mir-154 suppresses non-small cell lung cancer growth in vitro and in vivo

Size: px
Start display at page:

Download "mir-154 suppresses non-small cell lung cancer growth in vitro and in vivo"

Transcription

1 ONCOLOGY REPORTS 33: , 2015 mir-154 suppresses non-small cell lung cancer growth in vitro and in vivo Xingyu Lin 1, Zhiguang Yang 2, Peng Zhang 1 and Guoguang Shao 1 Departments of 1 Thoracic Surgery and 2 Anesthesiology, The First Hospital of Jilin University, Changchun, Jilin , P.R. China Received December 13, 2014; Accepted February 24, 2015 DOI: /or Abstract. mir-154 has been proven to act as a tumor suppressor in several types of tumors. However, its role in non-small cell lung cancer (NSCLC) remains unclear. Thus, the aim of this study was to investigate the effects of mir-154 on NSCLC tumorigenesis and development. Using real-time quantitative PCR (qrt-pcr), we analyzed expression of mir-154 at the transcriptional level in 40 NSCLC tumor tissues and matched adjacent normal tissues and the correlation with clinicopathological features of the patients. The mir-154 mimic was stably transfected into NSCLC A549 cells, and the effects of mir-154 on cancer cell proliferation, colony formation, cell cycle arrest, apoptosis, migration and invasion in vitro, and on the growth of in vivo xenografts were investigated. mir-154 expression levels were significantly downregulated in the NSCLC compared to the corresponding non-cancerous lung tissues (P<0.05), and decreased mir-154 expression was significantly associated with metastasis (P<0.001), larger tumor size (P<0.001) and advanced TNM stage (P<0.001). Furthermore, transfection of the mir-154 mimic into the NSCLC A549 cells was able to inhibit cell proliferation, colony formation, invasion and migration, and induce cell apoptosis and G0/G1 cell cycle arrest. Enforced expression of mir-154 also suppressed the growth of cancer cell xenografts in vivo. These findings indicate that mir-154 may become a potential target for mirbased therapy of NSCLC. Introduction Lung cancer is the most commonly diagnosed type of cancer and is one of the leading causes of tumor-related deaths among adults worldwide (1). Among all forms of lung cancer, non-small cell lung cancer (NSCLC) is the predominant Correspondence to: Professor Guoguang Shao, Department of Thoracic Surgery, The First Hospital of Jilin University, Changchun, Jilin , P.R. China shaoguoguang520@163.com Key words: microrna, mir-154, non-small cell lung cancer, tumor growth type accounting for 75-80% of all cases (2). Despite great progress in early diagnosis and treatment strategies in recent decades, patients with NSCLC are normally associated with poor prognosis (2,3), with an estimated 5-year survival rate of <16% according to data from the International Association for the Study of Lung Cancer (IASLC). Therefore, it is of great significance to further our understanding of the molecular mechanisms underlying non-small cell lung carcinogenesis to develop better diagnostic and treatment methods, thereby improving the survival and quality of life of lung cancer patients. micrornas (mirnas) are a class of small, well-conserved, non-coding, single-stranded RNAs nucleotides in length (4). mirnas can negatively regulate gene expression by binding partially and complementarily to the 3'-untranslated regions (UTRs) of target mrnas at the post-transcriptional level, resulting in mrna degradation or inhibition of translation (4-6). Emerging evidence has demonstrated that mirnas are involved in various physiological, biological and pathological processes, such as, cell differentiation, proliferation, invasion and death (6,7). A growing body of evidence strongly suggests that the deregulation or dysfunction of mirnas contributes to human carcinogenesis and cancer progression (5,7-10). mirnas may function as either oncogenes or tumor suppressors based on the roles of their target genes (7). In terms of NSCLC, recent reports indicate that certain mirnas play important roles in the pathogenesis of lung cancer, and may function as potential biomarkers for NSCLC diagnosis, progression, and as therapeutic tools (10,11). Among the mirnas correlated with carcinogenesis, mir-154 is one of importance. The mir-154 cluster, located in the human imprinted 14q32 domain (mouse chromosome 12F2), is a very conservative mirna cluster in mammals (12). Dysregulation of mir-154 has been reported in various types of cancer, such as prostate (13), breast (14), colorectal (15) and thyroid cancer (16). Recently, several studies have demonstrated that mir-154 acts as a tumor suppressor and possesses inhibitory effects on cancer cell proliferation, migration and invasion (15,17,18). In lung cancer, mir-154 was found to be weakly expressed in cancerous tissues compared to normal lung tissues (19). However, to our knowledge, the correlation between mir-154 dysregulation and clinicopathological characteristics of NSCLC, and the functional attributes of mir-154 associated with NSCLC progression remain unclear.

