Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:"

Transcription

1 Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng, Olga Radkevich-Brown, Xuanming Yang, Husain Sattar, Yang Wang, Nicholas K. Brown, Mark Greene, Yang Liu, Jie Tang, Shengdian Wang, and Yang-Xin Fu CONTENTS: Supplemental Figures Figure S1. Lymphocytes are increased after antibody. Figure S2. Efficacy of anti-her2/neu antibody is associated with T cells Figure S3. The some drugs suppress lymphocyte proliferation. Figure S4. The combination of anti-neu antibody plus Ad-LIGHT immunotherapy eradicates established neu+ solid tumors.

2 A B CD8 Tunnel 2 ** migg α-neu migg % in total cells 1 ** α-neu 0 CD8 NK 50μm Figure S1, related to Fig. 2. Lymphocytes are increased after antibody. A, WT BALB/c mice were inoculated s.q. with 5x10 5 TUBO cells (n=5/group) and treated with anti-neu (150 μg) or control Ig (150 μg) with or without the administration of a CD8-depleting antibody (clone , 200 μg) on days 14 and 21. *p<0.05 compared to anti-neu plus anti-cd8 antibody treated mice. Data from one of two experiments shown. B, Comparison of different anti-cd8 antibodies on DC depletion. Female BALB/c mice were injected with 200 μg of different anti- CD8 antibodies (clone YTS , and ) by i.p. Two days later, spleens were collected and digested with collagenase to get single cell suspension. Then these splenocytes were stained with indicated antibodies and analyzed by FACS Caliber. 2

3 A Gated CD11C + cells % CD8 + DC 9.4% 0.2% 3.6% 2.7% CD8 B Tumor volume(mm 3 ) CD4 Control α-neu + α-cd8 migg + α-cd8 α-neu migg * Days after tumor inoculation YTS Average TIL C P>0.03 Pre-Tx Post-Tx Her2 + Her p=0.25 Pre-Tx Post-Tx Figure S2, related to Fig. 3. Increase of immune responses by anti-neu antibody is associated with T cells. A, WT BALB/c mice were inoculated s.q. with 5x10 5 TUBO cells (n=5/group) and treated with anti-neu (150 μg) or control Ig (150 μg) with or without the administration of a CD8-depleting antibody (clone , 200 μg) on days 14 and 21. *p<0.05 compared to anti-neu plus anti-cd8 antibody treated mice. Data from one of two experiments shown. B, Comparison of different anti-cd8 antibodies on DC depletion. Female BALB/c mice were injected with 200 μg of different anti-cd8 antibodies (clone YTS , and ) by i.p. Two days later, spleens were collected and digested with collagenase to get single cell suspension. Then these splenocytes were stained with indicated antibodies and analyzed by FACS Caliber. C. Increase of tumor infiltrating leukocytes in Herceptin treated breast cancer. Residual HER2 + tumors were removed 3 weeks after a 18-week treatment of

4 Taxotere with or without trastuzumab. We compared pre- and post-treatment breast tissue biopsies from patients with HER2 + (all treated with trastuzumab and Taxotere) and HER2 - (treated with Taxotere alone) breast tumors obtained from University of Chicago hospital s tumor specimen bank. Each sample was analyzed at 40X power, and the number of TIL in 10 fields was evaluated to calculate average for each sample. After antibody treatment, most lymphocytes surrounding tumor cells were CD8 + T cells (15.3 +/- 1.3 per high power field), while few CD4 + T cells infiltrated and surrounded tumor cells (1.3 +/- 1.2). 4

5 Figure S3, related to Figure 5. The some drugs suppress lymphocyte proliferation. WT BALB/c mice were treated with 150 μg of anti-neu with or without 60 mg/kg PTX. Cell populations were evaluated in (A) the spleen three days after treatment. (B) Total numbers of cells were also analysed on day three after treatment. (C) The proliferation of Lymphocytes three days after last treatment of PTX was calculated by staining Ki67 (PE-anti-ki67, BD). One of two representative experiments is shown.

