Clinical significance of zinc finger E box binding homeobox 1 mrna levels in peritoneal washing for gastric cancer

Size: px
Start display at page:

Download "Clinical significance of zinc finger E box binding homeobox 1 mrna levels in peritoneal washing for gastric cancer"

Transcription

1 MOLECULAR AND CLINICAL ONCOLOGY 3: , 2015 Clinicl significnce of zinc finger E box binding homeobox 1 mrna levels in peritonel wshing for gstric cncer NORIMITSU YABUSAKI, SUGURU YAMADA, TOSHIFUMI MURAI, MITSURO KANDA, DAISUKE KOBAYASHI, CHIE TANAKA, TSUTOMU FUJII, GORO NAKAYAMA, HIROYUKI SUGIMOTO, MASAHIKO KOIKE, SHUJI NOMOTO, MICHITAKA FUJIWARA nd YASUHIRO KODERA Deprtment of Gstroenterologicl Surgery (Surgery II), Ngoy University Grdute School of Medicine, Ngoy, Aichi , Jpn Received September 22, 2014; Accepted November 10, 2014 DOI: /mco Abstrct. Zinc finger E box binding homeobox 1 (ZEB1) is n importnt regultor of epithelil to mesenchyml trnsition nd is ssocited with vrious types of metstsis. Gstric cncer ptients often develop peritonel crcinomtosis, of which the detection of free cncer cells in the peritonel wshes is n importnt predictor. We nlyzed the correltion of ZEB1 mrna levels in the peritonel wshing (pzeb1) with clinicopthologicl vribles nd survivl in 107 gstric cncer ptients who underwent surgery nd peritonel wshing cytology. Reverse trnscription polymerse chin rection ws performed to quntify pzeb1. The ptients were clssified into the pzeb1 High (n=27) nd the pzeb1 Low (n=80) groups bsed on their pzeb1 expression. pzeb1 ws sttisticlly correlted with pthologicl T stge (P=0.03) nd vsculr involvement (P=0.03). At 5 yers, the disese specific survivl ws 36.4% for the pzeb1 High group nd 64.7% for the pzeb1 Low group (P=0.02), wheres the disese free survivl rte ws 46.9% for the pzeb1 High group nd 83.0% for the pzeb1 Low group (P=0.03). When subclssified into 4 ctegories bsed on wshing cytology nd pzeb1, survivl ws significntly lower in the pzeb1 High compred to the pzeb1 Low group (cytology negtive group, P=0.01; cytology positive group, P=0.13). Therefore, pzeb1 my dd vluble informtion to conventionl peritonel wshing cytology s prognostic determinnt in gstric cncer. Correspondence to: Dr Suguru Ymd, Deprtment of Gstroenterologicl Surgery (Surgery II), Ngoy University Grdute School of Medicine, 65 Tsurumi cho, Show ku, Ngoy, Aichi , Jpn E mil: suguru@med.ngoy u.c.jp Key words: zinc finger E box binding homeobox 1, peritonel wshing, epithelil to mesenchyml trnsition, gstric cncer Introduction Although the survivl of ptients with gstric cncer hs improved due to the recent dvnces in tretment, the prognosis of loclly dvnced or metsttic cncer remins poor (1 3). A proportion of the ptients develop recurrences even fter curtive resection, possibly reflecting the presence of residul cncer cells nd micrometstses tht hd not been detected by the currently vilble dignostic technology (4,5). Therefore, the ccurte evlution of microscopic residul disese my led to more pproprite therpeutic strtegies nd improvement in survivl. Epithelil to mesenchyml trnsition (EMT) is criticl process during which the dhesion nd migrtion properties of cncer cells chnge drmticlly (6,7). During EMT, the cells lose epithelil polrity nd cquire spindle shped, highly motile fibroblstoid phenotype. Vrious trnscription fctors re known to trigger EMT (8 10), including zinc finger E box binding homeobox 1 (ZEB1), centrl EMT meditor (11,12). ZEB1 reportedly ffects cncer progression by regulting EMT in gstric, brest, prostte, ovrin nd colorectl cncers (13 20). In gstric cncer, crcinoembryonic ntigen (CEA) mrna levels in peritonel wshing hve been reported to be potentil predictors of peritonel recurrence (21,22). Koder et l reported tht the combintion of CEA nd cytokertin 20 in peritonel wshes my more ccurtely predict prognosis (23). ZEB1 expression hs lso been recently reported s novel biomrker in cncer tissue tht my independently predict overll survivl (13,14,24). We recently reported on significnt correltion between ZEB1 expression nd diffuse phenotype in gstric cncer (24). Okugw et l reported tht ZEB1 ws n independent predictor of peritonel dissemintion in gstric cncer ptients nd ws expressed in disseminted cncer cells in the peritoneum in the sme pttern s tht seen in the primry lesions (13). Therefore, we hypothesized tht the ZEB1 mrna levels in peritonel wshing (pzeb1) in conjunction with peritonel wshing cytology my predict intrperitonel recurrence nd prognosis. This study investigted the ssocition of pzeb1 with clinicopthologicl prmeters nd prognosis nd the potentil of pzeb1 s predictive mrker. To the best of our knowledge,

2 436 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER this is the first report on the clinicl impliction of pzeb1 in gstric cncer. Mterils nd methods Ptients. We enrolled 107 consecutive gstric cncer ptients who underwent surgicl procedures tht included collection of peritonel wshing smples t the left subphrenic re t the beginning of surgery, between Jnury, 2005 nd August, 2010 t the Deprtment of Gstroenterologicl Surgery, Ngoy University Hospitl, Ngoy, Aichi, Jpn. All the ptients hd histologiclly confirmed gstric cncer. Of the 107 ptients, 4 hd received chemotherpy prior to surgery, 2 of whom chieved complete response. All the ptients hd been stged ccording to the Union for Interntionl Cncer Control stging criteri for gstric cncer (7th edition, 2009) s follows: 2 ptients hd stge 0; 12 hd stge IA; 11 hd stge IB; 7 hd stge IIA; 12 hd stge IIB; 8 hd stge IIIA; 10 hd stge IIIB; 10 hd stge IIIB; 10 hd stge IIIC; nd 35 hd stge IV disese. Overll, 72 ptients underwent curtive resection, 35 ptients underwent non curtive resection, of whom 2 ptients did not receive gstrectomy due to disseminted cncer. All the ptients underwent gstrectomy with D2 lymphdenectomy when potentilly curtive R0 resection ws plnned. The medin follow up period ws 41.9 months (rnge, months). This study ws pproved by the Ethics Committee of our hospitl nd signed informed consent ws obtined from ll the prticipting ptients. Peritonel wshes. At the beginning of ech surgery, ml sline ws introduced into the left subphrenic re nd spirted soon fter gentle stirring. Hlf of ech fluid smple ws sent for routine cytopthology with conventionl Ppnicolou nd Giems stining, wheres the other hlf ws used to mesure ZEB1 mrna levels. The smple ws centrifuged t 540 x g for 5 min to collect intct cells, rinsed with phosphte buffered sline, dissolved in ISOGEN LS RNA extrction buffer (Nippon Gene, Tokyo, Jpn) nd stored immeditely in liquid nitrogen t -80 C until nlysis. Reverse trnscription quntittive polymerse chin rection (RT qpcr). Totl RNA ws isolted from ech of the frozen smples with the RNesy mini kit (Qigen, Hilden, Germny) ccording to mnufcturer's instructions. cdna ws synthesized using the QuntiTect Reverse Trnscription kit (Qigen, Hilden, Germny) nd mplified by PCR primers s follows: ZEB1: 5' TGCACTGAGTGTGGAAAAGC 3' (forwrd) nd 5' TGGTGATGCTGAAAGAGACG 3' (reverse), which mplify 237 bp product. RNA expression ws determined using the rel time quntittive PCR method. To quntify nd demonstrte the integrity of the isolted RNA, glycerldehyde 3 phophte dehydrogense ws lso nlyzed with RT qpcr using the primer set 5' AACGGCTCCGGCATGTGCAA 3' (forwrd) nd 5' GGCTCCTGTGCAGAGAAAGC 3' (reverse). All the PCR rections were performed s follows: 1 cycle t 50 C for 2 min, 1 cycle t 95 C for 10 min, followed by 40 cycles t 95 C for 15 sec nd t 60 C for 60 sec. Rel time detection of the emission intensity of SYBR Green ws performed with n ABI prism 7000 Sequence Detector (Perkin Elmer Tble I. Ptient chrcteristics. Chrcteristics Applied Biosystems, Foster City, Cliforni, USA). qpcr ws performed t lest 3 times, including negtive no templte control. Sttisticl nlysis. Correltions between pzeb1 expression nd clinicopthologicl vribles were nlyzed by the χ 2 nd Fisher's exct tests. Disese specific survivl (DSS) nd disese free survivl (DFS) were clculted using the Kpln Meier method nd differences in survivl curves were nlyzed using the log rnk test. The Cox proportionl hzrds model ws used for multivrite nlysis, fter relevnt prognostic vribles hd been defined by univrite nlysis. Dt were nlyzed using JMP v10 softwre (JMP, SAS Institute, Cry, North Crolin, USA). P<0.05 ws considered to indicte sttisticlly significnt differences. Results Ptient no. Age, yers (men ± SD) 63±13.5 Gender Mle 83 Femle 24 Opertive method TGX 45 DGX 57 PGX 3 Gstrojejunostomy 1 Explortory lprotomy 1 UICC stge 0 2 IA 12 IB 11 IIA 7 IIB 12 IIIA 8 IIIB 10 IIIC 10 IV 35 SD, stndrd devition; DGX, distl gstrectomy; PGX, proximl gstrectomy; TGX, totl gstrectomy; UICC, Union for Interntionl Cncer Control. Ptient demogrphics. The 107 subjects in this study included 83 men nd 24 women, with medin ge of 63 yers (rnge, yers) (Tble I). Of the 107 ptients, 45 underwent totl gstrectomy, 57 distl gstrectomy, 3 proximl gstrectomy, 1 gstrojejunostomy nd 1 explortory lprotomy. Correltion between pzeb1 nd clinicopthologicl fctors. pzeb1 ws techniclly detectble in ll 107 ptients by qpcr.