2 3054 lin et al: mir-154 suppresses NSCLC growth Therefore, in the present study, we firstly examined the expression level of mir-154 in NSCLC cancer cell lines and cancer patients. Then, we transfected the mir-154 mimic into the A549 cells to investigate the functional role of mir-154 in regulating NSCLC proliferation, apoptosis, cell cycle arrest, migration and invasion, and tumor growth of xenografts in vivo. These studies contribute to improve our understanding of the underlying mechanisms of mir-154 regulation in NSCLC. Materials and methods Tissue samples. NSCLC samples and the corresponding adjacent tissues were collected from 40 patients that had undergone routine surgery at the First Hospital of Jilin University from April 2008 to June Normal lung tissues adjacent to the tumors were obtained 5 cm away from the lung tumor cells, and the lack of tumor cell infiltration was verified by pathological examination. All tissues were immediately snap frozen in liquid nitrogen, and stored at -80 C until RNA extraction. This study was approved by the Ethics Committee of Jilin University, and written informed consent was obtained from all study participants. Cell culture. The lung cancer cell lines (A549, H1299, SPCA1 and H358) and normal lung cells (BEAS-2B) used in this study were purchased from the Institute of Biochemistry and Cell Biology (Shanghai, China). All cell lines were cultured in RPMI-1640 medium (Gibco-BRL, Carlsbad, CA, USA) with 10% fetal bovine serum (HyClone, Logan, UT, USA) and penicillin (100 U/ml). All cells were cultured at 37 C in a humidified atmosphere containing 5% CO 2. mirna real-time RT-PCR analysis. Total mirnas of the cultured cells, 40 surgically resected NSCLC tissues and the corresponding adjacent tissues were extracted using the mirneasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The purity and concentration of the RNAs were determined by using a dual-beam ultraviolet spectrophotometer (Eppendorf, Hamburg, Germany). cdna was synthesized with 5 ng of total RNA using the TaqMan mirna Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) following the manufacturer's instructions. All PCR reactions were detected by ABI 7900 Fast system (Applied Biosystems). Primers for mir-154 and U6 were obtained from GeneCopoeia (Carlsbad, CA, USA). The expression levels of U6 were used as the internal control. The relative quantification of mir-154 was presented as the fold change after normalization to U6 RNA for the equation 2 - Ct in the Rotor-Gene 6000 Series software 1.7 (Qiagen). Transient transfection. Oligonucleotide negative control (mircontrol) and mir-154 mimics (hsa-mir-154 mimics) were purchased from GenePharma (Shanghai, China). A549 cells were seeded into 6-well plates and transfected with mir-154 or mir-control using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) at a final concentration of 100 nm. Transfection efficiency was monitored by qrt-pcr. Three independent replicated experiments were performed for each transfection. Cell proliferation assay (Cell Counting Kit-8, CCK-8). Cell proliferation assay was performed using the CCK-8 method (Dojindo, Kunamoto, Japan). Briefly, ~6,000 mir-154 mimic or mir control transfected cells were seeded into 96-well plates and then cultured. The viability of the cells was determined at the indicated times (0, 24, 48 and 72 h) according to the CCK-8 kit manufacturer's instructions. The absorbance of each well was read on a spectrophotometer (Thermo Fisher Scientific, Rockford, IL, USA) at 450 nm (A450). Three independent experiments were performed in quintuplicate. Colony formation assay. Briefly, 24 h after transfection with the mir-154 mimic or mir-control, 1,000 cells were plated into each well of 6-well plates and incubated for 2 weeks at 37 C with 5% CO 2. Then, the cells were washed twice with PBS (0.01 M), with 4% paraformaldehyde for 10 min and counted after staining with 1% crystal violet for 30 min at room temperature. Colony numbers in each assay were quantified by using imaging software (Alpha Innotech, San Leandro, CA, USA) and the percentage of colony formation was calculated by adjusting control cells to 100%. The experiments were carried out at least 3 times. Cell cycle assay. Briefly, 48 h after transfection with mir-154 mimic or mir-control, A549 cells were harvested and washed twice with PBS, and were fixed in ice-cold 70% ethanol for 48 h, washed by ice-cold PBS, and resuspended in 1 ml of PBS containing 1 mg/ml RNase and 50 µg/ml propidium iodide (PI; Sigma, St. Louis, MO, USA) at room temperature for 30 min. Cells were acquired using a BD LSR II flow cytometer and analyzed using Weasel 3.1 software (both from Becton Dickinson, San Jose, CA, USA). Apoptosis assay. Twenty-four hours after transfection, apoptosis in the cultured cells was evaluated by Annexin V staining and PI exclusion using the Annexin V-FITC Apoptosis Detection kit I (BD Pharmingen, San Diego, CA, USA) according to the manufacturer's instructions. Cells were acquired by a BD LSR II flow cytometer and were analyzed using BD FACSDiva 4.0 software (both from Becton-Dickinson). In addition, the activities of caspase-3 and -8 were determined as an additional indicator of apoptosis using the caspases colorimetric protease assay kits (Millipore Corporation, Billerica, MA, USA) 48 h post-transfection. The relative caspase activity of the control blank group was referred to as 100%. Wound-healing assay. To assess the effect of mir-154 on the cell migration of A549 cells, a wound-healing assay was performed. In brief, transfected A549 cells were seeded in a 6-cm dish with 1.5x10 6 wells/dish and cultured for 24 h. The linear wound of the cellular monolayer was created by scratching the confluent cell monolayer using a plastic pipette tip. The monolayer of scratched cells was washed with PBS to remove debris. The images were respectively captured at 0-24 h after wound creation. All experiments were performed in triplicate. Invasion assays. The invasion capacity of the A549 cells was performed in vitro using Transwell chambers (Corning,

