned here are suitable for FFE tissue sections. Ready-to-use antibodies: Designed for convenient handling these antibodies require no dilution or titration. Zytomed Systems offers 6 ml and 7 ml ready-to-use antibodies. MAX-Line antibodies: These high-volume ready-to-use antibodies offer cost-effective solutions for manually as well as automated working laboratories with high throughput. They are provided in a 16 ml format. Concentrated antibodies: To ensure highest flexibility in your immunohistochemistry protocol Zytomed Systems offers 1 ml, 0.5 ml and 0.1 ml concentrated antibodies. For a broad range of antibodies we offer protocol information for use on automated systems. These protocols were provided by customers and have already been approved in the day-to-day routine of an IHC laboratory. You can download a sheet with protocol recommendation from our homepage or ask your local dealer for more information. ACTH Clone: SM501 Ready-to-use - 7 ml Concentrate 1:400 1 ml Actin alpha (Skeletal Muscle) Clone: 5C5.F8.C7 Ready-to-use - 7 ml ml Concentrate 1:50 1 ml Actin alpha (Smooth Muscle) Clone: 1A4, MS, RT, CH re-treat.: - 6 ml MSG030 Ready-to-use - 16 ml BMS ml MSK030-05, IF Concentrate 1:100 1 ml MSK030 AF (Alpha-Fetoprotein) re-treat.: - Ready-to-use - 7 ml , WB Concentrate 1:200 1 ml

12 Akt1, phosphorylated Ser473 Ready-to-use - 7 ml ml Concentrate 1:25 1 ml ALK/p80 (Anaplastic Lymphoma Kinase) Clone: 5A4 Concentrate 1:100-1: ml MSK Alpha-1-Antichymotrypsin re-treat.: - Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml AF (Alpha-Fetoprotein) Clone: S154, BV, DG, G Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml AMACR lease refer to 504S. Amyloid Beta recursor rotein (A), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml Anaplastic Lymphoma Kinase lease refer to ALK/p80. = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 11

13 Androgen Receptor Clone: S107, MS, RT Annexin I (ANXA1) Ready-to-use - 7 ml , WB Concentrate 1:400 1 ml Ready-to-use - 7 ml ml Concentrate 1:25 1 ml Apo-1 (Fas) lease refer to CD95. A lease refer to Amyloid Beta recursor rotein. Arginase-1, BV, G, RB 0.1 ml , WB Concentrate 1: ml B-cells lease refer to CD19, CD20, CD23, CD79a, pan B Cocktail, AX. Bak, MS a.o. Ready-to-use - 7 ml Concentrate 1:300 1 ml Bax Clone: S47 Ready-to-use - 7 ml Concentrate 1:50 1 ml BCL1 lease refer to Cyclin D

14 BCL2 Clone: E17, *RUO 6 ml RBG016 Ready-to-use - 16 ml BRB055* 0.5 ml RBK Concentrate 1:25-1:100 1 ml RBK016 BCL6 Clone: GI191E/A8 Ready-to-use - 6 ml MSG037 Concentrate 1:100-1: ml MSK BCL10 Clone: S153, MS, RT, G, BV re-treat.: EDTA Ready-to-use - 7 ml ml Concentrate 1:100 1 ml Beta Catenin lease refer to Catenin (beta). BOB-1 Clone: S92 Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml BRST-2 lease refer to GCDF-15. C3d (Complement factor) Ready-to-use - 6 ml RBG034 Concentrate 1:100-1: ml RBK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 13

15 C4d (Complement factor) Clone: A24-T c-erbb1 Ready-to-use - 6 ml RBG061 Concentrate 1:100-1: ml RBK lease refer to EGFr. c-erbb2 lease refer to HER2. c-erbb3 lease refer to HER3. c-erbb4 lease refer to HER4. CA15-3 Antigen lease refer to MUC1. CA 9 (Carbonic Anhydrase 9) Clone: S106 Ready-to-use - 7 ml ml , WB Concentrate 1:100 1 ml CA 19-9 Antigen (Colon) Clone: 121SLE Ready-to-use - 6 ml MSG094 Concentrate 1:25-1: ml MSK Cadherin lease refer to E-Cadherin, N-Cadherin and Ksp-Cadherin. Cadherin 17 Clone: 1H3 re-treat.: EDTA Ready-to-use - 6 ml MSG105 Concentrate 1:100-1: ml MSK

16 Cadherin (an) Calcitonin Ready-to-use - 7 ml Concentrate 1:100 1 ml Clone: S17, MS, RT, DG, G, HS, SH Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100 1 ml RBK038 Caldesmon Clone: E-89 Ready-to-use - 6 ml RBG040 Concentrate 1:25-1: ml RBK CALLA lease refer to CD10. Calpain Clone: S81 Ready-to-use - 7 ml Concentrate 1:100 1 ml Calpastatin Clone: S82 Ready-to-use - 7 ml Concentrate 1:100 1 ml Calponin-1 Clone: E789Y Ready-to-use - 6 ml RBG041 Concentrate 1:50-1: ml RBK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 15

17 Calretinin 6 ml RBG003 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:100-1:200 1 ml RBK003 Carbonic Anhydrase IX (CA IX) lease refer to CA 9. Carcinoembryonic Antigen lease refer to CEA. Caspase-3, cleaved (C32), MS, RT Concentrate 1:50-1: ml RBK Cat Scratch Disease Clone: H2A10 Reactivity: Bartonella henselae Ready-to-use - 6 ml MSG015 Concentrate 1:50-1: ml MSK Catenin (beta), MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:250 1 ml Catenin delta lease refer to p120. Cathepsin D Ready-to-use - 7 ml Concentrate 1:50 1 ml

18 CB lease refer to CITED-1. CD1a Clone: E3622 or EDTA Ready-to-use - 6 ml RBG045 Concentrate 1:25-1: ml RBK CD2 re-treat.: EDTA Ready-to-use - 7 ml Concentrate 1:50 1 ml CD3 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:200-1:400 1 ml RBK015 CD3 Clone: S7, MS, *CE/IVD 6 ml RBG024 Ready-to-use - 16 ml BRB041* 0.5 ml RBK024-05, WB Concentrate 1:150-1:200 1 ml RBK024 CD4 Clone: S35 Ready-to-use - 16 ml BRB042 CD4 Clone: S35 or EDTA Ready-to-use - 7 ml Concentrate 1:50 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 17

19 CD5 Clone: S19 CD7 Ready-to-use - 6 ml RBG023 Concentrate 1:50-1: ml RBK Ready-to-use - 7 ml ml Concentrate 1: ml ml CD8 Clone: S16 Ready-to-use - 16 ml BRB036 CD8 Clone: C8/144B re-treat.: EDTA Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100 1 ml MSK011 CD10 (CALLA) Clone: 56C6 6 ml MSG070 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:25-1:50 1 ml MSK070 CD11c Clone: 5D11 or EDTA Ready-to-use - 6 ml MSG093 Concentrate 1:50-1: ml MSK

20 CD13 Clone: S182 re-treat.: EDTA Ready-to-use - 7 ml ml , FL Concentrate 1: ml ml CD14 Clone: ER3653 Concentrate 1:50-1: ml RBK CD15 Clone: MMA + BY87 Ready-to-use - 6 ml MSG108 Concentrate 1:50-1: ml MSK CD16a Clone: S189 re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml CD19 Clone: LE-CD19 Concentrate 1:100-1: ml MSK CD20 Clone: L26 re-treat.: optional: Citrate 6 ml MSG008 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:100-1:200 1 ml MSK008 = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 19

21 CD20 Clone: S32 re-treat.: - CD21 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100 1 ml RBK030 Clone: E3093 Ready-to-use - 6 ml RBG036 Concentrate 1:50-1: ml RBK CD22 Ready-to-use - 7 ml Concentrate 1:200 1 ml CD23 Clone: S163 Ready-to-use - 7 ml , WB 0.5 ml Concentrate 1:50 1 ml CD25 Clone: S176, MS, RT re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml CD30 (Ki-1) Clone: Ber-H2 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:40-1:80 1 ml MSK

22 CD31 (ECAM-1) Clone: JC70, *CE/IVD 6 ml MSG091 Ready-to-use - 16 ml BMS044* 0.5 ml MSK Concentrate 1:50-1:200 1 ml MSK091 CD31 (ECAM-1) Clone: S38, MS, G Ready-to-use - 7 ml Concentrate 1:50 1 ml CD34 Clone: QBEnd/10 re-treat.: optional: Citrate Ready-to-use - 16 ml BMS045 CD34 Clone: QBend/10 re-treat.: optional: Citrate Ready-to-use - 7 ml Concentrate 1:200 1 ml CD42b Clone: S202 re-treat.: EDTA Ready-to-use - 7 ml ml Concentrate 1: ml ml CD43 Clone: DF-T1, RT re-treat.: optional: Citrate Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK010 = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 21

23 CD45 (LCA) Clone: D7/26+2B11 6 ml MSG054 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:100 1 ml MSK054 CD56 Clone: RCD56, MS, RT re-treat.: EDTA 6 ml RBG050 Ready-to-use - 16 ml BRB ml RBK050-05, WB Concentrate 1:100-1:500 1 ml RBK050 CD61 Clone: 2f2 re-treat.: EDTA Ready-to-use - 6 ml MSG ml MSK Concentrate 1:25-1:100 1 ml MSK086 CD63 Clone: SM524 Ready-to-use - 7 ml Concentrate 1:200 1 ml CD66 lease refer to CEA. CD68 Clone: K1 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:50-1:100 1 ml MSK

24 CD79a Clone: JCB117 6 ml MSG036 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:100 1 ml MSK036 CD79a Clone: S18 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100-1:200 1 ml RBK029 CD79b Clone: S240 Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml CD95 (Fas, Apo-1) Ready-to-use - 7 ml Concentrate 1:60 1 ml CD95L (Fas Ligand), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml CD99 Ready-to-use - 7 ml Concentrate 1:200 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 23

25 CD105 (Endoglin, TGF-beta1/3-Receptor) CD117/c-kit Ready-to-use - 7 ml Concentrate 1:50 1 ml Ready-to-use - 7 ml Concentrate 1:100 1 ml CD138 (Syndecan-1) Clone: B-A38, G Ready-to-use - 6 ml MSG ml MSK Concentrate 1:200 1 ml MSK063 CD140a lease refer to DGFr-alpha. CD140b lease refer to DGFr-beta. CD163 Clone: S96 re-treat.: EDTA Ready-to-use - 7 ml Concentrate 1:100 1 ml CD169 Clone: S213 Ready-to-use - 7 ml ml Concentrate 1: ml ml CD178 lease refer to CD95L. 24