3 MOLECULAR AND CLINICAL ONCOLOGY 3: , Tble II. Correltion between clinicopthologicl vribles nd pzeb1 expression in ptients with gstric cncer. pzeb1 Low pzeb1 High P-vlue Vribles (n=80) (n=27) Gender 0.30 Mle Femle 16 8 Age, yers < Tumor size, cm < Histologicl type 0.38 Diffuse Intestinl 28 7 Pthologicl T stge pt1/ pt3/ Vsculr involvement Present Absent 42 7 Lymphtic vessel involvement 0.20 Present Absent 15 2 Lymph node metstsis 0.45 Present Absent 28 7 Liver metstsis 0.16 Present 7 5 Absent Peritonel dissemintion 0.22 Present 10 6 Absent Peritonel wshing cytology 0.46 Present 18 8 Absent TNM stge 0.16 I/II 36 8 III/IV Sttisticlly significnt. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing The vlues rnged from 3.0x10-6 to 7.0x10-3 µg/µl (medin, 1.2x10 - µg/µl). The pzeb1 cut off point ws set t the top qurtile, which ws 3.5x10-4 µg/µl. Accordingly, ptients with low pzeb1 expression (<3.5x10-4 µg/µl) were ssigned to the pzeb1 Low group (n=80), wheres those with high expression ( 3.5x10-4 µg/µl) were ssigned to the pzeb1 High group (n=27). The nlysis of pzeb1 expression nd vrious clinicopthologicl fctors (Tble II) reveled tht pzeb1 ws correlted with pthologicl T stge (P=0.03) nd vsculr involvement (P=0.03), but not with gender, ge, tumor size, histologicl type, lymphtic vessel involvement, lymph node metstsis, liver metstsis, peritonel dissemintion, peritonel wshing cytology, or TNM stge. Ptient survivl by pzeb1 expression. The survivl curves of ptients with gstric cncer by pzeb1 expression re presented in Fig. 1. DSS ws significntly lower in ptients with pzeb1 High expression compred to those with pzeb1 Low expression. The

4 438 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER Figure 1. Survivl curves for gstric cncer ptients by pzeb1 expression sttus. (A) Disese specific survivl; (B) disese free survivl. The ptients with pzeb1 High expression exhibited significntly poorer prognosis compred to those with pzeb1 Low expression (A) P=0.02, (B) P=0.03, log rnk test. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Figure 2. Survivl curves for gstric cncer ptients bsed on wshing cytology nd pzeb1 expression. The ptients were subclssified into 4 types bsed on wshing cytology nd pzeb1 expression. Disese specific survivl ws significntly lower in ptients with pzeb1 High expression compred to those with pzeb1 Low expression. (CY0 group, P=0.01; CY1 group, P=0.13). pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing; CY0, negtive cytology; CY1, positive cytology; NA, not pplicble. 5 yer DSS ws 36.4% in the pzeb1 High group nd 64.7% in the pzeb1 Low group (P=0.02), wheres the 5 yer DFS ws 46.9%, in the pzeb1 High group nd 83.0% in the pzeb1 Low group (P=0.03). The ptients were next subclssified into 4 groups ccording to negtive or positive peritonel wshing cytology (CY0 nd CY1, respectively) s follows: CY0 pzeb1 Low, CY0 pzeb1 High, CY1/pZEB1 Low nd CY1 pzeb1 High. In the CY0 group, DSS ws significntly lower in the pzeb1 High group compred to tht in the pzeb1 Low group. The 5 yer survivl rte ws 48.7% in the CY0 pzeb1 High group nd 82.0% in the CY0 pzeb1 Low group (P=0.01). In the CY1 group, DSS ws lso lower mong ptients with pzeb1 High expression compred to those with pzeb1 Low expression. The 5 yer survivl rte ws 0% in the CY1 pzeb1 High group nd 9.3% in the CY1 pzeb1 Low group (P=0.13) (Fig. 2). pzeb1 s predictor of recurrence fter surgery. Among the 18 ptients who developed recurrences fter surgery, 10 ptients hd pzeb1 Low expression nd 8 hd pzeb1 High expression. The recurrence rte in the pzeb1 High group (8/27) ws significntly higher compred to tht in the pzeb1 Low group (10/80; P=0.03,

5 MOLECULAR AND CLINICAL ONCOLOGY 3: , Tble III. Correltion of pzeb1 expression sttus with recurrence of gstric cncer nd recurrence site. A, Correltion of pzeb1 expression with recurrence pzeb1 Low pzeb1 High Recurrence (n=54) (n=18) P-vlue Yes No B, Correltion of pzeb1 expression with recurrence site Recurrence site No. pzeb1 Low/High Lymph nodes 6 4/2 Peritoneum 6 2/4 Liver 5 3/2 Lung 1 1/0 Sttisticlly significnt. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Tble IV. Chrcteristics of ptients with pzeb1 High expression excluding those with stge IV disese. Ptients Age (yrs) Gender DFS Recurrence site T stge Metstsis Histology 1 62 F 48 Peritoneum T4 N3 Diffuse 2 60 F 28 Peritoneum T4 N1 Diffuse 3 55 M 3.2 Peritoneum T4 N0 Diffuse 4 55 M 19 Peritoneum T2 N0 Diffuse 5 63 M 15 Liver T3 N3b Intestinl 6 61 M 6 Liver T3 N2 Intestinl 7 71 M 16 Lymph node T3 N2 Diffuse 8 75 F 19 Lymph node T4 N3 Diffuse 9 56 M 70 None T3 N1 Diffuse M 9.5 None T3 N0 Intestinl F 69 None T2 N0 Diffuse M 27 None T1 N0 Intestinl M 31 None T3 N0 Diffuse M 45 None T4 N1 Diffuse M 35 None T1b N0 Intestinl M 58 None T4 N1 Intestinl F 50 None T4 N2 Diffuse M 43 None T2 N0 Diffuse Metsttic lymph nodes. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing; DFS, disese free survivl (in months). Tble IIIA). Of these 18 ptients 6 developed lymph node metstses, 6 peritonel metstses, 5 liver metstses nd 1 lung metstsis. Of the 6 ptients with recurrent peritonel metstses, 4 were in the pzeb1 High group (Tble IIIB). The chrcteristics of the 18 ptients with pzeb1 High nd CY0, excluding those with stge IV disese, re summrized in Tble IV. Among these, 8 ptients ultimtely developed recurrent metstses (4 in the peritoneum, 2 in the liver nd 2 in the lymph nodes). Prognostic fctors of gstric cncer ptients by univrite nd multivrite nlysis. The univrite nlysis using the Cox proportionl hzrds model identified 9 prognostic fctors, nmely tumor size, T stge, histologicl type, lymph node metstsis, lymphtic vessel involvement, vsculr involvement, peritonel metstsis, liver metstsis nd pzeb1 expression (Tble V). However, in the multivrite nlysis of these prmeters, pzeb1 ws not identified s n independent predictor of DSS.