3 ONCOLOGY REPORTS 33: , Figure 1. mir-154 is decreased in NSCLC tissues and cell lines, and is associated with patient survival. (A) Expression levels of mir-154 in 40 pairs of NSCLC tissues and adjacent non-cancerous tissues were detected by qrt-pcr, * P<0.05 vs. adjacent non-cancerous tissues. (B) The expression levels of mir-154 in the human NSCLC cell lines A549, H1299, SPCA1 and H358, and normal lung cells (BEAS-2B) were detected by qrt-pcr. * P<0.05 vs. BEAS-2B cells. (C) Kaplan-Meier analyses of overall survival in 40 NSCLC patients according to the expression level of mir-154. NSCLC, non-small cell lung cancer. Tewksbury, MA, USA). In briefly, the cells were harvested 48 h post-transfection, and 5x10 4 cells with 200 µl of serumfree RPMI-1640 medium were seeded into the upper chamber of an insert coated with Matrigel (BD Bioscience, San Jose, CA, USA) following the manufacturer's instructions. RPMI medium containing 10% FBS was added to the lower chamber. The cells were incubated for 48 h at 37 C with 5% CO 2. Then, the remaining cells on the upper membrane were removed using cotton swabs, whereas those that had invaded through the membrane were fixed in 90% alcohol and stained with 0.1% crystal violet. The number of invasive cells was counted in five randomly selected fields under a light microscope at a magnification, x200 (Olympus, Tokyo, Japan). Western blot analysis. Proteins were extracted from the cultured cells 48 h after transfection, and were quantitated using the BCA protein assay kit (Pierce Biotechnology, Rockford, IL, USA). Proteins were separated on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to nitrocellulose membranes (Invitrogen), blocked in 4% dry milk at room temperature for 1 h, and immunostained with primary antibodies at 4 C overnight using mouse anti human E-cadherin (1:1,000), N-cadherin (1:3,000), vimentin (1:1,500) and GAPDH (1:5,000) (all from Cell Signaling Technology, Danvers, MA, USA), and then incubated with horseradish peroxidase-conjugated goat anti-mouse secondary antibody at room temperature for 2 h. The blots were detected using a chemiluminescent detection system (Pierce ECL western blotting substrate; Thermo Fisher Scientific) and exposed using the Molecular Imager ChemiDoc XRS system (Bio-Rad, Hercules, CA, USA). Protein levels were determined by normalization to GAPDH. Lung cancer xenografts. Thirty female BALB/c mice 5-6 weeks old were provided by the Experimental Animal Center of Changchun Biological Institute (Changchun, China), and were maintained under specific pathogen-free (SPF) conditions. The protocol was approved by the Ethics Committees of Jilin University (Changchun, China). A total of 2x10 6 stably overexpressing mir-154 or mir control A549 or untreated A549 cells suspended in 100 µl of PBS were injected into the flanks of mice (n=10), respectively. Tumor volumes were calculated using the following formula: Volume (mm 3 ) = width 2 x length. Tumors were monitored weekly and extracted and weighed 35 days after inoculation. In addition, part of the tumors tissue was used to measure the mir-154 level by qrt-pcr as described above. Statistical analysis. Statistical analyses were carried out using GraphPad Prism, version 5 (GraphPad Software, Inc., San Diego, CA, USA) and SPSS software version 16.0 (SPSS Inc., Chicago, IL, USA). Data are expressed as mean ± SD (standard deviation). The differences between the groups were analyzed by Student's t-test when two groups were compared or by one-way ANOVA when more than two groups were compared. Patient survival curves were estimated by the Kaplan-Meier method. The significance level was set at P<0.05. Results Decreased expression of mir-154 in the NSCLC tissues. To investigate the role of mir-154 in human NSCLC, we first detected the expression of mir-154 in NSCLC patient samples and corresponding adjacent tissues by qrt-pcr. The results showed that mir-154 was significantly decreased in the NSCLC samples compared to that in the normal non cancerous lung tissue (n=40) (Fig. 1A). Patients were divided into 2 groups based on their mir-154 expression levels: those with less than or equal to the median of the mir-154 expression levels and those with more than the median of the mir-154 expression levels (median: ). Then the relationship between mir-154 expression levels and clinicopathological characteristics was analyzed. As shown in Table I, age and gender were not associated with the expression of mir-154, while larger tumor size (P<0.001), advanced TNM stage (P<0.001) and metastasis (P<0.001) were significantly associated with low mir-154 expression. These results indicated that mir-154 may be involved in the metastasis of patients with NSCLC.