26 CD207 lease refer to Langerin. CD227 lease refer to MUC1 and EMA. CD246 lease refer to ALK/p80. CD274 lease refer to D-L1. CD278 Clone: S98, MS re-treat.: EDTA Ready-to-use - 7 ml ml Concentrate 1: ml ml CD279 lease refer to D1. CD308 lease refer to VEGFr-1 (Flt-1). CD309 lease refer to VEGFr-2 (Flk-1). CD310 lease refer to VEGFr-3 (Flt-4). CD324 lease refer to E-Cadherin. CD326 lease refer to Epithelial Specific Antigen. = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 25

27 CD331 CD333 lease refer to FGFR1 FGFR3. CD380 lease refer to HER2. CDH17 lease refer to Cadherin 17. Cdk4 (Cyclin dependent Kinase) Clone: DCS-31.2, MS, RT, WB, Concentrate 1:100-1: µg CDw325 lease refer to N-Cadherin. CDX-2 Clone: ER2764Y 6 ml RBG019 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:50-1:100 1 ml RBK019 CEA Clone: Col-1 re-treat.: - 6 ml MSG022 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:100-1:200 1 ml MSK022 Chromogranin A Clone: LK2H10, G re-treat.: - Ready-to-use - 16 ml BMS

28 Chromogranin A Clone: LK2H10, G re-treat.: - CITED-1 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:200-1:400 1 ml MSK062, MS, RT Ready-to-use - 7 ml Concentrate 1:100 1 ml ckit lease refer to CD117. Claudin 1, MS, RT Ready-to-use - 7 ml Concentrate 1:200 1 ml Claudin 4, MS Ready-to-use - 7 ml , WB Concentrate 1:200 1 ml Claudin 7, MS, RT Ready-to-use - 7 ml Concentrate 1:200 1 ml Connexin 43, MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:50 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 27

29 COX-1 COX-2 Ready-to-use - 7 ml Concentrate 1:100 1 ml , MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:100 1 ml CUL-1, Cullin 1 Ready-to-use - 7 ml ml Concentrate 1: ml Cyclin D1 Clone: S4, MS, RT or EDTA Ready-to-use - 6 ml RBG025 Concentrate 1:50-1: ml RBK Cyclin Dependent Kinase lease refer to Cdk. Cyclooxygenase lease refer to COX-1 und COX-2. Cytokeratin 5 & 14 Clone: XM26+LL002 6 ml MSG106 Ready-to-use - 16 ml BMS ml MSK Concentrated 1:50-1:100 1 ml MSK

30 Cytokeratin 5 & 6 Clone: D5/16B4 6 ml MSG034 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:100 1 ml MSK034 Cytokeratin 6 Clone: S87 Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml Cytokeratin 7 Clone: OV-TL 12/30 or enzymatic 6 ml MSG032 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:100-1:200 1 ml MSK032 Cytokeratin 8 & 18 Clone: IVT2000 or enzymatic Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK035 Cytokeratin 8 Clone: S102 Ready-to-use - 7 ml Concentrate 1:100 1 ml Cytokeratin 14 Clone: S53 Ready-to-use - 7 ml Concentrate 1:100 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 29

31 Cytokeratin 17 re-treat.: EDTA Cytokeratin 18 Ready-to-use - 7 ml , WB Concentrate 1:200 1 ml Clone: DC-10 or enzymatic Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK016 Cytokeratin 19 Clone: A53-B/A2.26 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:200-1:300 1 ml MSK017 Cytokeratin 20 Clone: KS 20.8 re-treat.: epsin or Trypsin Ready-to-use - 16 ml BMS037 Cytokeratin 20 Ready-to-use - 7 ml Concentrate 1:200 1 ml Cytokeratin (HMW) Clone: 34βE12, RB, DG, epsin 6 ml MSG027 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:25-1:50 1 ml MSK

32 Cytokeratin (OSCAR) Clone: OSCAR Ready-to-use - 6 ml Z Y Concentrate ~ 1:40 1 ml Z Y Cytokeratin Broad Spectrum Clone: AE1+AE3, MS, RT, DG, epsin 6 ml MSG019 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:100-1:200 1 ml MSK019 Cytokeratin an lus (AE1 & AE3 & 5D3) Clone: AE1+AE3+5D3, MS, RT, EDTA or proteolytic Ready-to-use - 6 ml MSG098 Concentrate 1:50-1: ml MSK D2-40 (Lymphatic Endothelium Marker) lease refer to odoplanin. Desmin Clone: D33, MS, RT 6 ml MSG053 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:25-1:50 1 ml MSK053 DOG1 Clone: S31 Ready-to-use - 7 ml ml Concentrate 1:100 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 31

33 DOG1 Dysferlin Ready-to-use - 7 ml Concentrate 1:100 1 ml Ready-to-use - 7 ml , WB Concentrate 1:50 1 ml E-Cadherin Clone: E700Y 6 ml RBG043 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:50-1:200 1 ml RBK043 E-Cadherin Clone: ECH-6 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100 1 ml MSK033 EGFR Clone: 2-1E1 re-treat.: epsin Concentrate 1:100-1: ml MSK EGFR (E746-A750del) Clone: S111 re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml

34 EGFR (L858R) Clone: S125 re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml EGFRvIII (Epidermal Growth Factor Receptor variant III) Clone: EGFRvIII.1 re-treat.: optional: Citrate Concentrate 1:20-1: ml MSK EMA (Epithelial Membrane Antigen) Clone: E29 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:200-1:400 1 ml MSK059 Endoglin lease refer to CD105. Ep-CAM lease refer to Epithelial Specific Antigen. Epidermal Growth Factor Receptor lease refer to EGFr. Epithelial Membrane Antigen lease refer to EMA. Epithelial Specific Antigen (Ep-CAM, ESA) Clone: Ber-E4 Ready-to-use - 16 ml BMS ml MSK Concentrated 1:100-1:200 1 ml MSK109 = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 33

35 Epithelial Specific Antigen (ESA, Ep-CAM) Clone: MOC-31 ERG Ready-to-use - 6 ml MSG ml MSK Concentrate 1:50-1:100 1 ml MSK066 Clone: 9FY Ready-to-use - 6 ml MSG090 Concentrate 1:50-1: ml MSK Erwing s Sarcoma Marker lease refer to CD99. ESA lease refer to Epithelial Specific Antigen. Estrogen Receptor Clone: S1, *CE/IVD 6 ml RBG018 Ready-to-use - 16 ml BRB053* 0.5 ml RBK Concentrate 1:200 1 ml RBK018 Estrogen Receptor (beta) Clone: G5/10, RT, MO Concentrate 1:10-1: ml MSK Factor XIIIa (Fibrinoligase, lasma Transglutaminase) Clone: E3372 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100-1:500 1 ml RBK

36 FAS lease refer to CD95. FBXW7 Clone: S237 re-treat.: EDTA Ready-to-use - 7 ml ml , FL Concentrate 1: ml ml FGFr1 (Fibroblast Growth Factor Receptor) Ready-to-use - 7 ml Concentrate 1:50 1 ml Fibrinoligase lease refer to Factor XIIIa. Fli-1, MS, RT Ready-to-use - 7 ml Concentrate 1:50 1 ml Flk-1 lease refer to VEGFr-2. Flt-1 lease refer to VEGFr-1. Flt-4 lease refer to VEGFr-3. FOX3 Clone: S97 Ready-to-use - 7 ml Concentrate 1:100 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 35

37 Gastrin-1 GATA3 Ready-to-use - 7 ml Concentrate 1:200 1 ml Clone: L ml MSG100 Ready-to-use - 16 ml BMS054 Concentrate 1:100-1: ml MSK GCDF-15 (Gross Cystic Disease Fluid rotein, BRST-2) Clone: E1582Y Ready-to-use - 6 ml RBG032 Concentrate 1:25-1: ml RBK GFA (Glial Fibrillary Acidic rotein) Clone: E672Y Ready-to-use - 6 ml RBG ml RBK Concentrate 1:25-1:100 1 ml RBK037 Glucagon Ready-to-use - 7 ml Concentrate 1:25 1 ml GLUT-1 (Glucose Transporter 1) or EDTA Ready-to-use - 16 ml BRB

38 GLUT-1 (Glucose Transporter 1) Clone: S168, BV, CK, MS, G, RB, RT Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml Glypican-3 Clone: 1G12 Ready-to-use - 6 ml MSG067 Concentrate 1:100-1: ml MSK Granzyme B, MS, RT Ready-to-use - 7 ml Concentrate 1:100 1 ml Gross Cystic Disease Fluid rotein lease refer to GCDF. Growth Hormone, Human (hgh), RT Ready-to-use - 7 ml ml Concentrate 1:200 1 ml Heat Shock rotein 70 (HS70), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml Helicobacter pylori Reactivity: Helicobacter pylori 6 ml RBG012 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:200-1:400 1 ml RBK012 = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 37

39 Hemoglobin A Clone: ER3608 HER1 Concentrate 1:100-1: ml RBK lease refer to EGFr. HER2 (c-erbb-2) Clone: TAB250 re-treat.: Ficin Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK003 HER2 (c-erbb-2) Extracellular domain Clone: S3 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100-1:200 1 ml RBK026 HER2 (c-erbb-2) Intracellular domain Clone: CB11 6 ml MSG044 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:200 1 ml MSK044 HER3 (c-erbb-3) Clone: S71 re-treat.: EDTA Ready-to-use - 7 ml Concentrate 1:100 1 ml HER4 (c-erbb-4), MS Ready-to-use - 7 ml , WB, I Concentrate 1:50 1 ml

40 HGAL (GCET2) Clone: ZSHG or EDTA HGH Ready-to-use - 6 ml MSG088 Concentrate 1:100-1: ml MSK lease refer to Growth Hormone, human. HHV-8 (Human Herpes Virus 8) Clone: 13B10 Reactivity: HHV8 or EDTA Ready-to-use - 6 ml MSG085 Concentrate 1:50-1: ml MSK HMB45 lease refer to Melanoma. HS lease refer to Heat Shock rotein. Human Herpes Virus lease refer to HHV. IgG4 Clone: ZSIGG4 Ready-to-use - 6 ml MSG084 Concentrate 1:100-1: ml MSK IKAROS Clone: S108 re-treat.: EDTA Ready-to-use - 7 ml Concentrate 1:100 1 ml Inducible NO-Synthase lease refer to inos. = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 39

41 Inhibin alpha INI-1 Ready-to-use - 7 ml Concentrate 1:100 1 ml Clone: ZSI1 Concentrate 1:100-1: ml MSK inos (inducible NO-synthase), MS, RT Ready-to-use - 7 ml Concentrate 1:100 1 ml Insulin Clone: 2D11, BV, G re-treat.: -, EL urified µg Integrin beta 3 lease refer to CD61. J-Chain Clone: S105, MS Ready-to-use - 7 ml Concentrate 1:100 1 ml Kappa Light Chain Clone: SM508 Ready-to-use - 7 ml Concentrate 1:200 1 ml