6 Figure S4, related to Fig. 6. The combination of anti-neu antibody plus Ad-LIGHT immunotherapy eradicates established neu + solid tumors. A, TUBO-bearing WT BALB/c mice (n=6/group) were treated with a low dose of anti-neu antibody (50 μg) on days 18 and 25. 1x10 10 viral particle of Ad-LIGHT or control Ad-LacZ were injected intratumorally on day 18. **, p<0.005 compared to other groups. B, Tumor-free mice from the anti-neu antibody + Ad- LIGHT group described in (A) were re-challenged with 5x10 6 TUBO and 4T1 tumor cells s.c. at least 30 days after complete rejection of primary tumors. C and D, TUBO-bearing neu Tg mice (n=5/group) were treated with 100 µg of neu antibody on days 18 and 25 and 1x10 10 vp of Ad- LIGHT or control Ad-Null intra-tumorally on days 18 and 21. Average tumor volume (C) and survival (D) are shown. *, p < 0.05; **, p < All experiments were done three times. 6

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/333/333ra47/dc1 Supplementary Materials for Androgen receptor antagonists compromise T cell response against prostate cancer leading to early tumor

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity

The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity rticle The Therapeutic Effect of nti-her2/neu ntibody Depends on oth Innate and daptive Immunity SaeGwang Park, 1,2,3,6 Zhujun Jiang, 1,6 Eric D. Mortenson, 2,6 Liufu Deng, 1 Olga Radkevich-rown, 2 Xuanming

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Tumors arise from accumulated genetic mutations. Tumor Immunology (Cancer)

Tumors arise from accumulated genetic mutations. Tumor Immunology (Cancer) Tumor Immunology (Cancer) Tumors arise from accumulated genetic mutations Robert Beatty MCB150 Mutations Usually have >6 mutations in both activation/growth factors and tumor suppressor genes. Types of

More information

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy

Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Molecular mechanisms of the T cellinflamed tumor microenvironment: Implications for cancer immunotherapy Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

Irradiation and anti PD-L1 treatment synergistically promote antitumor immunity in mice

Irradiation and anti PD-L1 treatment synergistically promote antitumor immunity in mice Research article Irradiation and anti PD-L1 treatment synergistically promote antitumor immunity in mice Liufu Deng, 1 Hua Liang, 1 Byron Burnette, 1 Michael Beckett, 1 Thomas Darga, 1 Ralph R. Weichselbaum,

More information

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV)

ndln NK Cells (x10 3 ) Days post-infection (A/PR/8) *** *** *** Liver NK Cells (x10 4 ) Days post-infection (MCMV) A mln NK Cells(x ) 6 1 * ndln NK Cells (x ) ns C Lung NK Cells(x ) 1 1 7 * D LN NK Cells (x ) 1 7 1 7 Days post-infection (A/PR/8) * * E Liver NK Cells (x ) 1 7 Days post-infection (A/PR/8) * * * 1 7 Days

More information

Immunology Lecture 4. Clinical Relevance of the Immune System

Immunology Lecture 4. Clinical Relevance of the Immune System Immunology Lecture 4 The Well Patient: How innate and adaptive immune responses maintain health - 13, pg 169-181, 191-195. Immune Deficiency - 15 Autoimmunity - 16 Transplantation - 17, pg 260-270 Tumor

More information

Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation:

Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation: Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation: Combination Treatment with TLR Antagonist and Rituximab D. Wang, W. Jiang, T. Sullivan, L.

More information

From Bench to Bedside Regulatory T Cells: Can We Make the Police Work for Us?

From Bench to Bedside Regulatory T Cells: Can We Make the Police Work for Us? From Bench to Bedside Regulatory T Cells: Can We Make the Police Work for Us? Sang Mo Kang, MD Qizhi Tang, PhD UCSF Division of Transplantation UCSF Transplant Conference 2012 The Reality of Immunosuppression

More information

Enhanced Cancer Vaccine Effectiveness with NKTR-214, a CD122-Biased Cytokine

Enhanced Cancer Vaccine Effectiveness with NKTR-214, a CD122-Biased Cytokine Enhanced Cancer Vaccine Effectiveness with NKTR-214, a CD122-Biased Cytokine Jonathan Zalevsky SVP, Biology and Preclinical Development Nektar Therapeutics SMI Cancer Vaccines, September 2017 Nektar Therapeutics