6 440 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER Tble V. Univrite nd multivrite nlysis of clinicopthologicl fctors for disese specific survivl. Univrite nlysis Multivrite nlysis Vribles HR 95% CI P-vlue HR 95% CI P-vlue Gender (femle) Age ( 65 yers) Tumor size ( 5 cm) Pthologicl T stge (pt3/4) < Histologicl type (diffuse) Lymph node metstsis < Lymphtic vessel involvement Vsculr involvement < Peritonel metstsis < Liver metstsis < pzeb1 High Sttisticlly significnt. HR, hzrd rtio; CI, confidence intervl; pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Discussion EMT is process through which epithelil cells ttin fibroblstic chrcteristics, which enble them to invde neighboring tissues (25,26). ETM is regulted by severl trnscription fctors, including Snil, Slug, Twist, CrB box binding fctor, mesenchyme forkhed 1, Krüppel like fctor nd ZEB1 (26 29). ZEB1 is reportedly key plyer in cncer progression (17,30 32). In prticulr, high expression of ZEB1 in endometril nd colorectl cncers nd heptocellulr crcinom hs been ssocited with poor prognosis (15,33,34). In gstric cncer, ZEB1 expression in cncer tissues hs been identified s n independent prognostic fctor (13,14). We hve lso reported correltion between high ZEB1 expression nd diffuse pthologicl cncer type (24). However, the diffuse type is known risk fctor for peritonel recurrence in gstric cncer, which supports the findings of Okugw et l (13), who reported tht high ZEB1 expression is n independent fctor for peritonel crcinomtosis. Comprisons of the expression of EMT mrkers in the primry tumor nd corresponding lymph node metstses hve been performed for severl cncer types (35,36,37). These studies demonstrted tht the expression of EMT mrkers in mture metsttic lymph nodes ws lower compred to tht in the primry lesions; therefore it ws hypothesized tht mesenchyml to epithelil trnsition (MET), the reverse phenomenon of EMT, my occur t secondry metsttic sites before the metstsized cells develop into cliniclly significnt metsttic lesions. However, Okugw et l (13) observed through immunostining tht ZEB1 expression in the peritonel metsttic sites exhibited the sme pttern s tht observed in the primry lesions. The role of EMT nd MET in the development of peritonel metstsis my be different from tht of nodl metstsis nd it my be of vlue to investigte the EMT sttus of intrperitonel cncer cells tht likely develop into visible peritonel deposits. To the best of our knowledge, there re no vilble studies investigting pzeb1 in gstric cncer ptients. The mjor finding in this study ws tht pzeb1 expression ws significntly ssocited with DSS nd DFS in ptients with gstric cncer. Furthermore, pzeb1 my be more sensitive dignostic tool for poor prognosis compred to conventionl peritonel wshing cytology, s the RT qpcr more sensitively detects intrperitonel free cncer cells nd lso becuse positive pzeb1 reflects the cpbility of the primry tumor to disseminte ZEB1 positive mesenchymlly trnsformed cells into the peritonel cvity s well s through the hemtogeneous nd lymphtic metsttic pthwys. Although ZEB1 expression in the primry lesion is lredy known s n independent prognostic fctor (13,14,24), pzeb1 expression my lso represent novel mrker of poorer prognosis. However, our results filed to demonstrte sttisticl correltions between pzeb1 nd peritonel dissemintion nd peritonel recurrence. As stted bove, lthough locl ZEB1 production by cncer cells in the peritonel cvity is the most importnt fctor in pzeb1 expression, the primry pzeb1 high tumor my disseminte metsttic nd ZEB1 producing crcinom cells to ny other sites in the body, leding to vrious other types of metstsis nd consequent cncer relted deth. Thus, pzeb1 my be correlted with poor prognosis, but not necessrily with peritonel dissemintion. There is lso possibility tht proportion of the ptients did ctully hrbor peritonel recurrence, but its mnifesttion ws preceded by other types of metstsis tht were cliniclly more relevnt. Further investigtion is required to elucidte the mechnisms underlying pzeb1 expression in lrge popultion with long term follow up. In conclusion, pzeb1 my be predictive mrker for poor prognosis or tumor ggressiveness in gstric cncer, similr to ZEB1 expression in primry lesions. pzeb1 my dd vluble informtion to conventionl peritonel wshing cytology nd, thus, help with the selection of cndidtes for more ggressive chemotherpies.