4 3056 lin et al: mir-154 suppresses NSCLC growth Table I. Correlation between mir-154 status and clinical characteristics in the patients with NSCLC. mir-154 expression Low High Feature Patients ( median) (> median) P value Age (years) < Gender Male Female TNM stage <0.001 I-II III-IV Tumor size <0.001 T1/T T3/T Metastasis <0.001 Yes No NSCLC, non-small cell lung cancer. In addition, the expression levels of mir-154 in human NSCLC cell lines A549, H1299, SPCA1 and H358, and normal lung cells (BEAS-2B) were detected by qrt-pcr. It was found that the mir-154 expression in four NSCLC cell lines was clearly downregulated compared to that in the normal lung cells (Fig. 1B). The A549 cell line, which possessed the lowest level of mir-154 expression among the four cell lines, was selected for further study. We further investigated whether mir-154 expression has prognostic potential for overall survival (OS) of NSCLC patients. The Kaplan-Meier method showed that the survival rate of patients with high mirna-154 expression was higher than that of patients with low mirna 154 expression (P<0.001, Fig. 1C). mir-154 inhibits cell proliferation and colony formation in the A549 cells. To investigate whether mir-154 mediates growth suppressive effects, we transfected the mir-154 mimic into the A549 cells. Then real-time qrt-pcr was performed to determine whether the mir-154 mimic increased the mir-154 levels in the A549 transfectants. After 48 h of transfection, the mir-154 expression level was significantly increased in the cells transfected with the mir-154 mimic compared with that in cells transfected with the mir-control and the mock cells (P<0.05, Fig. 2A). CCK-8 assay showed that the cells transfected with the mir-154 mimic had a significantly lower proliferative index than cells transfected with the mir-control and the mock cells (P<0.05, Fig. 2B). Accordingly, colony formation analysis showed that the colony-forming efficiency of cells transfected with the mir-154 mimic was significantly lower than that of cells transfected with the mir-control and the mock cells (P<0.05, Fig. 2C). mir-154 induces G1 cell cycle arrest and cell apoptosis in the A549 cells. To determine the effects of mir-154 on the cell cycle in the A549 cells, FACScan flow cytometric assays were performed. After transfection with the mir-154 mimic for 48 h, the percentage of cells in the G0/G1 stage was higher than that of the mir-control group and mock group (P<0.05, Fig. 3A). Next, we also assessed the role of mir-154 in A549 cell apopto sis. Cells transfected with the mir-154 mimic exhibited significantly induced cell apoptosis compared to the cells transfected with the mir-control and mock cells (P<0.05, Fig. 3B). In addition, we also analyzed the effects of mir-154 on caspase-3 and caspase-8 activity in the A549 cells. The activities of caspase-3 and caspase-8 were significantly increased in the cells transfected with the mir-154 mimic when compared with cells transfected with the mir-control and mock cells (P<0.05, Fig. 3C and D). These finding suggested that overexpression of mir-154 induced cell arrest at the G0/G1stage and apoptosis of A549 cells. Figure 2. Overexpression of mir-154 inhibits cell proliferation and colony formation of A549 cells. (A) The expression level of mir-154 in the A549 cells was detected by qrt-pcr 48 h after transfection with the mir-154 mimic or mir-control. (B) Cell proliferation was measured by CCK-8 assays in the A549 cells transfected with the mir-154 mimic or mir-control. (C) Clonogenic assay was performed in the A549 cells after transfection with the mir-154 mimic or mir-control. * P<0.05 vs. Mock.

5 ONCOLOGY REPORTS 33: , Figure 3. Overexpression of the mir-154 induces cell cycle G1/G0 phase and apoptosis of A549 cells. (A) Analysis of the cell cycle distribution in the A549 cells was performed after transfection with either the mir-154 mimic or mir-control. (B) Cell apoptosis was determined in the A549 cells after transfection with the mir-154 mimic or mir-control. The activities of (C) caspase-3 and (D) caspase-8 were determined after transfection with either the mir-154 mimic or mir-control. * P<0.05 vs. Mock. Figure 4. Overexpression of mir-154 inhibits cell migration and invasion of A549 cells. (A) Cell migration in the A549 cells was determined by wound healing assay after transfection with either the mir-154 mimic or mir-control. Phase micrographs of cells were captured at 0 and 24 h after monolayer wounding. (B) Relative migration of the A549 cells was quantified. (C) Cell invasion in the A549 cells was determined by Transwell assay after transfection with either the mir 154 mimic or mir-control. (D) Relative invasion of the A549 cells was quantified. * P<0.05 vs. Mock.