More information

Novel RCC Targets from Immuno-Oncology and Antibody-Drug Conjugates

Novel RCC Targets from Immuno-Oncology and Antibody-Drug Conjugates Novel RCC Targets from Immuno-Oncology and Antibody-Drug Conjugates Christopher Turner, MD Vice President, Clinical Science 04 November 2016 Uveal Melanoma Celldex Pipeline CANDIDATE INDICATION Preclinical

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

CD47 blockade triggers T cell mediated destruction of immunogenic tumors

CD47 blockade triggers T cell mediated destruction of immunogenic tumors a r t i c l e s CD47 blockade triggers T cell mediated destruction of immunogenic tumors Xiaojuan Liu 1,2,6, Yang Pu 3, Kyle Cron 3, Liufu Deng 3, Justin Kline 4, William A Frazier 5, Hairong Xu 1, Hua

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

NKTR-214 plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology

NKTR-214 plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology plus NKTR-262, a Scientifically-Guided Rational Combination Approach for Immune Oncology Jonathan Zalevsky SVP, Biology and Preclinical Development Nektar Therapeutics World Preclinical Congress, 2017

More information

Bihong Zhao, M.D, Ph.D Department of Pathology

Bihong Zhao, M.D, Ph.D Department of Pathology Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

STATE OF THE ART 4: Combination Immune Therapy-Chemotherapy. Elizabeth M. Jaffee (JHU) James Yang (NCI) Jared Gollob (Duke) John Kirkwood (UPMI)

STATE OF THE ART 4: Combination Immune Therapy-Chemotherapy. Elizabeth M. Jaffee (JHU) James Yang (NCI) Jared Gollob (Duke) John Kirkwood (UPMI) STATE OF THE ART 4: Combination Immune Therapy-Chemotherapy Elizabeth M. Jaffee (JHU) James Yang (NCI) Jared Gollob (Duke) John Kirkwood (UPMI) Topics for Consideration What are the rules for integrating

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplementary Information

Supplementary Information Supplementary Information Memory-type ST2 + CD + T cells participate in the steroid-resistant pathology of eosinophilic pneumonia Naoko Mato 1, 2, Kiyoshi Hirahara 2, Tomomi Ichikawa 2, Jin Kumagai 2,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION

CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION CELLULAR AND MOLECULAR REQUIREMENTS FOR REJECTION OF B16 MELANOMA IN THE SETTING OF REGULATORY T CELL DEPLETION AND HOMEOSTATIC PROLIFERATION Justin Kline 1, Long Zhang 1, and Thomas F. Gajewski 1,2 Departments

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

2/16/2018. The Immune System and Cancer. Fatal Melanoma Transferred in a Donated Kidney 16 years after Melanoma Surgery

2/16/2018. The Immune System and Cancer. Fatal Melanoma Transferred in a Donated Kidney 16 years after Melanoma Surgery C007: Immunology of Melanoma: Mechanisms of Immune Therapies Delphine J. Lee, MD, PhD Chief and Program Director, Dermatology, Harbor UCLA Medical Center Principal Investigator, Los Angeles Biomedical

More information

Posters and Presentations

Posters and Presentations Posters and Presentations June 2017: American Society of Clinical Oncology (ASCO) Annual - Preliminary Correlative Analysis of PD-L1 expression from the SUNRISE Study. View April 2017: American Association

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

ULTIMATE GBG 95 UC-0140/1606 BIG UnLock The IMmune cells ATtraction in ER+ breast cancer

ULTIMATE GBG 95 UC-0140/1606 BIG UnLock The IMmune cells ATtraction in ER+ breast cancer ULTIMATE GBG 95 UC-0140/1606 BIG 16-01 UnLock The IMmune cells ATtraction in ER+ breast cancer A PHASE II TRIAL TESTING DURVALUMAB COMBINED WITH ENDOCRINE THERAPY IN PATIENTS WITH ER+/HER2- BREAST CANCER

More information

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques

JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques JAK3 inhibitor administration in vivo in chronically SIV Infected Rhesus Macaques preferentially depletes NK Cells Ladawan Kowawisatsut 1 Kovit Pattanapanyasat 1 Aftab A. Ansari 2 1 Department of Immunology