42 Kappa Light Chain Clone: S148 re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml Ki-1 lease refer to CD30. Ki-67 Clone: S6, MS 6 ml RBG027 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:200 1 ml RBK027 KOC/L523S (IM3) Ready-to-use - 7 ml ml Concentrate 1: ml ml Ksp-Cadherin Clone: ZSCA1 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK068 Lactogen, placental (hl) re-treat.: - Ready-to-use - 7 ml , WB Concentrate 1:250 1 ml Lactogenic Hormone lease refer to rolactin. = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 41

43 Lambda Light Chain Clone: S147 re-treat.: EDTA Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml Langerin Clone: 12D6 re-treat.: EDTA Ready-to-use - 6 ml MSG103 Concentrate 1:25-1: ml MSK LCA lease refer to CD45. Leukosialin lease refer to CD43. LI-Cadherin lease refer to Cadherin 17. LMO2 Clone: 1A9-3D11 Ready-to-use - 7 ml Concentrate 1:100 1 ml LTH lease refer to rolactin. Luteinizing Hormone (LH) Ready-to-use - 7 ml Concentrate 1:500 1 ml

44 Luteinizing Hormone (LH) Clone: S132 Ready-to-use - 7 ml ml Concentrate 1: ml ml Luteotropic Hormone (LTH) lease refer to rolactin. Lymphatic Endothelium Marker lease refer to odoplanin. LYVE-1 Concentrate 1:50-1: ml RBK Macrophage Antigen lease refer to CD68. Macrosialin lease refer to CD68. MAdL (Marker for Adenocarcinomas of the Lung) Clone: MAdL re-treat.: epsin Concentrate 1:100-1: ml MSK MAGE-1 Ready-to-use - 7 ml Concentrate 1:200 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 43

45 Mammaglobin Clone: 31A5 Mammaglobin Ready-to-use - 6 ml RBG022 Concentrate 1:100-1: ml RBK022-05, WB Concentrate 1:100-1: ml RBK MART-1 (Melan-A) Clone: M2-7C10 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK056 Mast Cell Tryptase Clone: AA1, MO, DG, FE re-treat.: - urified 1: µg Matrix Metalloproteinase lease refer to MM. MDM2 (Murine Double Minute 2) Clone: 3G187, WB, IF Concentrate 1:100-1: µg Melan A lease refer to MART-1. Melanoma (NKI/C3) lease refer to CD

46 Melanoma Associated Antigen KBA.62 Clone: KBA.62 Ready-to-use - 6 ml MSG080 re-treat.: EDTA Concentrate 1:25-1: ml MSK Melanoma Associated Antigen NL2 Clone: NL2 re-treat.: EDTA Ready-to-use - 6 ml MSG082 Concentrate 1:25-1: ml MSK Melanosome (HMB45) Clone: HMB45, G re-treat.: optional: Citrate 6 ml MSG007 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:100 1 ml MSK007 Mesothelin Clone: S74 Ready-to-use - 7 ml Concentrate 1:100 1 ml MIC2 lease refer to CD99. Mismatch Repair rotein lease refer to MLH, MSH and MS. MLH1 Clone: G168-15, MS Ready-to-use - 16 ml BMS033 MLH1 (including Antibody Diluent B) Clone: G168-15, MS or EDTA Concentrate 1:25-1: ml MSK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 45

47 MM-9 (Matrix Metalloproteinase 9, Gelatinase B) a.o. mmr rotein Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml lease refer to MLH, MSH and MS. MOC-31 lease refer to Epithelial Specific Antigen. MSH2 (MutS homologue 2, Mismatch Repair rotein) Clone: FE11, MS 6 ml MSG031 Ready-to-use - 16 ml BMS034 Concentrate 1:25-1: ml MSK MSH6 (MutS homologue 6, Mismatch Repair rotein) Clone: S93 re-treat.: EDTA Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml MUC1 (Mucin 1, EMA, CD227, CA 15-3) Clone: SM492 Ready-to-use - 7 ml Concentrate 1:100 1 ml MUC4 (Mucin 4) Clone: S241 Ready-to-use - 7 ml ml Concentrate 1: ml ml

48 MUC5AC (Mucin 5AC) Clone: 45M1, MS, RT, MO, G Ready-to-use - 7 ml ml Concentrate 1: ml ml Mycobacterium tuberculosis Reactivity: M. tuberculosis re-treat.: - urified - 1 ml Myeloperoxidase (MO) Clone: S72 Ready-to-use - 7 ml Concentrate 1:100 1 ml Myogenin Clone: MyG007, MS, RT, CT Ready-to-use - 6 ml MSG112 Concentrate 1:100 1: ml MSK Myoglobin re-treat.: - Ready-to-use - 7 ml , WB Concentrate 1:200 1 ml Myosin SM Heavy Chain Clone: SMMS-1 Ready-to-use - 6 ml MSG081 Concentrate 1:100-1: ml MSK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 47

49 N-Cadherin Clone: S90 re-treat.: EDTA Napsin A Ready-to-use - 7 ml ml Concentrate 1:100 1 ml Clone: BC15, MS, RT, DG, SH Ready-to-use - 6 ml RBG059 Concentrate 1:100-1: ml RBK Nestin Clone: S103 Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml Neurofilament L + H (70/200kD) Clone: 2F11 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:200 1 ml MSK060 Neuron Specific Enolase lease refer to NSE. NFkappaB (p50) Ready-to-use - 7 ml Concentrate 1:100 1 ml NFkappaB (p65) (rel A), RT, RB Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml

50 NKH1 lease refer to CD56. NKI/C3 lease refer to CD63. NKX3-1 Ready-to-use - 6 ml RBG062 Concentrate 1:50-1: ml RBK Notch-1, MS, RT Ready-to-use - 7 ml Concentrate 1:200 1 ml NSE (Neuron Specific Enolase) Ready-to-use - 7 ml Concentrate 1:300 1 ml Oct-2 (Octamer Binding Transcription Factor 2) Clone: ZS02 Ready-to-use - 6 ml MSG073 Concentrate 1:50-1: ml MSK Oct-3/Oct-4 (Octamer Binding Transcription Factor 3/4) Ready-to-use - 7 ml Concentrate 1:50 1 ml Oct-4 Concentrate 1:50-1: ml RBK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 49

51 p40 (ΔNp63) Clone: BC28 6 ml MSG097 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:100 1 ml MSK097 p40 (ΔNp63) or EDTA Ready-to-use - 6 ml RBG054 Concentrate 1:50-1: ml RBK p53 Clone: B53-12 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK020 p63 Clone: 4A4 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:50-1:75 1 ml MSK087 p S lease refer to IN Cocktail. p80 lease refer to ALK/p80. p120, Catenin (delta) Ready-to-use - 7 ml Concentrate 1:100 1 ml p300/cb (CB, CREB Binding rotein, p300) lease refer to CITED

52 504S (AMACR) re-treat.: EDTA 6 ml RBG002 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:50-1:100 1 ml RBK S + p63 lease refer to IN Cocktail. pan B-Cocktail (CD20 & AX-5) Clone: L26+polyclonal +Rabbit or EDTA 6 ml COG002 Ready-to-use - 16 ml BMS ml CO002K-05 Concentrate 1:50 1 ml CO002K pan Basalcell-Cocktail (p63 & Cytokeratin 5/14) Clone: 4A4+XM26+LL002 6 ml COG005 Ready-to-use - 16 ml BMS ml CO005K-05 Concentrate 1:50 1 ml CO005K arathyroid Hormone (TH) Clone: ZST re-treat.: optional: Citrate Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK072 arathyroid Hormone Receptor 1 (THr) Ready-to-use - 7 ml Concentrate 1:50 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 51

53 AX-5, MS, RT re-treat.: EDTA, *CE/IVD 6 ml RBG008 Ready-to-use - 16 ml BRB027* 0.5 ml RBK Concentrate 1:50 1 ml RBK008 AX-8 Clone: BC12, MS, RT, CT, DG Ready-to-use - 6 ml MSG107 Concentrate 1:100-1: ml MSK AX-8 Ready-to-use - 6 ml RBG047 Concentrate 1:25-1: ml RBK CNA (roliferating Cell Nuclear Antigen) Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml D-1 (CD279) re-treat.: EDTA Ready-to-use - 7 ml ml Concentrate 1: ml ml D-L1 (CD274) Clone: CAL10 Ready-to-use - 6 ml RBG063 Concentrate 1:100-1: ml RBK

54 DGFr alpha (latelet Derived Growth Factor Receptor Alpha, CD140a), MS Ready-to-use - 7 ml Concentrate 1:50 1 ml DGFr beta (latelet Derived Growth Factor Receptor Beta, CD140b), MS Ready-to-use - 7 ml Concentrate 1:50 1 ml DX-1 re-treat.: - Concentrate 1:10 1: ml ECAM-1 lease refer to CD31. G9.5 lease refer to rotein Gene roduct 9.5. IN Cocktail (504S+p63) +4A4 +Mouse or EDTA Ready-to-use - 6 ml COG ml CO001K-05 Concentrate 1:50 1 ml CO001K lacental Alkaline hosphatase lease refer to LA. lacental Lactogen lease refer to Lactogen. = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 53

55 LA (lacental Alkaline hosphatase) Clone: S15 Ready-to-use - 6 ml RBG ml RBK Concentrate 1:50-1:100 1 ml RBK056 latelet-derived Growth Factor Receptor lease refer to DGFr. MS2 Clone: A16-4, MS Concentrate 1:25-1: ml MSK MS2 Clone: ER3947 re-treat.: EDTA Ready-to-use - 6 ml RBG048 odoplanin (Lymphatic endothelium marker) Clone: D2-40 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:50-1:100 1 ml MSK057 rogesterone Receptor Clone: S42 6 ml RBG020 Ready-to-use - 16 ml BRB ml RBK Concentrate 1:200-1:400 1 ml RBK020 rohibitin Ready-to-use - 7 ml Concentrate 1:100 1 ml

56 rolactin (LTH, Luteotropic Hormone, Lactogenic Hormone), RT Ready-to-use - 7 ml Concentrate 1:200 1 ml roliferating Cell Nuclear Antigen lease refer to CNA. rostate Specific Antigen lease refer to SA. rostate Specific Membrane Antigen lease refer to SMA. rostate Stem Cell Antigen lease refer to sca. rotein Gene roduct 9.5 (G9.5, UCHL1) re-treat.: EDTA Ready-to-use - 6 ml RBG064 Concentrate 1:100-1: ml RBK rotein Gene roduct 9.5 (G9.5, UCHL1) Ready-to-use - 7 ml Concentrate 1:200 1 ml SA (rostate Specific Antigen) Clone: ER-R8 Ready-to-use - 6 ml MSG ml MSK051-05, WB Concentrate 1:50 1 ml MSK051 sca (rostata Stem Cell Antigen) Ready-to-use - 7 ml Concentrate 1:75 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 55

