Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
|
|
- Melvyn Brown
- 6 years ago
- Views:
Transcription
1 Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley September 30, 2010 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
2 Outline Genotyping microarrays in cancer research 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
3 Outline Genotyping microarrays in cancer research DNA copy number changes in cancer cells 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
4 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genomic changes at the DNA level are hallmarks of cancer We inherited 23 paternal and 23 maternal chromosomes, mostly identical. Normal karyotype Tumor karyotype Our goal: identify CN changes to improve characterization, classification, and treatment of cancers Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
5 Genotyping microarrays in cancer research Genotypes in a diploid chromosome DNA copy number changes in cancer cells Genotypes in a diploid chromosome Single nucleotide polymorphism G C C T C A G G million known SNPs Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
6 Genotyping microarrays in cancer research Genotypes in a diploid chromosome DNA copy number changes in cancer cells Genotypes in a diploid chromosome Single nucleotide polymorphism A B B B AB BB B A AB A A AA million known SNPs Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
7 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotypes and copy numbers in a tumor Genotypes and copy numbers in a tumor Tumor with deletion copy-neutral LOH Matched Normal (diploid) Tumor with gain (0,2) - - BB BB BB BB A B B B AB BB A B BB BB ABB BBB (1,2) (0,1) (1,1) - A A A A AA B A AB A A AA A A B A AB AA (1,1) Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
8 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Parental, minor and major copy numbers Parental copy numbers at genomic locus j: (m j, p j ), the unobserved number of maternal and paternal chromosomes at j. Copy number state at genomic locus j CN = (C 1j, C 2j ), where C 1j = min(m j, p j ) and C 2j = max(m j, p j ). Minor (C 1 ) and major (C 2 ) copy numbers: characterize the above CN events in cancers can be estimated from SNP arrays Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
9 Outline Genotyping microarrays in cancer research Genotyping microarray data 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
10 Genotyping microarrays in cancer research Genotyping microarray data Technology: Technology: Copy number and genotyping microarrays Copy number and genotyping microarrays Chip Design Probes DNA T/C CGTGTAATTGAACC GCACATTAACTTGG GCACATCAACTTGG CGTGTAGTTGAACC CCCCGTAAAGTACT TATGCCGCCCTGCG ATACGGCGGGACGC Sample DNA + Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
11 Genotyping microarrays in cancer research Genotyping microarray data (C 1, C 2 ) can be estimated from SNP arrays For SNP j in sample i, observed signal intensities can be summarized as (θ, β), where θ ij = θ Aij + θ ijb and β ij = θ ijb /θ ij. Total copy numbers C ij = 2 θ ij θ Rj = C 1ij + C 2ij Decrease in heterozygosity DH ij = 2 β ij 1/2 = C 2ij C 1ij C 2ij + C 1ij Notes: DH only defined for SNPs that were heterozygous in the germline Both dimensions are needed to understand what is going on: Copy neutral LOH: CN = (0, 2), normal total copy number Balanced duplication: CN = (2, 2), allelic balance Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
12 Genotyping microarrays in cancer research Genotyping microarray data The Cancer Genome Atlas (TCGA) Accelerate our understanding of the molecular basis of cancer 20 tumor types: brain (glioblastoma multiforme), ovarian, breast, lung, leukemia (AML)... Large studies: 500 tumor-normal pairs for each tumor type Data levels: DNA copy number, gene expression, DNA methylation Platforms: microarray and sequencing For SNP arrays: identify copy number changes: (C, DH) or (C 1, C 2 ): 1 detection: finding regions 2 classification labeling regions Data shown in this presentation: high-grade serous ovarian adenocarcinoma (OvCa). Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
13 Outline Genotyping microarrays in cancer research Genotyping microarray data 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
14 Genotyping microarrays in cancer research No copy number change: (1,1) Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
15 Gain: (1, 2) Genotyping microarrays in cancer research Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
16 Deletion: (0, 1) Genotyping microarrays in cancer research Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
17 Genotyping microarrays in cancer research Copy number neutral LOH: (0, 2) Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
18 Genotyping microarrays in cancer research Tumor purity/normal contamination Genotyping microarray data In practice what we call tumor samples are actually a mixture of tumor and normal cells. The ones just shown have the largest fraction of tumor cells in the data set. In presence of normal contamination allele B fractions for heterozygous SNPs are shrunk toward 1/2. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
19 Genotyping microarrays in cancer research Normal, gain, copy neutral LOH Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
20 Genotyping microarrays in cancer research Normal, deletion, copy neutral LOH Genotyping microarray data BB AB AA Homozygous SNPs in the normal sample are highlighted in red. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
21 Outline TumorBoost: improved power to detect CN changes 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
22 Outline TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