More information

The tumor immunosuppressive microenvironment impairs the therapy of anti-her2/neu antibody

The tumor immunosuppressive microenvironment impairs the therapy of anti-her2/neu antibody Protein Cell 2012, 3(6): 441 449 DOI 10.1007/s13238-012-2044-3 COMMUNICATION The tumor immunosuppressive microenvironment impairs the therapy of anti-her2/neu antibody Meng Xu 1,2, Xuexiang Du 1,2, Mingyue

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

Immunotherapy in Lung Cancer - TLR9 as a therapeutic target -

Immunotherapy in Lung Cancer - TLR9 as a therapeutic target - Immunotherapy in Lung Cancer - TLR9 as a therapeutic target - Wilfried Eberhardt,, MD Head of Outpatient Unit, Dept. of Internal Medicine (Cancer Research) West German Cancer Centre Essen University Hospital

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

The toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanism

The toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanism The toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanism Hua Yang, Emory University Craig M. Brackett, Roswell Park

More information

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Preclinical Assessment of JTX-2011, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial

Preclinical Assessment of JTX-2011, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial Preclinical Assessment of JTX-211, An Agonist Antibody Targeting ICOS, Supports Evaluation In ICONIC Clinical Trial Jennifer Michaelson, Ph.D. AACR Annual Meeting April 2, 217 Major Symposium Emerging

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Role of microenvironment and tumor interactions in melanoma progression with special regard to the prognostic significance of immune cell infiltrate

Role of microenvironment and tumor interactions in melanoma progression with special regard to the prognostic significance of immune cell infiltrate Role of microenvironment and tumor interactions in melanoma progression with special regard to the prognostic significance of immune cell infiltrate PhD thesis Dr. Anita Mohos Doctoral School of Pathological

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Cancer Vaccines and Combination Immunotherapy

Cancer Vaccines and Combination Immunotherapy Cancer Vaccines and Combination Immunotherapy Bernard A. Fox, PhD Harder Family Chair for Cancer Research Member and Chief, Laboratory of Molecular and Tumor Immunology Earle A. Chiles Research Institute

More information

I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms. Table 2: Innate Immunity: First Lines of Defense

I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms. Table 2: Innate Immunity: First Lines of Defense I. Lines of Defense Pathogen: Table 1: Types of Immune Mechanisms Table 2: Innate Immunity: First Lines of Defense Innate Immunity involves nonspecific physical & chemical barriers that are adapted for

More information

Do Your Flow Cytometric LDTs. Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine

Do Your Flow Cytometric LDTs. Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine Do Your Flow Cytometric LDTs Conform to the ICSH ICCS Validation Guidelines? Fiona E. Craig, MD University of Pittsburgh School of Medicine How should LDTs be validated? Accuracy Specificity Sensitivity

More information

Cytokine therapy reverses NK cell anergy in MHC-deficient tumors

Cytokine therapy reverses NK cell anergy in MHC-deficient tumors The Journal of Clinical Investigation Research article Cytokine therapy reverses NK cell anergy in MHC-deficient tumors Michele Ardolino, 1 Camillia S. Azimi, 1 Alexandre Iannello, 1 Troy N. Trevino, 1

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Tumor Immunology. Wirsma Arif Harahap Surgical Oncology Consultant

Tumor Immunology. Wirsma Arif Harahap Surgical Oncology Consultant Tumor Immunology Wirsma Arif Harahap Surgical Oncology Consultant 1) Immune responses that develop to cancer cells 2) Escape of cancer cells 3) Therapies: clinical and experimental Cancer cells can be

More information

in HER-2 Adenovirus Vaccine Protection against Autochthonous Mammary Carcinomas

in HER-2 Adenovirus Vaccine Protection against Autochthonous Mammary Carcinomas This information is current as of May 4, 2018. References Subscription Permissions Email Alerts Early Role of CD4 + Th1 Cells and Antibodies in HER-2 Adenovirus Vaccine Protection against Autochthonous