7 MOLECULAR AND CLINICAL ONCOLOGY 3: , References 1. Mcdonld JS, Smlley SR, Benedetti J, et l: Chemordiotherpy fter surgery compred with surgery lone for denocrcinom of the stomch or gstroesophgel junction. N Engl Med 345: , Cunninghm D, Allum WH, Stenning SP, et l: Periopertive chemotherpy versus surgery lone for resectble gstroesophgel cncer. N Engl Med 355: 11 20, Skurmoto S, Ssko M, Ymguchi T, et l: Adjuvnt chemotherpy for gstric cncer with S 1, n orl fluoropyrimidine. N Engl Med 357: , Allum W, Groflo A, Degiuli M nd Schuhmcher C: The first Europen Union Network of Excellence for Gstric Cncer conference, Rome, Itly, April Gstric Cncer 12: 56 65, Yonemur Y, Elnemr A, Endou Y, et l: Multidisciplinry therpy for tretment of ptients with peritonel crcinomtosis from gstric cncer. World J Gstrointest Oncol 2: 85 97, Thiery JP: Epithelil mesenchyml trnsitions in tumour progression. Nt Rev Cncer 2: , Gotzmnn J, Mikul M, Eger A, et l: Moleculr spects of epithelil cell plsticity: implictions for locl tumor invsion nd metstsis. Mutt Res 566: 9 20, Cvllro U nd Christofori G: Cell dhesion nd signlling by cdherins nd Ig CAMs in cncer. Nture Rev Cncer 4: , Tomit K, vn Bokhoven A, vn Leenders GJ, et l: Cdherin switching in humn prostte cncer progression. Cncer Res 60: , Rieger Christ KM, Cin JW, Brsch JW, et l: Expression of clssic cdherins type I in urothelil neoplstic progression. Hum Pthol 32: 18 23, Christinsen JJ nd Rjsekrn AK: Ressessing epithelil to mesenchyml trnsition s prerequisite for crcinom invsion nd metstsis. Cncer Res 66: , Klymkowsky MW nd Svgner P: Epithelil mesenchyml trnsition: cncer resercher's conceptul friend nd foe. Am J Pthol 174: , Okugw Y, Toiym Y, Tnk K, et l: Clinicl significnce of zinc finger E box binding homeobox 1 (ZEB1) in humn gstric cncer. J Surg Oncol 106: , Ji B, Liu H, Kong Q, et l: Overexpression of ZEB1 ssocited with metstsis nd invsion in ptients with gstric crcinom. Mol Cell Biochem 366: , Zhng GJ, Zhou T, Tin HP, et l: High expression of ZEB1 correltes with liver metstsis nd poor prognosis in colorectl cncer. Oncol Lett 5: , Spdern S, Schmlhofer O, Hlubek F, et l: A trnsient, EMT linked loss of bsement membrnes indictes metstsis nd poor survivl in colorectl cncer. Gstroenterology 131: , Eger A, Aigner K, Sonderegger S, et l: DeltEF1 is trnscriptionl repressor of E cdherin nd regultes epithelil plsticity in brest cncer cells. Oncogene 24: , Ohir T, Gemmill RM, Ferguson K, et l: WNT7 induces E cdherin in lung cncer cells. Proc Ntl Acd Sci USA 100: , Chu HL, Bht Nkshtri P, Clre SE, et l: NF kppb represses E cdherin expression nd enhnces epithelil to mesenchyml trnsition of mmmry epithelil cells: potentil involvement of ZEB 1 nd ZEB 2. Oncogene 26: , Grhm TR, Zhu HE, Odero Mrh VA, et l: Insulin like growth fctor I dependent up regultion of ZEB1 drives epithelil to mesenchyml trnsition in humn prostte cncer cells. Cncer Res 68: , Abe N, Wtnbe T, Tod H, et l: Prognostic significnce of crcinoembryonic ntigen levels in peritonel wshes in ptients with gstric cncer. Am J Surg 181: , Ito S, Nknishi H, Koder Y, et l: Prospective vlidtion of quntittive CEA mrna detection in peritonel wshes in gstric crcinom ptients. Br J Cncer 93: , Koder Y, Nknishi H, Ito S, et l: Prognostic significnce of intrperitonel cncer cells in gstric crcinom: detection of cytokertin 20 mrna in peritonel wshes, in ddition to detection of crcinoembryonic ntigen. Gstric Cncer 8: , Muri T, Ymd S, Fuchs BC, et l: Epithelil to mesenchyml trnsition predicts prognosis in clinicl gstric cncer. J Surg Oncol 109: , Schmlhofer O, Brbletz S nd Brbletz T: E cdherin, bet ctenin nd ZEB1 in mlignnt progression of cncer. Cncer Metstsis Rev 28: , De Wever O, Puwels P, De Crene B, et l: Moleculr nd pthologicl signtures of epithelil mesenchyml trnsitions t the cncer invsion front. Histochem Cell Biol 130: , Wldmnn J, Feldmnn G, Slter EP, et l: Expression of the zinc finger trnscription fctor Snil in drenocorticl crcinom is ssocited with decresed survivl. Br J Cncer 99: , Iwtsuki M, Mimori K, Yokobori T, et l: Epithelil mesenchyml trnsition in cncer development nd its clinicl significnce. Cncer Sci 101: , Rosivtz E, Becker I, Specht K, et l: Differentil expression of the epithelil mesenchyml trnsition regultors Snil, SIP1 nd Twist in gstric cncer. Am J Pthol 161: , Spdern S, Schmlhofer O, Whlbuhl M, et l: The trnscriptionl repressor ZEB1 promotes metstsis nd loss of cell polrity in cncer. Cncer Res 68: , Drke JM, Strohbehn G, Bir TB, et l: ZEB1 enhnces trnsendothelil migrtion nd represses the epithelil phenotype of prostte cncer cells. Mol Biol Cell 20: , Tkeym Y, Sto M, Horio M, et l: Knockdown of ZEB1, mster epithelil to mesenchyml trnsition (EMT) gene, suppresses nchorge independent cell growth of lung cncer cells. Cncer Lett 296: , Singh M, Spoelstr NS, Jen A, et l: ZEB1 expression in type I vs type II endometril cncers: mrker of ggressive disese. Mod Pthol 21: , Zhou YM, Co L, Li B, et l: Clinicopthologicl significnce of ZEB1 protein in ptients with heptocellulr crcinom. Ann Surg Oncol 19: , Kurhr H, Tko S, Memur K, et l: Epithelil mesenchyml trnsition nd mesenchyml epithelil trnsition vi regultion of ZEB 1 nd ZEB 2 expression in pncretic cncer. J Surg Oncol 105: , Toll A, Msferrer E, Hernández Ruiz ME, et l: Epithelil to mesenchyml trnsition mrkers re ssocited with n incresed metsttic risk in primry cutneous squmous cell crcinoms but re ttenuted in lymph node metstses. J Dermtol Sci 72: , Aokge K, Ishii G, Ohtki Y, et l: Dynmic moleculr chnges ssocited with epithelil mesenchyml trnsition nd subsequent mesenchyml epithelil trnsition in the erly phse of metsttic tumor formtion. Int J Cncer 128: , 2011.

Efficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis

Efficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell

More information

Impact of Positive Nodal Metastases in Patients with Thymic Carcinoma and Thymic Neuroendocrine Tumors

Impact of Positive Nodal Metastases in Patients with Thymic Carcinoma and Thymic Neuroendocrine Tumors Originl Article Impct of Positive Nodl Metstses in Ptients with Thymic Crcinom nd Thymic Neuroendocrine Tumors Benny Weksler, MD, Anthony Holden, MD, nd Jennifer L. Sullivn, MD Introduction: Thymic crcinoms

More information

Prophylactic effect of neoadjuvant chemotherapy in gastric cancer patients with postoperative complications

Prophylactic effect of neoadjuvant chemotherapy in gastric cancer patients with postoperative complications Gstric Cncer (2018) 21:703 709 https://doi.org/10.1007/s10120-017-0781-y ORIGINAL ARTICLE Prophylctic effect of neodjuvnt chemotherpy in gstric cncer ptients with postopertive complictions Kojiro Eto 1

More information

ORIGINAL ARTICLE ABSTRACT INTRODUCTION

ORIGINAL ARTICLE ABSTRACT INTRODUCTION ORIGINAL ARTICLE LOSS OF EPCAM STAINING CORRELATES WITH POOR OUTCOME IN CRC, Wng et l. Reduction in membrnous immunohistochemicl stining for the intrcellulr domin of epithelil cell dhesion molecule correltes

More information

Esophageal carcinoma is the eighth most common cancer

Esophageal carcinoma is the eighth most common cancer ORIGINAL ARTICLE Tumor-Strom Rtio Is n Independent Predictor for Survivl in Esophgel Squmous Cell Crcinom Ki Wng, MD,* Wei M, MD,* Jinbo Wng, MD,* Ling Yu, MD, Xiomei Zhng, MD, Zhenbo Wng, MD, Bingxu Tn,

More information

CheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer

CheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn

More information

Clinical manifestations in patients with alpha-fetoprotein producing gastric cancer

Clinical manifestations in patients with alpha-fetoprotein producing gastric cancer Curr Oncol, Vol. 21, pp. e394-399; doi: http://dx.doi.org/10.3747/co.21.1768 CLINICAL MANIFESTATIONS IN AFP PRODUCING GASTRIC CANCER ORIGINAL ARTICLE Clinicl mnifesttions in ptients with lph-fetoprotein

More information

Prognostic significance of pretreatment serum levels of albumin, LDH and total bilirubin in patients with nonmetastatic

Prognostic significance of pretreatment serum levels of albumin, LDH and total bilirubin in patients with nonmetastatic Crcinogenesis, 2015, Vol. 36, No. 2, 243 248 doi:10.1093/crcin/bgu247 Advnce Access publiction December 18, 2014 Originl Mnuscript originl mnuscript Prognostic significnce of pretretment serum levels of

More information

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess

More information

Significance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues

Significance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto

More information

Age related differences in prognosis and prognostic factors among patients with epithelial ovarian cancer

Age related differences in prognosis and prognostic factors among patients with epithelial ovarian cancer MOLECULAR AND CLINICAL ONCOLOGY 9: 329-334, 2018 Age relted differences in prognosis nd prognostic fctors mong ptients with epithelil ovrin cncer KENJI YOSHIKAWA, TAKESHI FUKUDA, RYO UEMURA, HIROAKI MATSUBARA,

More information

Original Article Prognostic and clinicopathologic significance of AEG-1/MTDH and E-cadherin expression in human gallbladder carcinoma

Original Article Prognostic and clinicopathologic significance of AEG-1/MTDH and E-cadherin expression in human gallbladder carcinoma Int J Clin Exp Pthol 2018;11(12):6025-6031 www.ijcep.com /ISSN:1936-2625/IJCEP0086349 Originl Article Prognostic nd clinicopthologic significnce of AEG-1/MTDH nd E-cdherin expression in humn gllbldder

More information

Lung cancer is the leading cause of cancer death worldwide, EGFR Mutation and Brain Metastasis in Pulmonary Adenocarcinomas

Lung cancer is the leading cause of cancer death worldwide, EGFR Mutation and Brain Metastasis in Pulmonary Adenocarcinomas Originl Article EGFR Muttion nd Brin Metstsis in Pulmonry Adenocrcinoms Dong-Yeop Shin, MD,* Im Il N, MD,* Cheol Hyeon Kim, MD, PhD, Sunhoo Prk, MD, PhD, HeeJong Bek, MD, PhD, nd Sung Hyun Yng, MD, PhD*