6 3058 lin et al: mir-154 suppresses NSCLC growth Figure 5. Upregulation of mir-154 results in increased E-cadherin expression, and decreased N-cadherin and vimentin expression in the A549 cells transfected with the mir 154 mimic as analyzed by western blot analysis. GAPDH was used as a control. E-cadherin, N-cadherin and vimentin protein expression levels were quantitatively analyzed by the average IOD values. * P<0.05 vs. Mock. Figure 6. Overexpression of mir-154 suppresses tumor growth in vivo. (A) The image represents tumor growth at 5 weeks after inoculation. (B) Tumor volume and (C) weight were assessed. (D) qrt-pcr analyses of the mir 154 level in the tumor tissues. mir-154 inhibits cell migration and invasion in the A549 cells. We further studied the effects of mir-154 on cell migration and invasion using a wound healing/transwell assay in the A549 cells with or without mir-154 mimic transfection. Results of the wound healing assay showed that the A549 cells transfected with the mir-154 mimic showed less migratory ability than that in the mir-control and mock groups at 24 h after wound creation (P<0.05, Fig. 4A and B). We then investigated the effect of ectopic expression of mir-154 on the cell invasion in the A549 cells. Transwell matrix penetration (coated with Matrigel) assay showed that overexpression of mir-154 significantly inhibited cell invasion relative to the mir-control and mock groups (P<0.05, Fig. 4C and D). These findings demonstrated that mir-154 inhibits the migration and invasive ability of NSCLC cells in vitro.

7 ONCOLOGY REPORTS 33: , Overexpression of mir-154 inhibits epithelial-to-mesenchymal transition (EMT). It has been shown that EMT plays a key role in the invasion of various types of cancer cells by the transformation of polarized and adherent epithelial cells into motile and invasive mesenchymal cells. To determine whether mir-154 effects molecular changes typical of EMT in the cell lines, the expression levels of mesenchymal markers, including N-cadherin and vimentin and the epithelial marker, E-cadherin, were examined in the A549 cells by western blot analysis 48 h after transfection with the mir-154 mimic. Upregulation of mir-154 resulted in increased E-cadherin expression, and decreased N-cadherin and vimentin expression (Fig. 5). This finding indicated that mir-154 contributes to the regulation of EMT marker expression in NSCLC cells in vitro. Overexpression of mir-154 inhibits tumor growth in vivo. As the upregulation mir-154 had a functional role in regulating the NSCLC cells in vitro, we further investigated whether increasing the mir-154 expression has a similar antitumor effect on NSCLC tumor growth in vivo. Mice were transplanted with mir-154 overexpression or mir-control A549 cells, respectively. The tumors were extracted 5 weeks after implantation. The tumors were significantly smaller when mir-154 was downregulated (Fig. 6A). Quantification of the tumor size and weight confirmed that overexpression of mir-154 significantly reduced xenograft tumor volume (Fig. 6B) and tumor weight (Fig. 6C). To determine the mir-154 transfection activity in the nude mouse model, we also determined mir-154 expression in the xenograft tumors by qrt-pcr. The results revealed that mir-154 expression was upregulated in the xenograft tumors of the mir-154 group compared to the xenograft tumors of the mir-control group and untreated group (P<0.05, Fig. 6D). These results imply that upregulation of mir-154 inhibits tumor growth of NSCLC in vivo. Discussion Lung cancer is a malignant tumor that seriously threatens human health and affects the lives of millions (20). As estimated by the National Central Cancer Registry of China, in 2010, the lung cancer incidence and mortality were increased to 46.08/100,000 and 37.00/100,000, respectively (21). NSCLC is responsible for almost 80% of lung cancer-related deaths (1,2). To date, the highly complex molecular mechanisms underlying NSCLC carcinogenesis and progression remain relatively unclear. Therefore, it is of great significance to investigate the molecular and cellular mechanisms of lung cancer, which contribute to the identification of novel genetic or protein markers for accurate diagnosis and prediction of prognosis. In the present study, we firstly observed that mir-154 was downregulated in NSCLC compared with the adjacent non-cancerous tissues. Then, we also found that mir-154 expression was significantly correlated with aggressive clinicopathological features, such as metastasis (P<0.001), larger tumor size (P<0.001) and advanced TNM stage (P<0.001). Moreover, Kaplan-Meier analysis revealed that NSCLC patients with low mir-154 expression tended to have reduced OS. Finally, we found that upregulation of mir-154 expression in the A549 cells was able to reduce cell proliferation, invasion, and migration, and induce cell apoptosis and cell cycle arrest at the G0/G1 stage, as well as suppress tumor growth in vivo. To our knowledge, this is the first report regarding the clinical significance and functional attributes of mir-154 in NSCLC. It has been shown that mir-154 acts as a tumor-suppressor in several types of cancer. Zhu et al demonstrated that forced expression of mir-154 suppressed prostate cancer cell proliferation, colony formation, invasion and migration, and promoted cell apoptosis (17,18). Subsequently, Gururajan et al demonstrated that elevated expression of mir-154 was observed in bone metastatic prostate cancer cell lines and tissues, and intracardiac inoculation (to mimic systemic dissemination) of mir-154 inhibitor-treated bone metastatic ARCaPM prostate cancer cells in mice led to decreased bone metastasis and increased survival (22). Xin et al showed that mir-154 was decreased in colorectal cancer (CRC) tissues and cell lines, and ectopic expression of mir-154 markedly suppressed cell proliferation and colony formation, migration and invasion in CRC cells (15). Consistent with these results, our study showed that overexpression of mir-154 markedly suppressed tumor growth of NSCLC in vitro and in vivo, suggesting that mir-154 exhibits a tumor-suppressor function in NSCLC. It has been demonstrated that EMT plays an important role in the differentiation of multiple tissues and organs and in embryonic development as well as in the metastasis of cancer cells (23). EMT is characterized by a loss of cell-cell contact through the inhibition of epithelial markers, such as E-cadherin expression, and the acquisition of mesenchymal features via upregulation of mesenchymal markers, such as N-cadherin and vimentin (24,25). In NSCLC, it has been shown that restoration of E-cadherin expression markedly decreased the invasion/migration of tumors (26), while inhibition of N-cadherin reduced the proliferation and invasion of NSCLC (27). Importantly, recent studies showed that ectopic expression of mir-154 decreased the migratory and invasive capabilities of prostate cancer cells in vitro by regulation of ETM (17,22). In the present study, our results showed that upregulation of mir-154 resulted in increased E-cadherin expression and decreased N-cadherin and vimentin expression, suggesting that mir-154 can regulate ETM in NSCLC cells. Recent research has identified several oncogenes as direct targets of mir-154, such as CCND2 (18), HMGA2 (17), TLR2 (15) and STAG2 (22). It is known that mirnas execute their oncogenic or tumor-suppressive functions by regulating the expression of target genes. It has been reported that an average mirna can have more than 100 targets (28). Therefore, we propose that mir-154 is involved in NSCLC progression via the regulation of multiple target genes. In conclusion, our findings revealed that mir-154 expression was decreased in the NSCLC tissues and cell lines, and its expression level was correlated with TNM stage, tumor size, metastasis, and reduced overall survival. In addition, we also found that overexpression of mir-154 suppressed tumor growth of NSCLC in vitro and in vivo. Based on the multiple functions of mir-154 in the tumor growth of NSCLC, mir-154 may be considered as a diagnostic marker of NSCLC or a potential anticancer therapeutic target for NSCLC.