23 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Raw genomic signals: allelic ratios are noisy After preprocessing using the CRMAv2 method βt βn C Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
24 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects SNP effect in a region of no CN change in the tumor Instead of three points at (0,0), ( 1 2, 1 2 ) and (1,1), we have three clusters; the observed deviation is a SNP effect: δ ij = β ij µ ij δ is quite reproducible between the normal and the tumor Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
25 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects SNP effect in a region where tumor has a gain Homozygous clusters are similar as before Heterozygous cluster is split in two, and tilted Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
26 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects SNP effect in a region where tumor is CNNLOH Homozygous clusters are similar as before Heterozygous cluster is even more tilted Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
27 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Overview of the TumorBoost method Idea 1 the SNP effect is reproducible between tumor and normal 2 in the normal the truth is easier to infer because we only expect three true allele B fractions, corresponding to genotypes AA, AB, BB. For each SNP, we estimate the SNP effect in the normal hybridization, and subtract it from the tumor. Features No need to know copy number regions in advance Normalization is performed for each SNP separately Only one tumor/normal pair required H. Bengtsson, P. Neuvial, T.P. Speed TumorBoost: Normalization of allele-specific tumor copy numbers from a single pair of tumor-normal genotyping microarrays. BMC Bioinformatics (2010) 11:245. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
28 TumorBoost: improved power to detect CN changes Proposed normalization strategy Method: taking advantage of SNP effects Estimate the SNP effect in the normal sample as ˆδ Nj = β Nj ˆµ Nj, where ˆµ Nj {0, 1/2, 1} is the normal genotype For homozygous SNPs (ˆµ Nj {0, 1}): β Tj = β Tj β Nj + ˆµ Nj For heterozygous SNPs (ˆµ Nj 1/2): β Tj = { 1 2 βtj β Nj β Tj 1 β Nj if β Tj < β Nj otherwise Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
29 Outline TumorBoost: improved power to detect CN changes Results: improved signal to noise ratio 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
30 TumorBoost: improved power to detect CN changes Genomic signals before normalization Results: improved signal to noise ratio Normal, gain, copy neutral LOH Normal, loss, copy neutral LOH βn βt C Chromosome 2 (in Mb) Chromosome 10 (in Mb) Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
31 TumorBoost: improved power to detect CN changes Genomic signals after normalization Results: improved signal to noise ratio Normal, gain, copy neutral LOH Normal, loss, copy neutral LOH βn βt C Chromosome 2 (in Mb) Chromosome 10 (in Mb) Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
32 TumorBoost: improved power to detect CN changes Allele B fractions before normalization Results: improved signal to noise ratio Chromosome 10 Chromosome 2 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
33 TumorBoost: improved power to detect CN changes Allele B fractions after normalization Results: improved signal to noise ratio Chromosome 10 Chromosome 2 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
34 TumorBoost: improved power to detect CN changes ASCNs before normalization Results: improved signal to noise ratio Chromosome 10 Chromosome 2 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
35 TumorBoost: improved power to detect CN changes ASCNs after normalization Results: improved signal to noise ratio Chromosome 10 Chromosome 2 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
36 Outline TumorBoost: improved power to detect CN changes ROC evaluation 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
37 TumorBoost: improved power to detect CN changes ROC evaluation Detecting changes in allele B fractions allele B fractions: β allele B fractions for heterozygous SNPs mirrored allele B fractions for heterozygous SNPs: ρ = β 1/2 = DH/2 For heterozygous SNPs DH only has one mode so it can be segmented. We use ROC analysis to assess how separated two regions on each side of a known change point in DH are. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
38 TumorBoost: improved power to detect CN changes ROC evaluation ROC evaluation Available from aroma.cn.eval at: For a given sample: find a clear change point label flanking regions, e.g. NORMAL (1,1) and DELETION (0,1) choose one reference state and one state to call For each value of a threshold τ: Call SNPs below τ a DELETION Count number of true and false DELETIONs. ROC curve is built by adjusting τ. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
39 TumorBoost: improved power to detect CN changes ROC evaluation ROC evaluation Available from aroma.cn.eval at: For a given sample: find a clear change point label flanking regions, e.g. NORMAL (1,1) and DELETION (0,1) choose one reference state and one state to call For each value of a threshold τ: Call SNPs below τ a DELETION Count number of true and false DELETIONs. ROC curve is built by adjusting τ. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
40 TumorBoost: improved power to detect CN changes ROC evaluation ROC evaluation Available from aroma.cn.eval at: For a given sample: find a clear change point label flanking regions, e.g. NORMAL (1,1) and DELETION (0,1) choose one reference state and one state to call For each value of a threshold τ: Call SNPs below τ a DELETION Count number of true and false DELETIONs. ROC curve is built by adjusting τ. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