57 SMA (rostate Specific Membrane Antigen) Clone: S29 TH Ready-to-use - 7 ml Concentrate 1:100 1 ml lease refer to arathyroid Hormone. THr lease refer to arathyroid Hormone Receptor. U.1 Clone: ER3158Y Ready-to-use - 6 ml RBG042 Concentrate 1:50-1: ml RBK RCC lease refer to Renal Cell Carcinoma. Renal Cell Carcinoma, gp200 Clone: SM487 re-treat.: Enzymatic Ready-to-use - 7 ml Concentrate 1:25-1:50 1 ml Retinoblastoma (Rb), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml S100 Clone: 4C4.9, MS, RT, BV 6 ml MSG050 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:200-1:400 1 ml MSK

58 S100 (placental S100) Clone: 16/f5 or EDTA S100A4 Ready-to-use - 6 ml MSG089 Concentrate 1:100-1: ml MSK Ready-to-use - 7 ml Concentrate 1:100 1 ml SALL4 Clone: monoclonal Concentrate 1:100-1: ml MSK SATB2 Clone: SATBA4B10, MS, RT re-treat.: EDTA, WB, I Concentrate 1:50-1: ml MSK SCLC lease refer to CD56. Sialophorin lease refer to CD43. SMAD4 Clone: S306 Ready-to-use - 7 ml ml , FL Concentrate 1: ml ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 57

59 Somatostatin Receptor 2A (SSTR2A), MS, RT re-treat.: EDTA Concentrate 1:25-1: ml RBK Somatostatin Receptor 5 (SSTR5) re-treat.: EDTA Concentrate 1:25-1: ml RBK Somatotropin lease refer to Growth Hormone. SOX2 Clone: S76 Ready-to-use - 7 ml Concentrate 1:100 1 ml SOX10 re-treat.: EDTA Ready-to-use - 6 ml RBG057 Concentrate 1:25-1: ml RBK SOX11 Clone: ZSX11 Ready-to-use - 6 ml MSG095 Concentrate 1:25-1: ml MSK Spirochete lease refer to Treponema pallidum. SSTR lease refer to Somatostatin Receptor. 58

60 STAT6 Ready-to-use - 7 ml ml , WB, I Concentrate 1: ml ml Stathmin Clone: S49, MS Ready-to-use - 7 ml ml Concentrate 1: ml ml Survivin Clone: S79 Ready-to-use - 7 ml Concentrate 1:100 1 ml Synaptophysin Ready-to-use - 6 ml RBG ml RBK Concentrate 1:200-1:400 1 ml RBK011 Syndecan lease refer to CD138. Synuclein (an), RT Ready-to-use - 7 ml , WB Concentrate 1:50 1 ml T-bet Clone: ZSTB re-treat.: EDTA Ready-to-use - 6 ml RBG049 Concentrate 1:100-1: ml RBK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 59

61 T-cells lease refer to CD3 CD8. TAU Clone: S70 Ready-to-use - 7 ml Concentrate 1:100 1 ml TdT (Terminal Desoxynucleotidyl Transferase) re-treat.: EDTA Ready-to-use - 6 ml RBG ml RBK Concentrate 1:100-1:500 1 ml RBK052 Tenascin C (TNC) Clone: DB7 re-treat.: EDTA Concentrate 1:50-1: ml MSK TGF beta 1/3 Receptor lease refer to CD105. TGF beta I (Transforming Growth Factor) Ready-to-use - 7 ml Concentrate 1:25 1 ml TGF beta II (Transforming Growth Factor) Ready-to-use - 7 ml ml Concentrate 1:100 1 ml Thymidylate Synthase (TS) Clone: S112 re-treat.: EDTA Ready-to-use - 7 ml Concentrate 1:100 1 ml

62 Thyroglobulin Clone: 2H11+6E1 Ready-to-use - 6 ml MSG ml MSK Concentrate 1:100-1:200 1 ml MSK039 Thyroid Stimulating Hormone lease refer to TSH. Thyroid Transcription Factor lease refer to TTF-1. Topoisomerase I Ready-to-use - 7 ml Concentrate 1:100 1 ml Toxoplasma gondii Reactivity: Toxoplasma gondii re-treat.: EDTA, F Concentrate 1:10-1: ml RBK Transforming Growth Factor lease refer to TGF. Treponema pallidum Reactivity: T. pallidum, IF urified - 1 ml Trypsin (Human pancreatic) re-treat.: epsin, WB, EL Concentrate 1:50-1: ml RBK = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 61

63 TSH (Thyroid Stimulating Hormone), MS, RT TTF-1 Ready-to-use - 7 ml Concentrate 1:200 1 ml Clone: ST24 Ready-to-use - 6 ml MSG111 Concentrate 1:100 1: ml MSK TTF-1 (Thyroid Transcription Factor 1) Clone: 8G7G3/1, RT 6 ml MSG004 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:200-1:500 1 ml MSK004 TTF-1 + Cytokeratin 5/6 Cocktail Clone: 8G7G3/1+D5/16B4 Ready-to-use - 6 ml COG ml CO004K-05 Concentrate 1:50 1 ml CO004K Tubulin, alpha, MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:200 1 ml Tubulin, beta, MS, RT re-treat.: - Ready-to-use - 7 ml , WB, I Concentrate 1:200 1 ml

64 Ubiquitin Uroplakin II Ready-to-use - 7 ml Concentrate 1:100 1 ml Clone: BC21 Ready-to-use - 6 ml MSG102 Concentrate 1:50-1: ml MSK Uroplakin III Clone: AU1, RT, BV, G, WB Concentrate 1:25-1: ml MSK VEGF-A (Vascular Endothelial Growth Factor) re-treat.: EDTA Ready-to-use - 7 ml , WB, I Concentrate 1:100 1 ml VEGFr-1 (Flt-1), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:100 1 ml VEGFr-2 (Flk-1, KDR), MS, RT Ready-to-use - 7 ml , WB Concentrate 1:50 1 ml VEGFr-3 (Flt-4), MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:100 1 ml = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 63

65 Villin Clone: S145, BV, CK, MS, G Ready-to-use - 7 ml ml , WB Concentrate 1: ml ml Vimentin Clone: V9, MS, RT, DG, G re-treat.: optional: Citrate 6 ml MSG023 Ready-to-use - 16 ml BMS ml MSK Concentrate 1:100-1:200 1 ml MSK023 Vinculin Clone: S117 Ready-to-use - 7 ml Concentrate 1: ml von Willebrand Factor lease refer to Factor VIII Related Antigen. Wilm s Tumor rotein-1 lease refer to WT1. WT1 (Wilm's Tumor rotein-1), MS, RT Ready-to-use - 7 ml , WB, I Concentrate 1:100 1 ml ZA-70 Ready-to-use - 7 ml WB, Concentrate 1:100 1 ml

66 = Human; MS = Mouse; RT = Rat; RB = Rabbit; BV = Cow; G = ig; DG = Dog; G = Guinea ig; HS = Horse; SH = Sheep; HM = Hamster; CH = Chicken; MO = Monkey; CT = Cat; a. o. = and others Method: EL = ELISA; F = frozen sections IHC; FL = Flow Cytometry; IF = Immunofluorescense; I = Immunoprecipitation; = paraffin section IHC; WB = Western Blot = for in vitro diagnostic use; RUO = Research use only 65

67 MAX-Line Cost-effective 16 ml ready-to-use antibodies for routine immunohistochemistry Zytomed Systems offers convenient high-volume ready-to-use antibodies suitable for FFE tissue sections. These MAX-Line antibodies meet your demands concerning costs, quality and suitability for routine. All these antibodies (except the 5 marked ones) are CE/IVD certified. MAX-Line antibodies Description Host Clone re-treatment Volume Cat. No. Actin alpha (Smooth Muscle) Mouse 1A4 None 16 ml BMS001 BCL2* Rabbit E17 Citrate 16 ml BRB055 Actin SM (BMS001) Appendix Calretinin Rabbit polyclonal Citrate 16 ml BRB022 CD3 (T-Cell) Rabbit S7 Citrate 16 ml BRB041 CD4 (T-Cell helper/inducer) Rabbit S35 Citrate 16 ml BRB042 CD8 (T-Cell cytotoxic/suppressor) Rabbit S16 Citrate 16 ml BRB036 CD10 (CALLA) Mouse 56C6 Citrate 16 ml BMS043 CD4 (BRB042) CD20 (B-Cell) Mouse L26 optional: Citrate 16 ml BMS003 CD31 Mouse JC70 Citrate 16 ml BMS044 CD34 Mouse QBEnd/10 optional: Citrate 16 ml BMS045 CD45 (LCA) Mouse D7/26 + 2B11 optional: Citrate 16 ml BMS046 CD10 (BMS043) Kidney CD56 Rabbit RCD56 EDTA 16 ml BRB039 CD79a Mouse JCB117 Citrate 16 ml BMS005 CDX-2 Rabbit ER2764Y Citrate 16 ml BRB028 CEA Mouse Col-1 None 16 ml BMS029 Chromogranin A Mouse LKH2H10 None 16 ml BMS018 CD31 (BMS044) Cytokeratin 5/6 Mouse D5/16B4 Citrate 16 ml BMS017 Cytokeratin 5/14 Mouse XM26 + LL002 Citrate 16 ml BMS023 Cytokeratin 7 Mouse OV-TL 12/30 Citrate or enzymatic 16 ml BMS030 Cytokeratin 20 Mouse Ks20.8 epsin or Trypsin 16 ml BMS037 CD45 (BMS046) 66

68 MAX-Line antibodies (continued) Description Host Clone re-treatment Volume Cat. No. Cytokeratin (HMW) Mouse 34βE12 Citrate or epsin 16 ml BMS015 Cytokeratin Broad Spectrum Mouse AE1 + AE3 Citrate or epsin 16 ml BMS006 Desmin Mouse D33 Citrate 16 ml BMS007 Ep-CAM (BMS048) Colon carcinoma E-Cadherin Rabbit E700Y Citrate 16 ml BRB047 Epithelial Specific Antigen (ESA, Ep-CAM) Mouse Ber-E4 Citrate or enzymatic 16 ml BMS048 Estrogen Receptor Rabbit S1 Citrate 16 ml BRB053 GATA3 Mouse L Citrate 16 ml BMS054 GLUT-1 Rabbit polyclonal Citrate or EDTA 16 ml BRB049 Helicobacter pylori Rabbit polyclonal Citrate 16 ml BRB032 HER2 (BMS014) HER2 (c-erbb-2) Mouse CB11 Citrate 16 ml BMS014 Ki-67 Rabbit S6 Citrate 16 ml BRB040 Melanoma (HMB45) Mouse HMB45 optional: Citrate 16 ml BMS010 MLH-1 Mouse G Citrate 16 ml BMS033 MSH-2 Mouse FE11 Citrate 16 ml BMS034 p40 Mouse BC28 Citrate 16 ml BMS050 MSH2 (BMS034) Colon carcinoma p63 * Mouse 4A4 Citrate or EDTA 16 ml BMS S * Rabbit polyclonal EDTA 16 ml BRB035 pan Basal Cell Cocktail * (p63 & Cytokeratin 5/14) Mouse 4A4 + XM26 + LL002 Citrate 16 ml BMS051 pan B-Cocktail * (CD20 & ax-5) Mouse + Rabbit L26 + polyclonal Citrate or EDTA 16 ml BMS026 ax-5 Rabbit polyclonal Citrate 16 ml BRB027 p40 (BMS050) rostate carcinoma rogesterone Receptor Rabbit S42 Citrate 16 ml BRB038 S100 Mouse 4C4.9 None 16 ml BMS013 TTF-1 Mouse 8G7G3/1 Citrate 16 ml BMS016 Vimentin Mouse V9 optional: Citrate 16 ml BMS012 * for research use only 504S (BRB035) rostate carcinoma 67