8 3060 lin et al: mir-154 suppresses NSCLC growth References 1. Siegel R, Naishadham D and Jemal A: Cancer statistics, CA Cancer J Clin 62: 10-29, Ramalingam SS, Owonikoko TK and Khuri FR: Lung cancer: new biological insights and recent therapeutic advances. CA Cancer J Clin 61: , Sánchez de Cos J, Sojo González MA, Montero MV, Pérez Calvo MC, Vicente MJ and Valle MH: Non-small cell lung cancer and silent brain metastasis. Survival and prognostic factors. Lung Cancer 63: , Osman A: MicroRNAs in health and disease-basic science and clinical applications. Clin Lab 58: , Mendell JT and Olson EN: micrornas in stress signaling and human disease. Cell 148: , Wen J, Li R, Wen X, Chou G, Lu J, Wang X and Jin Y: Dysregulation of cell cycle related genes and micrornas distinguish the low- from high-risk of prostate cancer. Diagn Pathol 9: 156, Chen PS, Su JL and Hung MC: Dysregulation of micrornas in cancer. J Biomed Sci 19: 90, Melo SA and Esteller M: Dysregulation of micrornas in cancer: playing with fire. FEBS Lett 585: , Bartel DP: micrornas: genomics, biogenesis, mechanism, and function. Cell 116: , Boeri M, Pastorino U and Sozzi G: Role of micrornas in lung cancer: microrna signatures in cancer prognosis. Cancer J 18: , Guz M, Rivero-Müller A, Okoń E, Stenzel-Bembenek A, Polberg K, Słomka M and Stepulak A: micrornas - role in lung cancer. Dis Markers 2014: , Lin SP, Youngson N, Takada S, Seitz H, Reik W, Paulsen M, Cavaille J and Ferguson-Smith AC: Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlk1-Gtl2 imprinted cluster on mouse chromosome 12. Nat Genet 35: , Wang W, Peng B, Wang D, Ma X, Jiang D, Zhao J and Yu L: Human tumor microrna signatures derived from large-scale oligonucleotide microarray datasets. Int J Cancer 129: , Miranda PJ, Vimalraj S and Selvamurugan N: A feedback expression of microrna-590 and activating transcription factor-3 in human breast cancer cells. Int J Biol Macromol 72: , Xin C, Zhang H and Liu Z: mir-154 suppresses colorectal cancer cell growth and motility by targeting TLR2. Mol Cell Biochem 387: , Mian C, Pennelli G, Fassan M, Balistreri M, Barollo S, Cavedon E, Galuppini F, Pizzi M, Vianello F, Pelizzo MR, et al: microrna profiles in familial and sporadic medullary thyroid carcinoma: preliminary relationships with RET status and outcome. Thyroid 22: , Zhu C, Li J, Cheng G, Zhou H, Tao L, Cai H, Li P, Cao Q, Ju X, Meng X, et al: mir-154 inhibits EMT by targeting HMGA2 in prostate cancer cells. Mol Cell Biochem 379: 69-75, Zhu C, Shao P, Bao M, Li P, Zhou H, Cai H, Cao Q, Tao L, Meng X, Ju X, et al: mir-154 inhibits prostate cancer cell proliferation by targeting CCND2. Urol Oncol 32: 31.e39-31.e16, Huang J, Wu J, Li Y, Li X, Yang T, Yang Q and Jiang Y: Deregulation of serum microrna expression is associated with cigarette smoking and lung cancer. Biomed Res Int 2014: , Soerjomataram I, Lortet-Tieulent J, Parkin DM, Ferlay J, Mathers C, Forman D and Bray F: Global burden of cancer in 2008: a systematic analysis of disability-adjusted life-years in 12 world regions. Lancet 380: , Chen WQ, Zheng RS, Zhang SW, Zeng HM and Zou XN: The incidences and mortalities of major cancers in China, Chin J Cancer 33: , Gururajan M, Josson S, Chu GC, Lu CL, Lu YT, Haga CL, Zhau HE, Liu C, Lichterman J, Duan P, et al: mir-154* and mir-379 in the DLK1-DIO3 microrna mega-cluster regulate epithelial to mesenchymal transition and bone metastasis of prostate cancer. Clin Cancer Res 20: , Yuan X, Wu H, Han N, Xu H, Chu Q, Yu S, Chen Y and Wu K: Notch signaling and EMT in non-small cell lung cancer: biological significance and therapeutic application. J Hematol Oncol 7: 87, Jiang JH, Liu C, Cheng H, Lu Y, Qin Y, Xu YF, Xu J, Long J, Liu L, Ni QX, et al: Epithelial-mesenchymal transition in pancreatic cancer: is it a clinically significant factor? Biochim Biophys Acta 1855: 43-49, Zheng H and Kang Y: Multilayer control of the EMT master regulators. Oncogene 33: , Mateen S, Raina K, Agarwal C, Chan D and Agarwal R: Silibinin synergizes with histone deacetylase and DNA methyltransferase inhibitors in upregulating E-cadherin expression together with inhibition of migration and invasion of human non-small cell lung cancer cells. J Pharmacol Exp Ther 345: , Zhang X, Liu G, Kang Y, Dong Z, Qian Q and Ma X: N-cadherin expression is associated with acquisition of EMT phenotype and with enhanced invasion in erlotinib-resistant lung cancer cell lines. PLoS One 8: e57692, Brennecke J, Stark A, Russell RB and Cohen SM: Principles of microrna-target recognition. PLoS Biol 3: e85, 2005.