41 TumorBoost: improved power to detect CN changes ROC evaluation Result: Result: Better detection of allelic imbalances Better detection of allelic imbalances Allelic imbalance NORMAL REGION GAIN 100% TumorBoost Total CNs NORMAL REGION GAIN True-Positive Rate 50% Total CN original 0% False-Positive Rate 50% Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
42 TumorBoost: improved power to detect CN changes ROC evaluation Complete preprocessing for a single tumor/normal pair Available from aroma.cn and aroma.affymetrix at: Normalization and locus-level summarization using CRMAv2 (Bengtsson et al, 2009) for the normal and the tumor sample separately Naive genotyping of the normal sample: threshold density of β TumorBoost normalization (Bengtsson et al, 2010) Note: genotyping errors can be taken care of by smoothing or using confidence scores. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
43 TumorBoost: improved power to detect CN changes ROC evaluation Observed power to detect changes (1,1) vs (1,2) (1,1) vs (0,1) Legend: Total copy number Raw allele B fractions Normalized β (naive) Normalized β (Birdseed) (1,2) vs (0,2) (0,1) vs (0,2) TCN is consistent across change points β is not! Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
44 TumorBoost: improved power to detect CN changes ROC evaluation Expected power to detect changes C varies from one unit in all change points just shown For DH and thus (C 1, C 2 )) it s more complicated: ρ (0,2) (0,1) (1,3) (1,2) (1,1) (0,0) Tumor purity Difference in ρ (1,1) to (0,1) (1,2) to (0,2) (1,1) to (1,2) (0,1) to (0,2) Tumor purity The expected improvement depends on the type of change point and on normal contamination. Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
45 TumorBoost: improved power to detect CN changes ROC evaluation What if no matched normal is available? CalMaTe For each SNP: Estimate a calibration function (from observed signals to genotypes) using a set of reference samples Back-transform test samples Before CalMate normalization After CalMate normalization Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
46 Challenges for detecting and calling of copy number events Outline 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
47 Challenges for detecting and calling of copy number events Outline Detecting copy number changes from both C and DH 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
48 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Changes can be reflected in both dimensions Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
49 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH DH has greater detection power than C at a single locus Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
50 Challenges for detecting and calling of copy number events More informative probes for C than DH Affymetrix GenomeWideSNP 6 Detecting copy number changes from both C and DH All units CN units SNP units Frequency 1,856, , ,364 Proportion 100% 51% 49% Unit types All units AA AB BB Frequency 1,856, , , ,418 Proportion 100% 18% 14% 18% SNPs by genotype call for sample TCGA Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
51 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Similar detection power at a fixed resolution Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
52 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Need for a truly joint dimensional segmentation method Most methods segment only one of C and DH Some use two-way segmentation: Olshen et al, [PSCBS] A handful are truly two-dimensional : Chen et al, [pscn] Greenman et al, Biostat., 2010, [PICNIC] Sun et al, NAR, 2009, [genocna] Challenges for a truly joint segmentation method A two-dimensional signal Only heterozygous SNPs can be used to detect CN changes from DH Bias in the estimation of DH DH is not Gaussian Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
53 Challenges for detecting and calling of copy number events Outline Calling: influence of tumor purity, ploidy, and signal saturation 1 Genotyping microarrays in cancer research DNA copy number changes in cancer cells Genotyping microarray data 2 TumorBoost: improved power to detect CN changes Method: taking advantage of SNP effects Results: improved signal to noise ratio ROC evaluation 3 Challenges for detecting and calling of copy number events Detecting copy number changes from both C and DH Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
54 Challenges for detecting and calling of copy number events Copy numbers are not calibrated Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
55 ATION Challenges for detecting and calling of copy number events Non-calibrated signals: signal saturation Calling: influence of tumor purity, ploidy, and signal saturation CN obs = f(cn true ) < CN true C obs = f (C true ) < C obs f is unknown Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
56 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation Non-calibrated signals: ploidy and purity Copy number Pure tumor, ploidy = 2 Pure tumor, ploidy > Position (Mb) Copy number Position (Mb) Allele fractions Position (Mb) Allele fractions Position (Mb) Non pure tumor, ploidy=2 Non-pure tumor, ploidy < 2 Copy number Position (Mb) Copy number Position (Mb) Allele fractions Position (Mb) Allele fractions Position (Mb) Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
57 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation Purity, ploidy, and signal saturation Why copy numbers are not calibrated signal saturation non purity: presence of normal cells in the tumor sample ploidy: the total amount of DNA is fixed by the assay Remarks ploidy is not identifiable purity and ploidy are biological properties of the sample signal saturation is an artifact from the assay under the rug: tumor heterogeneity Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