69 Detection Detection 68

70 Detection Systems ZytoChem lus detection systems are characterised by outstanding sensitivity and can be used in automated as well as manual immunohistochemistry. You can choose between polymer systems, which provide highest sensitivity, and high-sensitive streptavidin-biotin systems. Both kit systems are available with horse-radish peroxidase (HR) or alkaline phosphatase (A). They match perfectly with our chromogenic substrates for aqueous and permanent mounting. All ZytoChem lus detection kits and reagents are CE/IVD certified except the Double Stain olymer kits which are labelled for research use only. ZytoChem lus olymer Detection Systems rinciple of polymer detection systems Chromogenic substrate ZytoChem lus olymer Detection Biotin-free technique avoids problems due to endogenous biotin Compact polymers ensure highest sensitivity Detection Enzyme polymer rimary antibody Blocking (optional) Horse Radish eroxidase (HR) as well as Alkaline hosphatase (A) reagents available Choose between One-Step or Two-Step polymers Reagents and kits for detection of mouse, rabbit and rat primary antibodies or species-specific Single reagents perfect for double staining Suitable for manual as well as automated immunohistochemistry All kits and reagents CE/IVD certified HR olymer Detection Reagents Description CE/IVD Components Volume Cat. No. ZytoChem lus (HR) olymer Kit anti-mouse/rabbit Ready-to-use rotein Block, ost Block, HR-olymer 1 Kit (6 ml/60 tests) OLHR Kit (100 ml/1000 tests) OLHR-100 ZytoChem lus (HR) One-Step olymer anti-mouse/rabbit/rat Ready-to-use HR olymer 6 ml/60 tests ZUC ml/1000 tests ZUC ZytoChem lus (HR) olymer anti-mouse Ready-to-use HR olymer 6 ml/60 tests ZUC ml/1000 tests ZUC ZytoChem lus (HR) olymer anti-rabbit Ready-to-use HR olymer 6 ml/60 tests ZUC ml/1000 tests ZUC

71 A olymer Detection Reagents Description CE/IVD Components Volume Cat. No. ZytoChem lus (A) olymer Kit anti-mouse/rabbit Ready-to-use rotein Block, ost Block, A-olymer 1 Kit (6 ml/60 tests) OLA Kit (100 ml/1000 tests) OLA-100 ZytoChem Fast (A) One-Step olymer anti-mouse/rabbit/rat Ready-to-use A olymer 6 ml/60 tests ZUC ml/1000 tests ZUC ZytoChem lus (A) olymer anti-rabbit Ready-to-use A olymer 6 ml/60 tests ZUC ZytoChemlus (A) olymer anti-mouse Ready-to-use A olymer 6 ml/60 tests ZUC ml/1000 tests ZUC Detection Double Stain olymer Detection kits The ZytoChem lus Double Stain kits were especially developed for immunohistochemical double staining. One primary antibody must be obtained from mouse, the other one from rabbit. Zytomed Systems offers one double stain kit for sequential detection (OL2DS) and one kit for simultaneous detection (OLDS). Both kits are labelled for research use only. Description Components Volume Cat. No. ZytoChem lus Double Stain olymer Kit * ZytoChem lus 2-Step Double Stain olymer Kit * * for research use only HR olymer anti-mouse (50 X Concentrate), A olymer anti Rabbit (Ready-to-use) A-polymer anti-rabbit, HR-polymer anti-mouse (both ready-to-use) 1 Kit (6 ml/60 tests) OLDS Kit (100 ml/1000 Tests) OLDS Kit (2 x 6 ml/60 Tests) OL2DS Kit (2 x 100 ml/1000 Tests) OL2DS-100 ZytoChem lus Streptavidin-Biotin Detection Systems rinciple of streptavidin-biotin detection systems Chromogenic substrate Streptavidin-Enzyme Conjugate Label Biotinylated Secondary Antibody Link rimary Antibody Blocking (optional) ZytoChem lus Streptavidin-Biotin Detection Streptavidin-Biotin technique ensures high sensitivity Horse Radish eroxidase (HR) as well as Alkaline hosphatase (A) reagents available Kit sizes available from small complete kits up to high-volume bulk kits Broad-Spectrum kits as well as species-specific kits available Suitable for manual as well as automated immunohistochemistry All kits and reagents CE/IVD certified HR Streptavidin-Biotin Detection Reagents Description CE/IVD Components Volume Cat. No. ZytoChem lus (HR) Broad Spectrum (AEC) Kit eroxide Block, rotein Block, Sec. Antibody anti-mouse/rabbit/ Rat/Guinea pig, HR-conjugate, 2 component AEC 1 Kit (8 ml/80 tests) HR008AEC 70

72 HR Streptavidin-Biotin Detection Reagents (continued) Description CE/IVD Components Volume Cat. No. ZytoChem lus (HR) Broad Spectrum (DAB) Kit eroxide Block, rotein Block, Sec. Antibody anti-mouse/rabbit/rat/guinea pig, HR-conjugate, 2 component DAB 1 Kit (8 ml/80 tests) HR008DAB ZytoChem lus (HR) Broad Spectrum Kit rotein Block, Sec. Antibody anti-mouse/ Rabbit/Rat/Guinea pig, HR-conjugate 1 Kit (60 ml/600 tests) HR060 1 Kit (125 ml/1250 tests) HR125 1 Kit (500 ml/5000 tests) HR500 ZytoChem lus (HR) Anti-Mouse (AEC) Kit eroxide Block, rotein Block, Sec. Antibody anti-mouse, HR-conjugate, 2 component AEC 1 Kit (8 ml/80 tests) HR008AEC-MS ZytoChem lus (HR) Anti-Mouse (DAB) Kit eroxide Block, rotein Block, Sec. Antibody anti-mouse, HR-conjugate, 2 component DAB 1 Kit (8 ml/80 tests) HR008DAB-MS Detection ZytoChem lus (HR) Anti-Mouse Kit rotein Block, Sec. Antibody anti-mouse, HR-conjugate 1 Kit (60 ml/600 tests) HR060-MS 1 Kit (125 ml/1250 tests) HR125-MS 1 Kit (500 ml/5000 tests) HR500-MS ZytoChem lus (HR) Anti-Rabbit (AEC) Kit eroxide Block, rotein Block, Sec. Antibody anti-rabbit, HR-conjugate, 2 component AEC 1 Kit (8 ml/80 tests) HR008AEC-RB ZytoChem lus (HR) Anti-Rabbit (DAB) Kit eroxide Block, rotein Block, Sec. Antibody anti-rabbit, HR-conjugate, 2 component DAB 1 Kit (8 ml/80 tests) HR008DAB-RB ZytoChem lus (HR) Anti-Rabbit Kit rotein Block, Sec. Antibody anti-rabbit, HR-conjugate 1 Kit (60 ml/600 tests) HR060-RB 1 Kit (125 ml/1250 tests) HR125-RB 1 Kit (500 ml/5000 tests) HR500-RB A Streptavidin-Biotin Detection Reagents Description CE/IVD Components Volume Cat. No. ZytoChem lus (A) Broad Spectrum (Fast Red) Kit rotein Block, Sec. Antibody anti-mouse/ Rabbit/Rat/Guinea pig, A-conjugate, 2 component Fast Red 1 Kit (8 ml/80 tests) A008RED ZytoChem lus (A) Broad Spectrum Kit rotein Block, Sec. Antibody anti-mouse/ Rabbit/Rat/Guinea pig, A-conjugate 1 Kit (60 ml/600 tests) A060 1 Kit (125 ml/1250 tests) A125 1 Kit (500 ml/5000 tests) A500 ZytoChem lus (A) Anti-Mouse (Fast Red) Kit rotein Block, Sec. Antibody anti-mouse, A-conjugate, 2 component Fast Red 1 Kit (8 ml/80 tests) A008RED-MS ZytoChem lus (A) Anti-Mouse Kit rotein Block, Sec. Antibody anti-mouse, A-conjugate 1 Kit (60 ml/600 tests) A060-MS 1 Kit (125 ml/1250 tests) A125-MS 1 Kit (500 ml/5000 tests) A500-MS ZytoChem lus (A) Anti- Rabbit (Fast Red) Kit rotein Block, Sec. Antibody anti-rabbit, A-conjugate, 2 component Fast Red 1 Kit (8 ml/80 tests) A008RED-RB ZytoChem lus (A) Anti-Rabbit Kit rotein Block, Sec. Antibody anti-rabbit, A-conjugate 1 Kit (60 ml/600 tests) A060-RB 1 Kit (125 ml/1250 tests) A125-RB 1 Kit (500 ml/5000 tests) A500-RB 71

73 Reagents Reagents 72

74 Ancillary Reagents A broad range of ancillary reagents like buffers, chromogenic substrates and reagents for pre-treatment are available from Zytomed Systems, many of them CE/IVD certified. Epitope retrieval Zytomed Systems offers different reagents for enzymatic and heat pre-treatment (HIER). The correct epitope retrieval depends on the used antibody clone. Buffer solutions of higher ph value (8 or 9) often lead to stronger signal intensity compared to buffer of ph 7 when used in heat induced epitope retrieval. Our new Omnirep Solutions allow a convenient simultaneous dewaxing and heat pre-treatment in just one step. Cytokeratin 5&6 staining after dewaxing and epitope retrieval with Omnirep Solution ER staining after dewaxing and epitope retrieval with Omnirep Solution Cytokeratin 5&6 on prostate with HIER in Citrate Buffer ph 6.0 Cytokeratin 5&6 on prostate with HIER in T-EDTA Buffer ph 9.0 Reagents Dewaxing and heat pre-treatment combined Description CE/IVD Volume Cat. No. Omnirep Solution ph 9.0 (10 X) - Omnirep Solution ph 6.0 (10 X) ml ZUC ml ZUC ml ZUC ml ZUC HIER (Heat Induced Epitope Retrieval) Description CE/IVD Volume Cat. No. Zytomed Systems HIER Citrate Buffer ph 6.0 (10 X) Zytomed Systems HIER EDTA Buffer ph 8.0 (10 X) Zytomed Systems HIER T-EDTA Buffer ph 9.0 (10 X) 100 ml ZUC ml ZUC ml ZUC ml ZUC ml ZUC ml ZUC roteolytic re-treatment Description CE/IVD Volume Cat. No. epsin (Ready-to-use) 60 ml ZUC ronase (Ready-to-use) ml ZY ml ZY0007 roteinase K (Ready-to-use) - 50 ml ZY0009 Trypsin retreatment Kit (2 components) ml ZUC Ficin (Ready-to-use) - 50 ml ZUC