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG

More information

ONCOLOGY LETTERS 15: , 2018

ONCOLOGY LETTERS 15: , 2018 10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4 European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing

More information

LncRNA LET function as a tumor suppressor in breast cancer development

LncRNA LET function as a tumor suppressor in breast cancer development European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.

More information

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer

Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

More information

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:

More information

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis

Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.

More information

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE

More information

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.

More information

Safranal inhibits the migration and invasion of human oral squamous cell carcinoma cells by overcoming epithelial-mesenchymal transition.

Safranal inhibits the migration and invasion of human oral squamous cell carcinoma cells by overcoming epithelial-mesenchymal transition. Biomedical Research 2017; 28 (2): 817-821 ISSN 0970-938X www.biomedres.info Safranal inhibits the migration and invasion of human oral squamous cell carcinoma cells by overcoming epithelial-mesenchymal

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for

More information

LncRNA AB promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5

LncRNA AB promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5 European Review for Medical and Pharmacological Sciences 2019; 23: 2374-2379 LncRNA AB073614 promotes the proliferation and inhibits apoptosis of cervical cancer cells by repressing RBM5 L.-Y. GUO 1, C.-F.

More information

mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2

mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2 ONCOLOGY LETTERS mir-26a inhibits invasion and metastasis of nasopharyngeal cancer by targeting EZH2 LI YU 1, JUAN LU 1, BAO ZHANG 2, XIONG LIU 1, LU WANG 1, SI-YANG LI 1, XIAO-HONG PENG 1, XIA XU 1, WEN-DONG

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer

Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun

More information

Long non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer

Long non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer European Review for Medical and Pharmacological Sciences 2017; 21: 3808-3812 Long non-coding RNA Loc344887 is a potential prognostic biomarker in non-small cell lung cancer B. WU 1, X.-J. ZHANG 2, X.-G.

More information

Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63

Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 68 Chin J Cancer Res 22(1):68-72, 2010 www.springerlink.com Original Article Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 Jing-Wei Wang 1, Yi Liu 2, Hai-mei Tian 2, Wei

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

Association between downexpression of mir-1301 and poor prognosis in patients with glioma

Association between downexpression of mir-1301 and poor prognosis in patients with glioma European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.