More information

CHEST. Thyroid transcription factor 1 (TTF-1) is an important. Original Research

CHEST. Thyroid transcription factor 1 (TTF-1) is an important. Original Research CHEST Originl Reserch Clinicl Significnce of Thyroid Trnscription Fctor-1 in Advnced Lung Adenocrcinom Under Epiderml Growth Fctor Receptor Tyrosine Kinse Inhibitor Tretment Kuei-Pin Chung, MD; Yen-Tsung

More information

Association between LAPTM4B gene polymorphism and susceptibility to and prognosis of diffuse large B cell lymphoma

Association between LAPTM4B gene polymorphism and susceptibility to and prognosis of diffuse large B cell lymphoma 264 Assocition between LAPTM4B gene polymorphism nd susceptibility to nd prognosis of diffuse lrge B cell lymphom HUIRONG DING 1*, XIAOJING CHENG 2*, NING DING 3*, ZHIHUA TIAN 1, JUN ZHU 3, CHUNLIAN ZHOU

More information

High EGFR mrna expression is a prognostic factor for reduced survival in pancreatic cancer after gemcitabine-based adjuvant chemotherapy

High EGFR mrna expression is a prognostic factor for reduced survival in pancreatic cancer after gemcitabine-based adjuvant chemotherapy INTERNATIONAL JOURNAL OF ONCOLOGY 38: 629-641, 2011 High EGFR mrna expression is prognostic fctor for reduced survivl in pncretic cncer fter gemcitbine-bsed djuvnt chemotherpy Hyto Fujit 1, Kenoki Ohuchid

More information

Comparative effectiveness of the tumour diagnostics,

Comparative effectiveness of the tumour diagnostics, Gut, 1987, 28, 323-329 Comprtive effectiveness of the tumour dignostics, C 19-9, C 125 nd crcinoembryonic ntigen in ptients with diseses of the digestive system K SKMOTO, Y HG, R YOSHIMR, H GMI, Y YOKOYM,

More information

American Joint Committee on Cancer Staging and Clinicopathological High-Risk Predictors of Ocular Surface Squamous Neoplasia

American Joint Committee on Cancer Staging and Clinicopathological High-Risk Predictors of Ocular Surface Squamous Neoplasia Americn Joint Committee on Cncer Stging nd Clinicopthologicl High-Risk Predictors of Oculr Surfce Squmous Neoplsi A Study From Tertiry Eye Center in Indi Sheetl Chuhn, MSc; Seem Sen, MD; Anjn Shrm, PhD;

More information

Study on the association between PI3K/AKT/mTOR signaling pathway gene polymorphism and susceptibility to gastric

Study on the association between PI3K/AKT/mTOR signaling pathway gene polymorphism and susceptibility to gastric JBUON 2017; 22(6): 1488-1493 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mil: editoril_office@jbuon.com ORIGINAL ARTICLE Study on the ssocition between PI3K/AKT/mTOR signling pthwy gene polymorphism

More information

Journal of Hainan Medical University.

Journal of Hainan Medical University. 132 Journl of Hinn Medicl University 2017; 23(11): 132-136 Journl of Hinn Medicl University http://www.hnykdxxb.com Assessment of the efficcy nd sfety of bronchil rtery perfusion chemotherpy combined with

More information

Original Article Serum tumor markers used for predicting esophagogastric junction adenocarcinoma in esophageal malignancy

Original Article Serum tumor markers used for predicting esophagogastric junction adenocarcinoma in esophageal malignancy Int J Clin Exp Med 2016;9(6):11859-11864 www.ijcem.com /ISSN:1940-5901/IJCEM0025330 Originl Article Serum tumor mrkers used for predicting esophgogstric junction denocrcinom in esophgel mlignncy Yongkng

More information

Introduction. These patients benefit less from conventional chemotherapy than patients identified as MMR proficient or microsatellite stable 3-5

Introduction. These patients benefit less from conventional chemotherapy than patients identified as MMR proficient or microsatellite stable 3-5 Nivolumb + Ipilimumb Combintion in Ptients With DNA Mismtch Repir-Deficient/Microstellite Instbility-High Metsttic Colorectl Cncer: First Report of the Full Cohort From CheckMte-142 Abstrct 553 André T,

More information

One of the most important biological mechanisms of

One of the most important biological mechanisms of Brief Report Serum Thymidine Kinse 1 Activity in the Prognosis nd Monitoring of Chemotherpy in Lung Cncer Ptients: A Brief Report Benjmin Nismn, PhD,* Hovv Nechushtn, MD, PhD,* Him Birn, MD, Hds Gntz-Sorotsky,

More information

Classic Papillary Thyroid Carcinoma with Tall Cell Features and Tall Cell Variant Have Similar Clinicopathologic Features

Classic Papillary Thyroid Carcinoma with Tall Cell Features and Tall Cell Variant Have Similar Clinicopathologic Features The Koren Journl of Pthology 2014; 48: 201-208 ORIGINAL ARTICLE Clssic Ppillry Thyroid Crcinom with Tll Cell Fetures nd Tll Cell Vrint Hve Similr Clinicopthologic Fetures Woo Jin Oh 1 Young Sub Lee 1 Uiju

More information

A review of the patterns of docetaxel use for hormone-resistant prostate cancer at the Princess Margaret Hospital

A review of the patterns of docetaxel use for hormone-resistant prostate cancer at the Princess Margaret Hospital MEDICAL ONCOLOGY A review of the ptterns of docetxel use for hormone-resistnt prostte cncer t the Princess Mrgret Hospitl S.N. Chin MD,* L. Wng MSc, M. Moore MD,* nd S.S. Sridhr MD MSc* ABSTRACT Bckground

More information

MOLECULAR AND CLINICAL ONCOLOGY 7: , 2017

MOLECULAR AND CLINICAL ONCOLOGY 7: , 2017 MOLECULAR AND CLINICAL ONCOLOGY 7: 787-797, 2017 Evlution of epiderml growth fctor receptor serum levels nd their ssocition with clinicopthologicl chrcteristics in ptients with colorectl cncer MEHMET KARABULUT

More information

Evaluation of the detection of 14 high-risk human papillomaviruses with HPV 16 and HPV 18 genotyping for cervical cancer screening

Evaluation of the detection of 14 high-risk human papillomaviruses with HPV 16 and HPV 18 genotyping for cervical cancer screening 1332 Evlution of the detection of 14 high-risk humn ppillomviruses with HPV 16 nd HPV 18 genotyping for cervicl cncer screening MEI-LU BIAN, JIAO-YING CHENG, LI MA, XIAO CONG, JUN LIU, YING CHEN nd XI

More information

Genetic polymorphisms in the TERT-CLPTM1L region and lung cancer susceptibility in Chinese males

Genetic polymorphisms in the TERT-CLPTM1L region and lung cancer susceptibility in Chinese males 1588 Genetic polymorphisms in the TERT-CLPTM1L region nd lung cncer susceptibility in Chinese mles XUYANG XIAO 1 nd WUBIN HE 2 1 Deprtment of Thorcic Surgery nd 2 Biologicl Therpy Center Lbortory, The

More information

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler

More information

Invasive Pneumococcal Disease Quarterly Report. July September 2017

Invasive Pneumococcal Disease Quarterly Report. July September 2017 Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report

More information

SYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT

SYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of

More information

RESEARCH ARTICLE. Wen Li 1, Jing Deng 2 *, Shuang-Shuang Wang 1, Liang Ma 1, Jiang Pei 1, Xiao-Xi Zeng 1, Jian-Xin Tang 1. Abstract.