75 Chromogenic substrates Zytomed Systems offers three chromogenic substrates for permanent mounting: ermanent A Red for A systems and ermanent AEC as well as ermanent HR Green for HR systems. All three chomogenic substrates can be mounted with a permanent mounting medium after dehydration in ethanol and clearing in xylene. In addition Zytomed Systems offers well-established DAB and AEC for use in combination with horse radish peroxidase (HR) detection systems and Fast Red for alkaline phosphatase based (A) detection systems. Reagents stained with Ki67 (RBK027), HR and ermanent AEC (ZUC ) rostate carcinoma stained with 504S (RBG002), A and ermanent A Red Kit (ZUC001) stained with Ki-67 (RBK027), HR and ermanent HR Green (ZUC ) Stomach carcinoma stained with HER2 (RBK026), HR and DAB (DAB530) Chromogenic substrates for eroxidase Description CE/IVD Volume Cat. No. DAB Substrate Kit (2 components; for permanent mounting) DAB High contrast Kit (2 components; for permanent mounting) 50 ml DAB ml DAB ml DAB500plus 500 ml DAB5000plus ermanent AEC Kit (4 components; for permanent mounting) ml ZUC ermanent HR Green Kit (2 components; for permanent mounting) ml ZUC AEC Single Solution (Ready-to-use; for aqueous mounting) AEC Substrate Kit (2 components; for aqueous mounting) 8 ml ZUC ml ZUC ml ZUC ml ZUC Chromogenic substrates for Alkaline hosphatase Description CE/IVD Volume Cat. No. ermanent A Red Kit (2 components; for permanent mounting) Fast Red Substrate ack (tablets and buffer; for aqueous mounting) 125 ml ZUC ml ZUC ml RED ml RED ml RED

76 Diluents, buffers and miscellaneous In this table you will find buffers, reagents and products for use in immunohistochemistry. Many of these reagents can be used in manual as well as in automated IHC. Diluents, buffers and miscellaneous Description CE/IVD Volume Cat. No. Antibody Diluent (Ready-to-use) 100 ml ZUC ml ZUC Antibody Diluent B (Ready-to-use; special diluent recommended for anti-mlh-1 and certain other specificities) 25 ml ZUC ml ZUC ml ZUC eroxide Block (Ready-to-use) 100 ml ZUC ml ZUC Blocking Solution (Ready-to-use) 100 ml ZUC Reagents Wash Buffer (20 X) 500 ml ZUC ml ZUC Tris-Wash Buffer (20 X) ml ZUC Tris-Wash Buffer B (20 X), high detergent ml ZUC ink A en - 1 en ZUC064 ink A en Mini - 1 en ZUC065 Methylgreen (Ready-to-use) ml ZUC Aqueous Mount (Ready-to-use) - 30 ml ZY-AMT ml ZY-AMT060 ZytoChem lus Biotinylated secondary antibody, broad spectrum (Ready-to-use) 8 ml ZUC ml ZUC Reagents for heat induced epitope retrieval Antibody Diluent ZUC025 olymer Kit OLHR DAB Substrate kit DAB530 75

77 Control Arrays Cell Control Arrays 76

78 Cell Control Arrays Zytomed Systems offers four different Cell Control Arrays for immunohistochemistry and in-situ hybridisation. Our Cell Control Arrays are homogenous paraffin blocks containing different numbers of embedded cell lines. The small size of the control block sections allows for simultaneous mounting of patient material sections and control block sections on the same slide. The cell lines are fixed in buffered formalin under controlled conditions. The paraffin block can be cut as any regular paraffin block on a standard microtome without any further equipment. Red dyed paraffin was used for better orientation during cutting and mounting. Sections can be mounted on normal or coated slides following standard methods. A tissue core of heart muscle is included for rapid and easy orientation of the micro array on the glass slide. All Cell Control Arrays are labelled for research use only. HER2 stained on Cell Control Array Receptor Zytomed Systems offers four different Cell Control Arrays The Receptor Cell Control Array contains 4 types of cores: a negative control cell line, ER positive cell line, R positive cell line and a cell line with HER2 overexpression. The cell lines will positively react to IHC staining of estrogen receptor, progesterone receptor and HER2 antibodies. Each block consists of a set of low and a set of normal expressing cell lines. Thus, a differentiation between high and low staining intensity is possible, indicating the sensitivity of the stains. The array is suitable for immunochemistry and in-situ hybridisation. Streptavidin Biotin/AEC Immunohistochemistry olymer A/HR neg M negative R stained on Cell Control Array Receptor ER Clone: 1D5 R Clone: S42 neg neg M M neg neg M M N L H non ampl. low ampl. high ampl. Control Arrays HER2 ISH HER2 Clone: S3 neg M neg M N L H N M ER stained on Cell Control Array Receptor The Virus Cell Control Array contains cell lines infected with CMV, HSV type 1 and type 2, EBV and olyomavirus/sv40. The array is suitable for immunochemistry and in-situ hybridisation. The ALK Cell Control Array contains a core of ALK protein expressing cells and one core of ALK negative cells. It is intended to ensure a Yes or NO answer for immunohistochemical staining. Furthermore, the Cell Control Array ALK (IHC) can be used for certain RT-CR techniques. The Bacteria Cell Control Array contains 4 cores of cells: Attenuated bovine mycobacteria serve as positive control for the detection of acid fast mycobacteria. Aspergillus fumigatus is the positive control for fungispecific stains. Gram-positive and gram-negative bacteria are included for a gram- or Giemsa-stain. The array is suitable for special stains, immunochemistry, and immunofluorescence applications. EBV in situ-hybridisation on Cell Control Array Virus Cell Control Arrays Description Amount Cat. No. Cell Control Array Receptor 1 Block MB-CC REZ Cell Control Array Virus 1 Block MB-CC VIR Cell Control Array ALK (IHC) 1 Block MB-CC ALK Cell Control Array Bacteria plus Fungi 1 Block MB-CC BAC AS stain on Cell Control Array Bacteria plus Fungi 77

IHC Reagents & Kits. CE/IVD Certified

IHC Reagents & Kits. CE/IVD Certified IHC Reagents & Kits CE/IVD Certified BioSiteHisto Nordic BioSite wants to make diagnostic work easier. For this purpose, we have selected a number of markers, which are frequently needed for diagnostics

More information

NEW IHC A n t i b o d i e s

NEW IHC A n t i b o d i e s NEW IHC Antibodies TABLE OF CONTENTS NEW IHC ANTIBODIES from Cell Marque CITED1 (5H6).... 1 Claudin 7 (5D10F3).... 1 GATA1 (4F5).... 1 Transgelin (2A10C2).... 1 NEW IHC ANTIBODIES using RabMAb Technology

More information

International Catalogue 2016/2017

International Catalogue 2016/2017 Detection Cell Control Arrays Accessory Reagents International Catalogue 2016/2017 Immunohistochemistry Selected Reagents for Diagnostics and Research Content Antibodies Positive control list for primary

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK UCL-Advanced Diagnostics 1st Floor, Rockefeller Building 21 University Street London WC1E 6JJ Contact: David Allen Tel: +44 (0)20 7679 6912

More information

Protocols for Zytomed Systems antibodies on fully automated IHC staining systems date of issue: September 20, 2012

Protocols for Zytomed Systems antibodies on fully automated IHC staining systems date of issue: September 20, 2012 Protocols for Zytomed Systems antibodies on fully automated IHC staining systems date of issue: September 20, 2012 These protocols were provided by customers. Under no circumstances shall Zytomed Systems

More information

IHC Panels as an Aid in Diagnostic Decision Making

IHC Panels as an Aid in Diagnostic Decision Making IHC Antibody Test Selection Using a Panel Approach Steven Westra B.S. Reagent Product Specialist Leica Biosystems IHC Panels as an Aid in Diagnostic Decision Making Diagnostic Use of Tumors Using Algorithms

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK External Quality ssessment Services for Cancer Diagnostics CIC Issue No: 005

More information

In Situ Hybridization Immunohistochemistry

In Situ Hybridization Immunohistochemistry 2013-2014 In Situ Hybridization Immunohistochemistry A History of Delivering Superior Products Genemed Biotechnologies, Inc. was founded in 1987 and is located in the center of the South San Francisco

More information

Technology from Abcam

Technology from Abcam CD2 (EP222) CD2 is one of the earliest T-cell lineage restricted antigens to appear during T-cell differentiation and only rare CD2+ cells can be found in the bone marrow. Anti-CD2 is a pan-t-cell antigen

More information

C.L. Davis Foundation Descriptive Veterinary Pathology Course

C.L. Davis Foundation Descriptive Veterinary Pathology Course C.L. Davis Foundation 2015 Descriptive Veterinary Pathology Course IHC Resources IHC Identification Targets Antibodies Antibodies 1 Antibodies Specimens Antigen Retrieval Unmasks antigen epitopes Methods

More information

ADVANCED STAINING PRODUCT CATALOG. In Situ Hybridization Probes Immunohistochemistry Antibodies Detection Systems Ancillary Reagents

ADVANCED STAINING PRODUCT CATALOG. In Situ Hybridization Probes Immunohistochemistry Antibodies Detection Systems Ancillary Reagents 2017 ADVANCED STAINING PRODUCT CATALOG In Situ Hybridization Probes Immunohistochemistry Antibodies Detection Systems Ancillary Reagents A History of Delivering Superior Products Genemed a wholly-owned

More information

Charles Halsey, DVM, PhD, DACVP Pfizer, Inc. IHC Resources

Charles Halsey, DVM, PhD, DACVP Pfizer, Inc. IHC Resources Charles Halsey, DVM, PhD, DACVP Pfizer, Inc. IHC Resources 1 IHC Identification Targets Specimens Controls 2 Tissue controls Trouble Spots 3 The Key to Description IHC Description 4 Intermediate Filaments

More information

antibodies by application

antibodies by application antibodies by application Higher Affinity Higher Sensitivity Higher Specificity A selection of Over 460 Rabbit and Mouse Monoclonal For Use in Clinical and Research Applications Bio SB s RBT & MMab s BSB

More information

Breast - ductal carcinoma CK7 ER PR GATA3 Mammaglobin (50-70%) GCDFP-15 (50-70%) E-cadherin HMWCK CK20 PAX2 ER/PR/HER2 on all newly diagnosed cases