More information

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,

More information

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

MicroRNA-146b acts as a potential tumor suppressor in human prostate cancer

MicroRNA-146b acts as a potential tumor suppressor in human prostate cancer JBUON 2016; 21(2): 434-443 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE MicroRNA-146b acts as a potential tumor suppressor in human prostate

More information

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4 Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis

More information

Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer

Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer Clinical significance of serum mir-196a in cervical intraepithelial neoplasia and cervical cancer P. Liu 1, F. Xin 1 and C.F. Ma 2 1 Department of Obstetrics & Gynecology, Baoding Second Central Hospital,

More information

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

Increasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis

Increasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis European Review for Medical and Pharmacological Sciences 2017; 21: 3592-3597 Increasing expression of mir-5100 in non-small-cell lung cancer and correlation with prognosis T. WANG 1, X. LIU 1, Q. TIAN

More information

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao

More information

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Clinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer

Clinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer European Review for Medical and Pharmacological Sciences 2017; 21: 5696-5701 Clinical impact of serum mir-661 in diagnosis and prognosis of non-small cell lung cancer G.-H. ZHOU 1, W.-H. YANG 2, B. SUN

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Clinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study

Clinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study European Review for Medical and Pharmacological Sciences 2018; 22: 7704-7709 Clinicopathologic and prognostic relevance of mir-1256 in colorectal cancer: a preliminary clinical study Z.-Y. LIU, L. YANG,

More information

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906

More information

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion

More information

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.

More information

mir-125a-5p expression is associated with the age of breast cancer patients

mir-125a-5p expression is associated with the age of breast cancer patients mir-125a-5p expression is associated with the age of breast cancer patients H. He 1 *, F. Xu 2 *, W. Huang 1, S.Y. Luo 1, Y.T. Lin 1, G.H. Zhang 1, Q. Du 1 and R.H. Duan 1 1 The State Key Laboratory of

More information

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,

More information

Tea polyphenol decreased growth and invasion in human ovarian cancer cells

Tea polyphenol decreased growth and invasion in human ovarian cancer cells 674480EJI0010.1177/1721727X16674480European Journal of InflammationHuang et al. research-article2016 Letter to the editor Tea polyphenol decreased growth and invasion in human ovarian cancer cells European

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma

Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma Int J Clin Exp Pathol 2017;10(10):10276-10281 www.ijcep.com /ISSN:1936-2625/IJCEP0059849 Original Article Reduced serum mir-138 is associated with poor prognosis of head and neck squamous cell carcinoma

More information

Supplementary Data. Supplementary Methods:

Supplementary Data. Supplementary Methods: Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant

More information

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9

mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 ONCOLOGY REPORTS 38: 1977-1984, 2017 mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 Hua Liang, Ruoyu Luo, Xiaoqi Chen, Yuzi Zhao and Aili Tan Department of Obstetrics and Gynecology,

More information

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma

LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,

More information

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients

Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Title Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Author(s) Pun, JC; Chan, JY; Chun, BK; Ng, KW; Tsui, SY; Wan, TMH; Lo, OSH; Poon, TCJ; Ng,

More information

Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression

Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression European Review for Medical and Pharmacological Sciences 2017; 21: 4087-4091 Long non-coding RNA ROR is a novel prognosis factor associated with non-small-cell lung cancer progression C.-H. QU 1, Q.-Y.

More information

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific

Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating

More information

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma

Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital

More information

95% CI: , P=0.037).

95% CI: , P=0.037). Biomedical Research 2017; 28 (21): 9248-9252 Reduced expression level of mir-205 predicts poor prognosis in Qiang Yang 1*#, Peng Sun 2#, Haotian Feng 1, Xin Li 1, Jianmin Li 1 1 Department of Orthopedics,

More information

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,

More information

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2016;9(2):2049-2053 www.ijcep.com /ISSN:1936-2625/IJCEP0014841 Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

Paclitaxel inhibits the progression of cervical cancer by inhibiting autophagy via lncrnarp11-381n20.2

Paclitaxel inhibits the progression of cervical cancer by inhibiting autophagy via lncrnarp11-381n20.2 European Review for Medical and Pharmacological Sciences 2018; 22: 3010-3017 Paclitaxel inhibits the progression of cervical cancer by inhibiting autophagy via lncrnarp11-381n20.2 S.-H. ZOU, X. DU, H.

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis

Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis Reduced mirna-218 expression in pancreatic cancer patients as a predictor of poor prognosis B.-S. Li, H. Liu and W.-L. Yang Department of Gastrointestinal and Pancreatic Surgery, The Third Xiangya Hospital

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression.

Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression. J Med Oncl Ther 2016; 1 (1): 1-7 Journal of Medical Oncology and Therapeutics Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression. Min Lv 1,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,

More information

Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer

Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer European Review for Medical and Pharmacological Sciences 2016; 20: 5143-5147 Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer

More information

mir-542-3p suppresses colorectal cancer progression through targeting survivin

mir-542-3p suppresses colorectal cancer progression through targeting survivin Original Article mir-542-3p suppresses colorectal cancer progression through targeting survivin Chunxiang Ye 1 *, Guanjun Yue 2 *, Zhanlong Shen 1, Bo Wang 1, Yang Yang 1, Tao Li 1, Shuqiang Mao 1, Kewei

More information

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer

Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer European Review for Medical and Pharmacological Sciences 2016; 20: 3373-3377 Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer Z.-J. CHEN, Z. ZHANG, B.-B. XIE, H.-Y. ZHANG

More information

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3

More information

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143 European Review for Medical and Pharmacological Sciences 2018; 22: 8343-8352 Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information