More information

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking

IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Research article IL-15 regulates memory CD8 + T cell O-glycan synthesis and affects trafficking Jeffrey C. Nolz 1 and John T. Harty 1,2,3 1 Department of Microbiology, 2 Department of Pathology, and 3

More information

Utilizing Humanized NSG Mice to Evaluate Drug Efficacy in Immuno-Oncology

Utilizing Humanized NSG Mice to Evaluate Drug Efficacy in Immuno-Oncology Utilizing Humanized NSG Mice to Evaluate Drug Efficacy in Immuno-Oncology Rick Huntress Director Business Development March 15, 2017 Onco-Hu : Humanized Mice for Evaluation of Immuno-Oncology Therapeutics

More information

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell

There are 2 major lines of defense: Non-specific (Innate Immunity) and. Specific. (Adaptive Immunity) Photo of macrophage cell There are 2 major lines of defense: Non-specific (Innate Immunity) and Specific (Adaptive Immunity) Photo of macrophage cell Development of the Immune System ery pl neu mφ nk CD8 + CTL CD4 + thy TH1 mye

More information

Research Article A Combination of Systemic and Intracranial Anti-CD25 Immunotherapy Elicits a Long-Time Survival in Murine Model of Glioma

Research Article A Combination of Systemic and Intracranial Anti-CD25 Immunotherapy Elicits a Long-Time Survival in Murine Model of Glioma Oncology Volume 29, Article ID 96337, 8 pages doi:1.1155/29/96337 Research Article A Combination of Systemic and Intracranial Anti-CD25 Immunotherapy Elicits a Long-Time Survival in Murine Model of Glioma

More information

Focused Ultrasound and Cancer Immunotherapy

Focused Ultrasound and Cancer Immunotherapy Focused Ultrasound and Cancer Immunotherapy Overview A number of therapeutic modalities including radiation, radiofrequency and laser-induced heating, cryoablation, and focused ultrasound have been shown

More information

Fig. S1 A. week 4 week 6

Fig. S1 A. week 4 week 6 Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis

More information

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School

VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses. Li Wang. Dartmouth Medical School VISTA, a novel immune checkpoint protein ligand that suppresses anti-tumor tumor T cell responses Li Wang Dartmouth Medical School The B7 Immunoglobulin Super-Family immune regulators APC T cell Co-stimulatory:

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Chapter 24 The Immune System

Chapter 24 The Immune System Chapter 24 The Immune System The Immune System Layered defense system The skin and chemical barriers The innate and adaptive immune systems Immunity The body s ability to recognize and destroy specific

More information

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University

CANCER IMMUNOPATHOLOGY. Eryati Darwin Faculty of Medicine Andalas University CANCER IMMUNOPATHOLOGY Eryati Darwin Faculty of Medicine Andalas University Padang 18 Mei 2013 INTRODUCTION Tumor: cells that continue to replicate, fail to differentiate into specialized cells, and become

More information

Trastuzumab e carcinoma mammario HER2+: attività e possibili meccanismi di resistenza

Trastuzumab e carcinoma mammario HER2+: attività e possibili meccanismi di resistenza Innovazioni terapeutiche in Oncologia Medica Cagliari, 23-24 24 giugno 2005 Trastuzumab e carcinoma mammario +: attività e possibili meccanismi di resistenza U.O.A.D.U. Oncologia Medica ed Ematologia I.R.C.C.

More information

Letter to Editor Tissue micro arrays for immunohistochemical detection of inflammatory infiltrates in renal cell carcinoma

Letter to Editor Tissue micro arrays for immunohistochemical detection of inflammatory infiltrates in renal cell carcinoma Int J Clin Exp Med 2014;7(4):1175-1179 www.ijcem.com /ISSN:1940-5901/IJCEM0000102 Letter to Editor Tissue micro arrays for immunohistochemical detection of inflammatory infiltrates in renal cell carcinoma

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

Combination Immunotherapy Approaches Chemotherapy, Radiation Therapy, and Dual Checkpoint Therapy

Combination Immunotherapy Approaches Chemotherapy, Radiation Therapy, and Dual Checkpoint Therapy Combination Immunotherapy Approaches Chemotherapy, Radiation Therapy, and Dual Checkpoint Therapy Dr. David B. Page Providence Portland Medical Center Earle A. Chiles Research Institute Funding & Disclosures