Breast - ductal carcinoma CK7 ER PR GATA3 Mammaglobin (50-70%) GCDFP-15 (50-70%) E-cadherin HMWCK CK20 PAX2 ER/PR/HER2 on all newly diagnosed cases Adrenal cortical carcinoma Inhibin Synap Melan-A Calretinin Vimentin Chromogr CK7 CK20 Breast - ductal carcinoma CK7 ER PR GATA3 Mammaglobin (50-70%) GCDFP-15 (50-70%) E-cadherin HMWCK CK20 PAX2 ER/PR/HER2

More information

recommended for detecting myoepithelial cells.

recommended for detecting myoepithelial cells. Myosin SMMHC stained on normal breast tissue (MSK081) p63 stained on breast carcinoma (MSK087) The expanding role of immunohistochemistry in from atypical ductal hyperplasia or low-grade breast pathology

More information

Ready-to-use, CE-IVD antibodies for pathology

Ready-to-use, CE-IVD antibodies for pathology A-1-Antichymotrypsin A-1-Antitrypsin Abcc3 Aberrant Endothelial 4A11 Cell ACTH BSB-25; AH26 Actin 1A4 Actin, Muscle Specific HHF35 Actin, Smooth Muscle BSB-15 (ASM/H12) Adenovirus 20/11 and 2/6; A62020069A

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Christie Hospital Manchester M20 4BX Contact: Neil Wrathall Tel: +44 (0) 161 918 7264 Fax: +44 (0) 161 446 8549 E-Mail: neil.wrathall@christie.nhs.uk

More information

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products. CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction

More information

2016 Antibodies by Application

2016 Antibodies by Application 2016 by Application Higher Affinity Higher Sensitivity Higher Specificity New Rabbit Monoclonal ALK, EP301 Amyloid A, EP335 B7H3/CD276, RBT B7H3 bcl6, EP278 BRAF V600E, RM8 C4d, EP273 CD5, RED1 CD8, EP334

More information

The impact of proficiency testing on lab immunoassays

The impact of proficiency testing on lab immunoassays The impact of proficiency testing on lab immunoassays Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark Nordic Immunohistochemical Quality

More information

Nordic Immunohistochemical Quality Control

Nordic Immunohistochemical Quality Control Nordic Immunohistochemical Quality Control Immunohistochemistry in the classifiation of neoplasias of the alimentary tract & External Quality Assurance of Immunohistochemistry for GI cancer markers Mogens

More information

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification

More information

Single and Multiplex Immunohistochemistry

Single and Multiplex Immunohistochemistry Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch

More information

The role of immunohistochemistry in surgical pathology of the uterine corpus and cervix

The role of immunohistochemistry in surgical pathology of the uterine corpus and cervix The role of immunohistochemistry in surgical pathology of the uterine corpus and cervix Prof. Ben Davidson, MD PhD Department of Pathology, Norwegian Radium Hospital, Oslo University Hospital, Oslo, Norway

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

The Panel Approach to Diagnostics. Lauren Hopson International Product Specialist Cell Marque Corporation

The Panel Approach to Diagnostics. Lauren Hopson International Product Specialist Cell Marque Corporation The Panel Approach to Diagnostics Lauren Hopson International Product Specialist Cell Marque Corporation Cell Marque Rocklin, California About Cell Marque: IVD primary antibody manufacturer Distributors

More information

Immunohistochemical classification of the unknown primary tumour (UPT) Part I. Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark

Immunohistochemical classification of the unknown primary tumour (UPT) Part I. Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark Immunohistochemical classification of the unknown primary tumour (UPT) Part I Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark Tumours of unknown origin: Histology Brain tumour - biopsy

More information

I. Diagnosis of the cancer type in CUP

I. Diagnosis of the cancer type in CUP Latest Research: USA I. Diagnosis of the cancer type in CUP II. Outcomes of site-specific therapy of the cancer type in CUP a. Prospective clinical trial b. Retrospective clinical trials 1 Latest Research:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK North Tyneside General Hospital Rake Lane North Shields Tyne & Wear NE29 8NH Contact: Ian Taylor Tel:

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Issue No: 002 Issue date: 05 March 2018 Berkshire and Surrey Pathology Services Department of Histopathology Wexham Park Hospital Slough Berkshire

More information

IIImmunohistochemistry (IHC) Outreach Services

IIImmunohistochemistry (IHC) Outreach Services IIImmunohistochemistry (IHC) Outreach Services Note type of fixative used if not neutral buffered formalin. Note type of tissue/specimen Unless specified otherwise, positive and negative controls react

More information

Classification of the unknown primary tumour: the primary IHC panel

Classification of the unknown primary tumour: the primary IHC panel CIQC/CAP-ACP SEMINAR 2013: DIAGNOSTIC IHC AND MOLECULAR PATHOLOGY Classification of the unknown primary tumour: the primary IHC panel Aalborg University Hospital Denmark Tumours of unknown origin: Histology

More information

OncoMir Library Cancer Type Target Gene

OncoMir Library Cancer Type Target Gene OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service High Street, Feltham, Middlesex, TW13 4UN, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service High Street, Feltham, Middlesex, TW13 4UN, UK 21-47 High Street, Feltham, Middlesex, TW13 4UN, UK Cellular Pathology Pathology Department Northampton General Hospital Cliftonville Northampton Northamptonshire NN1 5BD Contact: Mary Pendleton Tel: +44

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Blizard Institute Core Pathology Pathology and Pharmacy Building Second Floor 80 Newark Street London E1 2ES Contact: Pauline Levey Tel: +44

More information

The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, controls and EQA (part I)

The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, controls and EQA (part I) The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark

More information

External Quality Assessment of melanocytic marker analyses NordiQC experience

External Quality Assessment of melanocytic marker analyses NordiQC experience External Quality Assessment of melanocytic marker analyses NordiQC experience Jan Klos MD, Department of Pathology Stavanger University Hospital Norway 1 Content 18 Runs = 2112 submissions between 2001-2014

More information

DOUBLE STAINS. Toll-Free: Direct:

DOUBLE STAINS. Toll-Free: Direct: DOUBLE STAINS CD61 + CD71 DAB Brown: CD61 Alk. Phos. Red: CD71 Bone Marrow DAB Brown: Megakaryocytes Alk. Phos. Red: Erythroid Precursors 400x CD61 (2f2) 0.1 ml concentrate............. 161M-14 0.5 ml

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Cellular Pathology Laboratory Contact: Breege Nicholson Queen Elizabeth Hospital Tel: +44 (0) 208 333 3000 ext. 8478 Stadium Road E-Mail:

More information

Thermo Scientific UltraVision Quanto for Immunohistochemistry The New Generation Micro-Polymer Detection System

Thermo Scientific UltraVision Quanto for Immunohistochemistry The New Generation Micro-Polymer Detection System Thermo Scientific for Immunohistochemistry The New Generation Micro-Polymer Detection System highest sensitivity sharp crisp clear shorter incubation times UltraVision Quanto the new Micro-Polymer System

More information

The clinically challenging entity of liver metastasis from tumors of unknown primary

The clinically challenging entity of liver metastasis from tumors of unknown primary The clinically challenging entity of liver metastasis from tumors of unknown primary Xuchen Zhang, MD, PhD Associate Professor of Pathology Department of Pathology Yale University School of Medicine Liver

More information

Cleveland Clinic Laboratories

Cleveland Clinic Laboratories Cleveland Clinic Laboratories Anatomic Pathology Special s Group I for Microorganisms Special s Group I 88312 Fite stain Gomori s methenamine silver (GMS) Gram Gridley PAS/light green counterstain Warthin-Starry

More information

Immunohistochemical classification of lung carcinomas and mesotheliomas. Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark

Immunohistochemical classification of lung carcinomas and mesotheliomas. Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark Immunohistochemical classification of lung carcinomas and mesotheliomas Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark Endobronchial ultrasound guided transbronchial needle biopsy

More information

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Histopathological diagnosis of CUP

Histopathological diagnosis of CUP Histopathological diagnosis of CUP Dr Karin Oien karin.oien@glasgow.ac.uk Disclosure slide Dr Karin Oien has no financial interests in any company mentioned in this presentation. Dr Karin Oien is conducting

More information

The unknown primary tumour: IHC classification part I, the primary panel - Antibody selection, protocol optimization, controls and EQA

The unknown primary tumour: IHC classification part I, the primary panel - Antibody selection, protocol optimization, controls and EQA The unknown primary tumour: IHC classification part I, Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark the primary panel - Antibody selection,

More information

Breast cancer: IHC classification. Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark

Breast cancer: IHC classification. Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark Breast cancer: IHC classification Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark http://upload.wikimedia.org/wikipedia/commons/1/1a/breast.svg

More information

MT09 - Normal Human Tissue Microarray, FDA

MT09 - Normal Human Tissue Microarray, FDA Reveal Biosciences offers Histochemical Staining, Immunohistochemistry (IHC), In Situ Hybridization (ISH), Whole Slide Imaging, and Quantitative Image Analysis on any TMA MT09 - Normal Human Tissue Microarray,

More information

The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, controls and EQA (part II)

The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, controls and EQA (part II) The unkown primary tumour: IHC Classification, antibody selection, protocol optimization, Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark

More information

Cleveland Clinic Laboratories

Cleveland Clinic Laboratories Cleveland Clinic Laboratories Anatomic Pathology Special Stains Group I for Microorganisms Special Stains Group I 88312 Fite stain Gomori s methenamine silver (GMS) Gram PAS/light green counterstain Warthin-Starry

More information

Diagnostic IHC in lung and pleura pathology

Diagnostic IHC in lung and pleura pathology Diagnostic IHC in lung and pleura pathology Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark WHO 2004 and Web Malignant mesothelioma Epithelioid

More information

Reporting of carcinoma of unknown primary tumour (CUP)

Reporting of carcinoma of unknown primary tumour (CUP) Reporting of carcinoma of unknown primary tumour (CUP) Prof John Schofield Kent Oncology Centre with grateful thanks to Dr Karin Oien University of Glasgow Royal College of Pathologists Cancer datasets

More information

TUMOR M ARKERS MARKERS

TUMOR M ARKERS MARKERS TUMOR MARKERS M.Shekarabi IUMS Definition Many cancers are associated with the abnormal production of some molecules l which h can be measured in plasma. These molecules are known as tumor markers. A good

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 05/09/2018 Cellular Pathology Level 2 Esher Wing Galsworthy Road Kingston upon Thames KT2 7QB Contact: Dr Sussan Gharaie Tel: +44 (0)208 934

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Schedule of Accreditation 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Eye Pathology 1 st Floor, Cayton Street Building UCL Institute of Ophthalmology 11-43 Bath Street

More information

Tumor Markers & Cytopathology

Tumor Markers & Cytopathology Tumor Markers & Cytopathology Objectives: After learning, student should be able to 1. Describe the basic concepts of tumor markers and Asst. Prof. Prasit Suwannalert, Ph.D. (Email: prasit.suw@mahidol.ac.th)