RESEARCH ARTICLE. Wen Li 1, Jing Deng 2 *, Shuang-Shuang Wang 1, Liang Ma 1, Jiang Pei 1, Xiao-Xi Zeng 1, Jian-Xin Tang 1. Abstract. DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10937 Methyltion of the RAR-β Gene nd Cigrette Smoking in NSCLC in Southern-Centrl Chinese RESEARCH ARTICLE Assocition of Methyltion of the RAR-β Gene with

More information

ONCOLOGY LETTERS 14: , China Medical University, Shenyang, Liaoning , P.R. China

ONCOLOGY LETTERS 14: , China Medical University, Shenyang, Liaoning , P.R. China 4890 Expression of vsculr endothelil growth fctor nd cspse 3 in mucinous brest crcinom nd infiltrting ductl crcinom not otherwise specified, nd the correltion with disese free survivl QIULI WANG 1, LISHA

More information

Neutrophil lymphocyte ratio predicts survival in pancreatic neuroendocrine tumors

Neutrophil lymphocyte ratio predicts survival in pancreatic neuroendocrine tumors 2454 Neutrophil lymphocyte rtio predicts survivl in pncretic neuroendocrine tumors GUOPEI LUO 1 3*, CHEN LIU 1 3*, HE CHENG 1 3*, KAIZHOU JIN 1 3, MENG GUO 1 3, YU LU 1 3, JIANG LONG 1 3, JIN XU 1 3, QUANXING

More information

Aberrant expression of B7-H4 correlates with poor prognosis and suppresses tumor-infiltration of CD8 + T lymphocytes in human cholangiocarcinoma

Aberrant expression of B7-H4 correlates with poor prognosis and suppresses tumor-infiltration of CD8 + T lymphocytes in human cholangiocarcinoma ONCOLOGY REPORTS 36: 419-427, 2016 Aberrnt expression of B7-H4 correltes with poor prognosis nd suppresses tumor-infiltrtion of CD8 + T lymphocytes in humn cholngiocrcinom Xin Zho *, Fei Guo *, Zhonghu

More information

DA XU *, XIAOFENG LIU *, LIJUN WANG and BAOCAI XING

DA XU *, XIAOFENG LIU *, LIJUN WANG and BAOCAI XING ONCOLOGY LETTERS Heptectomy plus djuvnt trnsctheter rteril chemoemboliztion improves the survivl rte of ptients with multicentric occurrence of heptocellulr crcinom DA XU *, XIAOFENG LIU *, LIJUN WANG

More information

Methylation of a Panel of MicroRNA Genes Is a Novel Biomarker for Detection of Bladder Cancer

Methylation of a Panel of MicroRNA Genes Is a Novel Biomarker for Detection of Bladder Cancer EUROPEAN UROLOGY 6 (1) 191 11 vilble t www.sciencedirect.com journl homepge: www.europenurology.com Urothelil Cncer Methyltion of Pnel of MicroRNA Genes Is Novel Biomrker for Detection of Bldder Cncer

More information

Association of PTEN expression with liver function and inflammatory changes in patients with liver cancer after chemotherapy

Association of PTEN expression with liver function and inflammatory changes in patients with liver cancer after chemotherapy ONCOLOGY LETTERS Assocition of PTEN expression with liver function nd inflmmtory chnges in ptients with liver cncer fter chemotherpy JIXIANG ZHOU nd XIAOLI LI Deprtment of Heptobiliry Surgery, Xingy Hospitl,

More information

Biliary tract cancer treatment: 5,584 results from the Biliary Tract Cancer Statistics Registry from 1998 to 2004 in Japan

Biliary tract cancer treatment: 5,584 results from the Biliary Tract Cancer Statistics Registry from 1998 to 2004 in Japan J Heptoiliry Pncret Surg (2009) 16:1 7 DOI 10.1007/s00534-008-0015-0 TOPICS Biliry trct cncer sttistics registry in Jpn Biliry trct cncer tretment: 5,584 results from the Biliry Trct Cncer Sttistics Registry

More information

Community. Profile Yellowstone County. Public Health and Safety Division

Community. Profile Yellowstone County. Public Health and Safety Division Community Helth Profile 2015 Yellowstone County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

A cross-sectional and follow-up study of leukopenia in tuberculosis patients: prevalence, risk factors and impact of anti-tuberculosis

A cross-sectional and follow-up study of leukopenia in tuberculosis patients: prevalence, risk factors and impact of anti-tuberculosis Originl Article A cross-sectionl nd follow-up study of leukopeni in tuberculosis ptients: prevlence, risk fctors nd impct of nti-tuberculosis tretment Fei-Shen Lin 1 *, Mei-Ying Wu 2 *, Wen-Jun Tu 3, Hong-Qiu

More information

Community. Profile Lewis & Clark County. Public Health and Safety Division

Community. Profile Lewis & Clark County. Public Health and Safety Division Community Helth Profile 2015 Lewis & Clrk County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

Community. Profile Missoula County. Public Health and Safety Division

Community. Profile Missoula County. Public Health and Safety Division Community Helth Profile 2015 Missoul County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Correlation between CT features and liver function and p53 expression in hepatitis, cirrhosis and hepatocellular carcinoma

Correlation between CT features and liver function and p53 expression in hepatitis, cirrhosis and hepatocellular carcinoma ONCOLOGY LETTERS Correltion between CT fetures nd liver function nd p53 expression in heptitis, cirrhosis nd heptocellulr crcinom YAHUI HU, JING WU, SHA LI nd XIAOXIAO ZHAO Deprtment of Nucler Medicine,

More information

Community. Profile Powell County. Public Health and Safety Division

Community. Profile Powell County. Public Health and Safety Division Community Helth Profile 2015 Powell County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Community. Profile Big Horn County. Public Health and Safety Division

Community. Profile Big Horn County. Public Health and Safety Division Community Helth Profile 2015 Big Horn County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl

More information

Original Article. Breast Care 2016;11: DOI: /

Original Article. Breast Care 2016;11: DOI: / Originl Article Brest Cre 2016;11:323 327 DOI: 10.1159/000452079 Published online: October 24, 2016 Neodjuvnt Chemotherpy with Docetxel, Crbopltin nd Weekly Trstuzumb Is Active in HER2-Positive Erly Brest

More information

Relation of Tumor Size, Lymph Node Status, and Survival in

Relation of Tumor Size, Lymph Node Status, and Survival in Reltion of Tumor Size, Lymph Node Sttus, nd Survivl in 24,74 Brest Cncer Cses CHRISTINE L. CARTER, PHD, MPH,* CAROL ALLEN, PHD,t AND DONALD E. HENSON, MD* Two of the most importnt prognostic indictors

More information

Efficacy of Sonidegib in Patients With Metastatic BCC (mbcc)

Efficacy of Sonidegib in Patients With Metastatic BCC (mbcc) AAD 216 eposter 3368 Efficcy of Sonidegib in Ptients With Metsttic BCC (mbcc) Colin Morton, 1 Michel Migden, 2 Tingting Yi, 3 Mnish Mone, 3 Dlil Sellmi, 3 Reinhrd Dummer 4 1 Stirling Community Hospitl,

More information

XII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV

XII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies

More information

Rheumatoid-susceptible alleles of HLA-DRB 1 are genetically recessive to non-susceptible alleles in the progression of bone destruction in the wrists

Rheumatoid-susceptible alleles of HLA-DRB 1 are genetically recessive to non-susceptible alleles in the progression of bone destruction in the wrists Annls of the Rheumtic Diseses 1994; 53: 587-592 587 Deprtment of Orthopedic Surgery, Knsi Medicl University, Otokoym Hospitl, Kyoto, Jpn Y Tod Y Mori Deprtment of Orthopedic Surgery, Knsi Medicl University,

More information

Patient Survival After Surgical Treatment of Rectal Cancer

Patient Survival After Surgical Treatment of Rectal Cancer Originl Article Ptient Survivl After Surgicl Tretment of Rectl Cncer Impct of Surgeon nd Hospitl Chrcteristics Dvid A. Etzioni, MD, MSHS 1,2 ; Toni M. Young-Fdok, MD, MS 1 ; Robert R. Cim, MD, MA 2,3 ;

More information

Risk of Colorectal Cancer by Subsite in a Swedish Prostate Cancer Cohort

Risk of Colorectal Cancer by Subsite in a Swedish Prostate Cancer Cohort Specil Report Risk of Colorectl Cncer by Subsite in Swedish Prostte Cncer Cohort Yunxi Lu, MD, PhD, Rickrd Ljung, MD, PhD, Ann Mrtling, MD, PhD, nd Mts Lindbld, MD, PhD Bckground: The reltionship between

More information

Using proliferative markers and Oncotype DX in therapeutic decision-making for breast cancer: the B.C. experience

Using proliferative markers and Oncotype DX in therapeutic decision-making for breast cancer: the B.C. experience ORIGINAL ARTICLE Using prolifertive mrkers nd Oncotype DX in therpeutic decision-mking for brest cncer: the B.C. experience E. Bxter bsc,* L. Gondr btech pdc, C. Lohrisch md, S. Chi md, K. Gelmon md, M.