More information

Chapter 13 Lymphatic and Immune Systems

Chapter 13 Lymphatic and Immune Systems The Chapter 13 Lymphatic and Immune Systems 1 The Lymphatic Vessels Lymphoid Organs Three functions contribute to homeostasis 1. Return excess tissue fluid to the bloodstream 2. Help defend the body against

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Combining ADCs with Immuno-Oncology Agents

Combining ADCs with Immuno-Oncology Agents Combining ADCs with Immuno-Oncology Agents Chad May, PhD Senior Director Targeted Immunotherapy Oncology Research Unit, Pfizer 7 th Annual World ADC October 10, 2016 Cancer-Immunity Cycle Innate Immunity

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Supporting Information

Supporting Information Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Chapter 16 Lymphatic System and Immunity. Lymphatic Pathways. Lymphatic Capillaries. network of vessels that assist in circulating fluids

Chapter 16 Lymphatic System and Immunity. Lymphatic Pathways. Lymphatic Capillaries. network of vessels that assist in circulating fluids Chapter 16 Lymphatic System and Immunity network of vessels that assist in circulating fluids closely associated with the cardiovascular system transports excess fluid away from interstitial spaces transports

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

The Major Histocompatibility Complex (MHC)

The Major Histocompatibility Complex (MHC) The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens

More information

Innate Immunity. Bởi: OpenStaxCollege

Innate Immunity. Bởi: OpenStaxCollege Innate Immunity Bởi: OpenStaxCollege The vertebrate, including human, immune system is a complex multilayered system for defending against external and internal threats to the integrity of the body. The

More information

Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding. 6 October

Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding. 6 October Immunology 2011 Lecture 11 Innate Immunity & Genetics of Inbreeding 6 October HANDOUT #6, Problem Set 3 TODAY Innate Immunity no core notes Genetics of Inbreeding - Appendix 10 MHC & Transplantation, Chapter

More information

Disclosure Information. Mary L. Disis

Disclosure Information. Mary L. Disis Disclosure Information Mary L. Disis I have the following financial relationships to disclose: Consultant for: VentiRx, Celgene, Emergent, EMD Serono Speaker s Bureau for: N/A Grant/Research support from:

More information

BD IMag Cell Separation System

BD IMag Cell Separation System BD IMag Cell Separation System Table of Contents Magnetic Cell Separation with BD IMag Particles.............................................................. 3 BD IMag Enrichment Protocol Flow Chart......................................................................

More information

Heat-killed Lactobacillus casei

Heat-killed Lactobacillus casei Heat-killed Lactobacillus casei confers broad protection against influenza A virus primary infection and develops heterosubtypic immunity against future secondary infection Yu-Jin Jung, Young-Tae Lee,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-86 TITLE: Visualizing Breast Cancer Cell Interaction With Tumor-Infiltrating Lymphocytes During Immunotherapy PRINCIPAL INVESTIGATOR: Helene BEUNEU CONTRACTING ORGANIZATION:

More information

Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice

Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice Rupal Ramakrishnan,, Esteban Celis, Dmitry I. Gabrilovich J Clin Invest. 2010;120(4):1111-1124.

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma

Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma Restoring Immune Function of Tumor-Specific CD4 + T Cells during Recurrence of Melanoma Goding SR et al. J Immunol 2013; 190:4899-4909 C. Nikolowsky Christian Doppler Laboratory for Cardiac and Thoracic

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Immunobiology, BIOL 537 Spring 2013

Immunobiology, BIOL 537 Spring 2013 Immunobiology, BIOL 537 Spring 2013 Instructor: Dr. Elliott Blumenthal Office: Science Building, # 390 Class Meets: 6:00-7:15 PM TR Phone: 481-6004 E-mail: Blumenth@ipfw.edu SB 168 481-6305 (Biology Office)

More information

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions

Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System Multiple-Choice Questions Campbell's Biology: Concepts and Connections, 7e (Reece et al.) Chapter 24 The Immune System 24.1 Multiple-Choice Questions 1) The body's innate defenses against infection include A) several nonspecific

More information