More information

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

Diagnostic BioSystems Anatomic Pathology Catalog. Affordable IHC Solutions

Diagnostic BioSystems Anatomic Pathology Catalog. Affordable IHC Solutions Diagnostic BioSystems 2015-2016 Anatomic Pathology Catalog Affordable IHC Solutions Ordering Information Orders: Orders will be accepted via phone, fax, mail or e-mail. Toll Free: (888) 896-3350 Select

More information

CARCINOMA OF UNKNOWN PRIMARY: DIAGNOSTIC APPROACH USING IMMUNOHISTOCHEMISTRY

CARCINOMA OF UNKNOWN PRIMARY: DIAGNOSTIC APPROACH USING IMMUNOHISTOCHEMISTRY CARCINOMA OF UNKNOWN PRIMARY: DIAGNOSTIC APPROACH USING IMMUNOHISTOCHEMISTRY Jason L Hornick, MD, PhD Director of Surgical Pathology Director of Immunohistochemistry Brigham and Women s Hospital Associate

More information

INTERPRETATION OF IMMUNOHISTOCHEMICAL STAINS - DIFFICULTIES AND PITFALLS. Gabor Fischer Diagnostic Services Manitoba University of Manitoba

INTERPRETATION OF IMMUNOHISTOCHEMICAL STAINS - DIFFICULTIES AND PITFALLS. Gabor Fischer Diagnostic Services Manitoba University of Manitoba INTERPRETATION OF IMMUNOHISTOCHEMICAL STAINS - DIFFICULTIES AND PITFALLS Gabor Fischer Diagnostic Services Manitoba University of Manitoba IHC INTERPRETATIONS LOCAL DATA Diagnostic Services Manitoba Number

More information

Solutions for IHC. Immunohistochemistry Products 2018 Catalog

Solutions for IHC. Immunohistochemistry Products 2018 Catalog Solutions for IHC Immunohistochemistry Products 2018 Catalog Immunohistochemistry Products In an industry where seemingly small decisions can have huge implications and the quality of your diagnosis is

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

SHN-1 Human Digestive Panel Test results

SHN-1 Human Digestive Panel Test results SHN-1 Human Digestive Panel Test results HN-30 tongue HN-24 salivary gland HN-12 larynx HN-28 esophagus HN-29 stomach HN-20 pancreas HN-13 liver HN-14 gall bladder HN-27-1 duodenum HN-27-2 ileum HN-27-3

More information

Cutaneous metastases. Thaddeus Mully. University of California, San Francisco Professor, Departments of Pathology and Dermatology

Cutaneous metastases. Thaddeus Mully. University of California, San Francisco Professor, Departments of Pathology and Dermatology Cutaneous metastases Thaddeus Mully University of California, San Francisco Professor, Departments of Pathology and Dermatology DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Thaddeus Mully Course C005 Essential

More information

Cancer genetics

Cancer genetics Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1

More information

Differential diagnosis of HCC

Differential diagnosis of HCC Hepatocellular Carcinoma Quest for an Ideal Immunohistochemical Panel Sanjay Kakar, MD UCSF Differential diagnosis of HCC Hepatocellular lesions Adenoma, FNH, HG dysplasia Adenocarcinoma CholangioCA, metastasis

More information

Your single-source laboratory solution. Antibody Library

Your single-source laboratory solution. Antibody Library Your single-source laboratory solution. Antibody Library A-ACT Alpha-1 antichymotrypsin; histiocytes; pancreatic pseudopapillary tumor A-AT Alpha-1-antitrypsin; inherited AAT deficiency ACTH Adrenocorticotropic

More information

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar Link full download:https://getbooksolutions.com/download/test-bank-for-robbinsand-cotran-pathologic-basis-of-disease-9th-edition-by-kumar Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Carcinoma of Unknown Primary (CUP)

Carcinoma of Unknown Primary (CUP) Metasta c Carcinoma of Unknown Primary: Diagnos c Approach Using Immunohistochemistry James R. Conner, MD, PhD Mount Sinai Hospital Toronto, ON Carcinoma of Unknown Primary (CUP) 3-5% of all new malignant

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Tissue-based Immunohistochemical Biomarker Expression in Malignant Glandular Lesions of the Uterine Cervix: a Systematic Review

Tissue-based Immunohistochemical Biomarker Expression in Malignant Glandular Lesions of the Uterine Cervix: a Systematic Review Tissue-based Immunohistochemical Biomarker Expression in Malignant Glandular Lesions of the Uterine Cervix: a Systematic Review Sandra Lee MD, FRCPC 1 *, Vikrant V. Sahasrabuddhe, MBBS, DrPH 2 *, Diana

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Laboratory locations: Department of Histopathology Royal United Hospitals NHS Foundation Trust Combe Park Bath BA1 3NG Contact: Lesley Shipway

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Cellular Pathology Contact: Dr Nicola Chaston East Kent Hospitals University Tel: +44 (0)1233 616183 NHS Foundation Trust Fax: +44 (0) 01233

More information

Immunohistochemistry. Potential and challenges To be or not to be

Immunohistochemistry. Potential and challenges To be or not to be Immunohistochemistry Potential and challenges To be or not to be Søren Nielsen Scheme Manager NordiQC Aalborg University Hospital, Denmark Vårmöte 19.05.2016 Karlstad Overview IHC project coordinator at

More information

Liver cancer and normal cell lines

Liver cancer and normal cell lines The Essentials of Life Science Research Globally Deed Liver cancer and normal cell lines ATCC No. Name Tissue Cell Type Disease Oganism Age Ethnicity Genes Expressed HTB-79 Capan-1 pancreas: adenocarcinoma

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK operating as North East Essex and Suffolk Pathology Service (NEESPS) Cellular Pathology Contact: Lynn Partridge Ipswich Hospital Tel: +44

More information

Diagnostic BioSystems

Diagnostic BioSystems Diagnostic BioSystems 2013-2014 Anatomic Pathology Catalog Histology and Advanced IHC Staining Products Ordering Information Orders: Orders will be accepted via phone, fax, mail or e-mail. Toll Free: (888)

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar

Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar Link full download: http://testbankair.com/download/test-bank-for-robbins-cotran-pathologic-basis-of-disease-9th-edition-bykumar-abbas-and-aster Test Bank for Robbins and Cotran Pathologic Basis of Disease

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK The Princess Alexandra Hospital NHS Trust The Michael Letcher Department of Cellular Pathology The Princess Alexandra Hospital NHS Trust Hamstel

More information

Speaking to you. This statement by Dr. Rodney T. Miller, Director of

Speaking to you. This statement by Dr. Rodney T. Miller, Director of Zyto_Facts 1-2013 News for pathology and immunohistochemistry +++Newsflash +++ Newsflash++ Speaking to you IHC algorithm poster now available in English. You can download the poster directly from our homepage

More information

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,

More information

Immunohistochemical Evaluation of Necrotic Malignant Melanomas

Immunohistochemical Evaluation of Necrotic Malignant Melanomas Anatomic Pathology / EVALUATION OF NECROTIC MALIGNANT MELANOMAS Immunohistochemical Evaluation of Necrotic Malignant Melanomas Daisuke Nonaka, MD, Jordan Laser, MD, Rachel Tucker, HTL(ASCP), and Jonathan

More information

CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS

CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6

More information

Products for Molecular Pathology

Products for Molecular Pathology Products for Molecular Pathology At Bio SB our passion is providing biomedical laboratories with the tools to improve the diagnosis, prognosis and therapies that benefit patients worldwide. Bio SB is proud

More information

Simultaneous de-waxing and standardisation of antigen retrieval in immunohistochemistry using commercially available equipment

Simultaneous de-waxing and standardisation of antigen retrieval in immunohistochemistry using commercially available equipment Reprinted by permission of UK NEQAS Immunocytochemistry and David S. Gray Kind thanks to David S. Gray for allowing ThermoFisher Scientific, Lab Vision Products, to distribute this article. Immunocytochemistry

More information

Tumour Markers. For these reasons, only a handful of tumour markers are commonly used by most doctors.

Tumour Markers. For these reasons, only a handful of tumour markers are commonly used by most doctors. Tumour Markers What are Tumour Markers? Tumour markers are substances that can be found in the body when cancer is present. They are usually found in the blood or urine. They can be products of cancer

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Review and Updates of Immunohistochemistry in Selected Salivary Gland and Head and Neck Tumors

Review and Updates of Immunohistochemistry in Selected Salivary Gland and Head and Neck Tumors Review and Updates of Immunohistochemistry in Selected Salivary Gland and Head and Neck Tumors. Monophasic tumors : myoepithelioma, acinic cell carcinoma, and salivary duct carcinoma. Biphasic tumors includes

More information

Expression of p53, p21 /waf l, bcl-2, bax, Rb and Ki67 proteins in Hodgkin's lymphomas

Expression of p53, p21 /waf l, bcl-2, bax, Rb and Ki67 proteins in Hodgkin's lymphomas Histol Histopathol (2000) 15: 445-453 http://www.ehu.es/histol-histopathol Histology and Histopathology Cellular and Molecular Biology Expression of p53, p21 /waf l, bcl-2, bax, Rb and Ki67 proteins in

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center

More information

Immunohistochemistry Research Products

Immunohistochemistry Research Products Immunohistochemistry Research Products Multiple Tissue Arrays (MTA) Primary and Secondary Antibodies Detection Systems Antigen Retrieval Solutions Tissue Processing Fixatives BD Biosciences Clontech Discovery

More information

New Developments in Immunohistochemistry for Gynecologic Pathology

New Developments in Immunohistochemistry for Gynecologic Pathology New Developments in Immunohistochemistry for Gynecologic Pathology Michael T. Deavers, M.D. Professor, Departments of Pathology and Gynecologic Oncology Immunohistochemistry in Gynecologic Pathology Majority

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Royal National Orthopaedic Hospital NHS Trust Brockley Hill Stanmore Middlesex HA7 4LP Contact: Professor Adrienne Flanagan Tel: +44 (0)20

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Pathology Mystery and Surprise

Pathology Mystery and Surprise Pathology Mystery and Surprise Tim Smith, MD Director Anatomic Pathology Medical University of South Carolina Disclosures No conflicts to declare Some problem cases Kidney tumor Scalp tumor Bladder tumor

More information

IMMUNOPROFILES OF THE MAJOR RENAL NEOPLASMS (%staining)

IMMUNOPROFILES OF THE MAJOR RENAL NEOPLASMS (%staining) Stain Clear Cell Papillary IMMUNOPROFILES OF THE MAJOR RENAL NEOPLASMS (%staining) Chromophobe Collecting Duct Carcinom a Sarcomatoid Xp11 Translocat ion Dr Jon Oxley See also www.jonoxley.com Page 1 MTSCC

More information