More information

P (RCC) was first done in the late 1930s and reported in

P (RCC) was first done in the late 1930s and reported in Pulmonry Resection of Metsttic Renl Cell Crcinom Robert J. Cerfolio, MD, Mrk S. Allen, MD, Clude Deschmps, MD, Richrd C. Dly, MD, Steven L. Wllrichs, BS, Victor F. Trstek, MD, nd Peter C. Pirolero, MD

More information

Effects of modified FOLFOX-6 chemotherapy on cellular immune function in patients with gastric cancer

Effects of modified FOLFOX-6 chemotherapy on cellular immune function in patients with gastric cancer ONCOLOGY LETTERS 15: 8635-8640, 2018 Effects of modified FOLFOX-6 chemotherpy on cellulr immune function in ptients with gstric cncer LIANG WANG 1, DONGER ZHOU 1, HAITAO REN 2 nd YAN CHEN 3 Deprtments

More information

Community. Profile Anaconda- Deer Lodge County. Public Health and Safety Division

Community. Profile Anaconda- Deer Lodge County. Public Health and Safety Division Community Helth Profile 2015 Ancond- Deer Lodge County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12

More information

Body mass index, waist-to-hip ratio, and metabolic syndrome as predictors of middle-aged men's health

Body mass index, waist-to-hip ratio, and metabolic syndrome as predictors of middle-aged men's health Originl Article - Sexul Dysfunction/Infertility pissn 2005-6737 eissn 2005-6745 Body mss index, wist-to-hip rtio, nd metbolic syndrome s predictors of middle-ged men's helth Jung Hyun Prk *, In-Chng Cho

More information

Prognostic significance of microrna 200c in various types of cancer: An updated meta analysis of 34 studies

Prognostic significance of microrna 200c in various types of cancer: An updated meta analysis of 34 studies MOLECULAR AND CLINICAL ONCOLOGY 4: 933-941, 2016 Prognostic significnce of microrna 200c in vrious types of cncer: An updted met nlysis of 34 studies JIA YI ZHANG 1*, YA MIN WANG 1*, LE BIN SONG 2*, CHEN

More information

IMpower133: Primary PFS, OS, and safety in a Ph1/3 study of 1L atezolizumab + carboplatin + etoposide in extensive-stage SCLC

IMpower133: Primary PFS, OS, and safety in a Ph1/3 study of 1L atezolizumab + carboplatin + etoposide in extensive-stage SCLC IMpower133: Primry PFS, OS, nd sfety in Ph1/3 study of 1L tezolizumb + crbopltin + etoposide in extensive-stge SCLC S. V. Liu, 1 A. S. Mnsfield, 2 A. Szczesn, 3 L. Hvel, 4 M. Krzkowski, 5 M. J. Hochmir,

More information

Case Report INTRODUCTION CASE REPORT. pissn eissn X

Case Report INTRODUCTION CASE REPORT. pissn eissn X pissn 2287-2728 eissn 2287-285X Cse Report Clinicl nd Moleculr Heptology 2018;24:424-429 Complete cure of dvnced heptocellulr crcinom with right drenl glnd metstsis nd portl vein thrombosis by multiple

More information

Asian Journal of Andrology (2017) 19,

Asian Journal of Andrology (2017) 19, (2017) 19, 20 25 2017 AJA, SIMM & SJTU. All rights reserved 1008-682X www.sindro.com; www.jndrology.com Prostte Cncer Open Access ORIGINAL ARTICLE Refining the Americn Urologicl Assocition nd Americn Society

More information

Systematic review of actual 10-year survival following resection for hepatocellular carcinoma

Systematic review of actual 10-year survival following resection for hepatocellular carcinoma DOI:10.1111/j.1477-2574.2012.00446.x HPB SYSTEMATIC REVIEW Systemtic review of ctul 10-yer survivl following resection for heptocellulr crcinom Annelise M. Gluer 1, Nichols Cocco 1, Jerome M. Lurence 1,2,

More information

A retrospective, single center cohort study on 65 patients with primary retroperitoneal liposarcoma

A retrospective, single center cohort study on 65 patients with primary retroperitoneal liposarcoma ONCOLOGY LETTERS 15: 1799-1810, 2018 A retrospective, single center cohort study on 65 ptients with primry retroperitonel liposrcom YI XI WU 1, JUN YAN LIU 1*, JIA JIA LIU 1*, PENG YAN 1, BO TANG 1, YOU

More information

Overexpression of FOXM1 Is a Potential Prognostic Marker in Male Breast Cancer

Overexpression of FOXM1 Is a Potential Prognostic Marker in Male Breast Cancer Originl Article Oncol Res Tret 2017;40:167 172 DOI: 10.1159/000458156 Received: September 13, 2016 Accepted: Jnury 26, 2017 Published online: Mrch 15, 2017 Overexpression of FOXM1 Is Potentil Prognostic

More information

Adjuvant chemotherapy for colon carcinoma with positive lymph nodes: use and benefit in routine health care practice

Adjuvant chemotherapy for colon carcinoma with positive lymph nodes: use and benefit in routine health care practice doi: 10.1054/ bjoc.2001.2035, vilble online t http://www.idelibrry.com on http://www.bjcncer.com Adjuvnt chemotherpy for colon crcinom with positive lymph nodes: use nd benefit in routine helth cre prctice

More information

R Martino 1, P Romero 1, M Subirá 1, M Bellido 1, A Altés 1, A Sureda 1, S Brunet 1, I Badell 2, J Cubells 2 and J Sierra 1

R Martino 1, P Romero 1, M Subirá 1, M Bellido 1, A Altés 1, A Sureda 1, S Brunet 1, I Badell 2, J Cubells 2 and J Sierra 1 Bone Mrrow Trnsplnttion, (1999) 24, 283 287 1999 Stockton Press All rights reserved 0268 3369/99 $12.00 http://www.stockton-press.co.uk/bmt Comprison of the clssic Glucksberg criteri nd the IBMTR Severity

More information

Supplementary Online Content

Supplementary Online Content Supplementry Online Content Zulmn DM, Pl Chee C, Ezeji-Okoye SC, et l. Effect of n intensive outptient progrm to ugment primry cre for high-need Veterns Affirs ptients: rndomized clinicl tril. JAMA Intern

More information

Community. Profile Carter County. Public Health and Safety Division

Community. Profile Carter County. Public Health and Safety Division Community Helth Profile 2015 Crter County Public Helth nd Sfety Division Tble of Contents Demogrphic Informtion 1 Communicble Disese 3 Chronic Disese 4 Mternl nd Child Helth 10 Mortlity 12 Behviorl Risk

More information

Improved prognosis of postoperative hepatocellular carcinoma patients when treated with functional foods: a prospective cohort study

Improved prognosis of postoperative hepatocellular carcinoma patients when treated with functional foods: a prospective cohort study Journl of Heptology 37 (2002) 78 86 www.elsevier.com/locte/jhep Improved prognosis of postopertive heptocellulr crcinom ptients when treted with functionl foods: prospective cohort study Yoichi Mtsui*,

More information

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.

More information

High expression of class III β tubulin in upper gastrointestinal cancer types

High expression of class III β tubulin in upper gastrointestinal cancer types ONCOLOGY LETTERS High expression of clss III β tubulin in upper gstrointestinl cncer types DORIS HÖFLMAYER 1*, ERAY ÖZTÜRK 1*, CORNELIA SCHROEDER 2, CLAUDIA HUBE MAGG 1, NICLAS C. BLESSIN 1, RONALD SIMON

More information

Prognostic factors in tongue cancer relative importance of demographic, clinical and histopathological factors

Prognostic factors in tongue cancer relative importance of demographic, clinical and histopathological factors British Journl of Cncer (2000) 83(5), 614 619 doi: 10.1054/ bjoc.2000.1323, vilble online t http://www.idelibrry.com on Prognostic fctors in tongue cncer reltive importnce of demogrphic, clinicl nd histopthologicl

More information

MOLECULAR AND CLINICAL ONCOLOGY 5: , 2016

MOLECULAR AND CLINICAL ONCOLOGY 5: , 2016 MOLECULAR AND CLINICAL ONCOLOGY 5: 429-436, 2016 Improvement of survivl with postmstectomy rdiotherpy in ptients with 1-3 positive xillry lymph nodes: A systemtic review nd met-nlysis of the current literture

More information

Association on polymorphisms in LncRNA HOTAIR and susceptibility to HNSCC in Chinese population

Association on polymorphisms in LncRNA HOTAIR and susceptibility to HNSCC in Chinese population Europen Review for Medicl nd Phrmcologicl Sciences 2018; 22: 702-706 Assocition on polymorphisms in LncRNA HOTAIR nd susceptibility to HNSCC in Chinese popultion B. WU 1, J. LIU 2, B. WANG 2, X. LIAO 1,

More information

Human leukocyte antigen-drb1 polymorphism in childhood acute lymphoblastic leukemia

Human leukocyte antigen-drb1 polymorphism in childhood acute lymphoblastic leukemia MOLECULAR AND CLINICAL ONCOLOGY 3: 425-429, 2015 Humn leukocyte ntigen-drb1 polymorphism in childhood cute lymphoblstic leukemi MERVAT M. EL ANSARY 1, LAMIAA A. MOHAMMED 2, TAMER H. HASSAN 3, AHMED BARAKA

More information

Utilization of dental services in Southern China. Lo, ECM; Lin, HC; Wang, ZJ; Wong, MCM; Schwarz, E

Utilization of dental services in Southern China. Lo, ECM; Lin, HC; Wang, ZJ; Wong, MCM; Schwarz, E Title Utiliztion of dentl services in Southern Chin Author(s) Lo, ECM; Lin, HC; Wng, ZJ; Wong, MCM; Schwrz, E Cittion Journl Of Dentl Reserch, 2001, v. 80 n. 5, p. 1471-1474 Issued Dte 2001 URL http://hdl.hndle.net/10722/53200

More information

Analysis of Risk Factors for the Development of Incisional and Parastomal Hernias in Patients after Colorectal Surgery

Analysis of Risk Factors for the Development of Incisional and Parastomal Hernias in Patients after Colorectal Surgery Originl Article Journl of the Koren Society of J Koren Soc Coloproctol 2012;28(6):299-303 http://dx.doi.org/10.3393/jksc.2012.28.6.299 pissn 2093-7822 eissn 2093-7830 Anlysis of Risk Fctors for the Development

More information

Safety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA

Safety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA Sfety nd Tolerbility of Subcutneous Srilumb nd Intrvenous Tocilizumb in Ptients With RA Pul Emery, 1 Jun Rondon, 2 Anju Grg, 3 Hubert vn Hoogstrten, 3 Neil M.H. Grhm, 4 Ming Liu, 4 Nncy Liu, 3 Jnie Prrino,

More information

Tumor Vascularity Does Not Predict Response to Yttrium-90 Radioembolization for Hepatic Metastases from Colorectal Cancer

Tumor Vascularity Does Not Predict Response to Yttrium-90 Radioembolization for Hepatic Metastases from Colorectal Cancer Originl Article 3 Tumor Vsculrity Does Not Predict Response to Yttrium-90 Rdioemboliztion for Heptic Metstses from Colorectl Cncer Alipi V. Nydenov Willim P. Hrris 2 Guy E. Johnson 3 Dniel S. Hippe 4 Siddhrth

More information

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer

Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA

More information

Comparison of three simple methods for the

Comparison of three simple methods for the J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis

More information

Breast carcinoma grading by histologic features has

Breast carcinoma grading by histologic features has Originl Articles Mitotic Index of Invsive Brest Crcinom Achieving Cliniclly Meningful Precision nd Evluting Tertil Cutoffs John S. Meyer, MD; Eric Costto, PhD; Hns Peter Grf, PhD Context. Mitotic figure

More information

Assessment of Depression in Multiple Sclerosis. Validity of Including Somatic Items on the Beck Depression Inventory II

Assessment of Depression in Multiple Sclerosis. Validity of Including Somatic Items on the Beck Depression Inventory II Assessment of Depression in Multiple Sclerosis Vlidity of Including Somtic Items on the Beck Depression Inventory II Peggy Crwford, PhD; Noh J. Webster, MA Signs nd symptoms of multiple sclerosis (MS)

More information

MOLECULAR AND CLINICAL ONCOLOGY 7: , 2017

MOLECULAR AND CLINICAL ONCOLOGY 7: , 2017 336 Effect of intrtumorl bscess/necrosis on the outcome for hed nd neck cncer ptients treted by hypofrctionted stereotctic re irrdition using CyberKnife HIDEYA YAMAZAKI 1,2, MIKIO OGITA 3, KENGO HIMEI

More information

Clinical Pattern of Recurrent Disease during the Follow-Up of Rectal Carcinoma

Clinical Pattern of Recurrent Disease during the Follow-Up of Rectal Carcinoma Originl Pper Received: December 20, 2016 Accepted: Februry 13, 2017 Published online: Mrch 14, 2017 Clinicl Pttern of Recurrent Disese during the Follow-Up of Rectl Crcinom Thijs Wieldrijer Pscl Bruin

More information

The potential future of targeted radionuclide therapy: implications for occupational exposure? P. Covens

The potential future of targeted radionuclide therapy: implications for occupational exposure? P. Covens The potentil future of trgeted rdionuclide therpy: implictions for occuptionl exposure? Introduction: Trgeted Rdionuclide Therpy (TRT) Systemic tretment Molecule lbelled with rdionuclide delivers toxic

More information

phosphatase isoenzyme activity: estimation of

phosphatase isoenzyme activity: estimation of J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry

More information

Completion pneumonectomy (CP) refers to the complete

Completion pneumonectomy (CP) refers to the complete ORIGINAL ARTICLE Completion Pneumonectomy in Ptients with Cncer Postopertive Survivl nd Mortlity Fctors Myeul Tbutin, MD, MSc,* Sébstien Courud, MD, MSc, Benoit Guibert, MD, Pierre Mulsnt, MD, Pierre-Jen

More information

Correlations Between Cytogenetic and Molecular Monitoring Among Patients With Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase

Correlations Between Cytogenetic and Molecular Monitoring Among Patients With Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase Originl Articles Correltions Between Cytogenetic nd Moleculr Monitoring Among Ptients With Newly Dignosed Chronic Myeloid Leukemi in Chronic Phse Post Hoc Anlyses of the Rtionle nd Insight for Gleevec

More information

The Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes

The Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,

More information

University of Texas Health Science Center, San Antonio, San Antonio, Texas, USA

University of Texas Health Science Center, San Antonio, San Antonio, Texas, USA Lung Cncer Chemotherpy Given Ner the End of Life by Community Oncologists for Advnced Non-Smll Cell Lung Cncer Jose R. Murillo, Jr., Jim Koeller b,c Methodist Hospitl, Houston, Texs, USA; b University

More information

Opioid Use and Survival at the End of Life: A Survey of a Hospice Population

Opioid Use and Survival at the End of Life: A Survey of a Hospice Population 532 Journl of Pin nd Symptom Mngement Vol. 32 No. 6 December 2006 NHPCO Originl Article Opioid Use nd Survivl t the End of Life: A Survey of Hospice Popultion Russell K. Portenoy, MD, Un Sibircev, BA,

More information

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2

Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2 Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry

More information

CheckMate-142 Study Design

CheckMate-142 Study Design Nivolumb + Ipilimumb Combintion in Ptients With DNA Mismtch Repir-Deficient/Microstellite Instbility-High Metsttic Colorectl Cncer: First Report of the Full Cohort From CheckMte-142 Thierry André, 1 Sr

More information

Oral UFT (uracil plus futrafur) for neoadjuvant chemotherapy of gastric cancer

Oral UFT (uracil plus futrafur) for neoadjuvant chemotherapy of gastric cancer 64 Gstric Cncer (1999) 2: 64 73 Y. Nio et l.: Neodjuvnt UFT for gstric cncer 1999 by Interntionl nd Jpnese Gstric Cncer Associtions Originl rticle Orl UFT (urcil plus futrfur) for neodjuvnt chemotherpy

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+

More information

PD L1 expression is associated with advanced non small cell lung cancer

PD L1 expression is associated with advanced non small cell lung cancer ONCOLOGY LETTERS 12: 921-927, 2016 PD L1 expression is ssocited with dvnced non smll cell lung cncer ZHIQUAN CHEN 1 3, JIANDONG MEI 3 5, LUNXU LIU 4,5, GUOCHEN WANG 2, ZUOSHENG LI 2, JINGPU HOU 2, QIUYANG

More information