58 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation OverUnder: Attiyeh et al, Genome Research, 2009 Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
59 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation GAP: Popova et al, Genome Biology, (a) BAF 0 1 (b) LRR X SNP Index B B allele frequency Pierre Neuvial (UC Berkeley) ~70% tumor cells (d) 0.0 Log R ratio Sub-clones A 0.0 BB AB -0.4 AA Log R ratio Log R ratio ABB AAB -0.4 (c) 0.4 Homozygous regions Germline -- Acquired B allele frequency SNP array data analyses in cancer studies p_baf = 0.3 q_lrr = (e) B allele frequency / 60
60 Challenges for detecting and calling of copy number events ASCAT: Van Loo et al, PNAS, 2010 Calling: influence of tumor purity, ploidy, and signal saturation Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
61 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation Comments on existing approaches What about Affymetrix data? Choice between candidate solutions Perform ad hoc correction for saturation Tumor heterogeneity? Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
62 Challenges for detecting and calling of copy number events Calling: influence of tumor purity, ploidy, and signal saturation Thanks Henrik Bengtsson Adam Olshen Maria Ortiz Angel Rubio Venkat E. Seshan Terry Speed Paul Spellman Nancy R. Zhang Funding: The Cancer Genome Atlas Pierre Neuvial (UC Berkeley) SNP array data analyses in cancer studies / 60
Understanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationGenome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre
Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes
More informationComparison of segmentation methods in cancer samples
fig/logolille2. Comparison of segmentation methods in cancer samples Morgane Pierre-Jean, Guillem Rigaill, Pierre Neuvial Laboratoire Statistique et Génome Université d Évry Val d Éssonne UMR CNRS 8071
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationADVANCED PGT SERVICES
Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationThe Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More informationBiostatistical modelling in genomics for clinical cancer studies
This work was supported by Entente Cordiale Cancer Research Bursaries Biostatistical modelling in genomics for clinical cancer studies Philippe Broët JE 2492 Faculté de Médecine Paris-Sud In collaboration
More informationHuman Cancer Genome Project. Bioinformatics/Genomics of Cancer:
Bioinformatics/Genomics of Cancer: Professor of Computer Science, Mathematics and Cell Biology Courant Institute, NYU School of Medicine, Tata Institute of Fundamental Research, and Mt. Sinai School of
More informationBACOM2: a Java tool for detecting normal cell contamination of copy number in heterogeneous tumor
Page 1 BACOM2: a Java tool for detecting normal cell contamination of copy number in heterogeneous tumor Yi Fu 1, Jun Ruan 2, Guoqiang Yu 1, Douglas A. Levine 3, Niya Wang 1, Ie- Ming Shih 4, Zhen Zhang
More informationMosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer
Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationUTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES
UTILIZATION OF A SNP MICROARRAY FOR CHRONIC LYMPHOCYTIC LEUKEMIA: EFFICACY, INFORMATIVE FINDINGS AND PROGNOSTIC CAPABILITIES S Schwartz, Z Hosseini, S Schepis, P Papenhausen Laboratory Corporation of America
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution
More informationThe role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia
The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)
More informationAbsolute quantification of somatic DNA alterations in human cancer
Absolute quantification of somatic DNA alterations in human cancer The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationIntroduction to Gene Sets Analysis
Introduction to Svitlana Tyekucheva Dana-Farber Cancer Institute May 15, 2012 Introduction Various measurements: gene expression, copy number variation, methylation status, mutation profile, etc. Main
More informationOn Missing Data and Genotyping Errors in Association Studies
On Missing Data and Genotyping Errors in Association Studies Department of Biostatistics Johns Hopkins Bloomberg School of Public Health May 16, 2008 Specific Aims of our R01 1 Develop and evaluate new
More informationGene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering
Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene
More informationOncoPhase: Quantification of somatic mutation cellular prevalence using phase information
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,
More informationComputational Analysis of Genome-Wide DNA Copy Number Changes
Computational Analysis of Genome-Wide DNA Copy Number Changes Lei Song Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationAssessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,
More informationStatistics 202: Data Mining. c Jonathan Taylor. Final review Based in part on slides from textbook, slides of Susan Holmes.
Final review Based in part on slides from textbook, slides of Susan Holmes December 5, 2012 1 / 1 Final review Overview Before Midterm General goals of data mining. Datatypes. Preprocessing & dimension
More informationClinical Interpretation of Cancer Genomes
IGENZ Ltd, Auckland, New Zealand Clinical Interpretation of Cancer Genomes Dr Amanda Dixon-McIver www.igenz.co.nz 1992 Slovenia and Croatia gain independence USA and Russia declare the Cold War over Steffi
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationThe laws of Heredity. Allele: is the copy (or a version) of the gene that control the same characteristics.
The laws of Heredity 1. Definition: Heredity: The passing of traits from parents to their offspring by means of the genes from the parents. Gene: Part or portion of a chromosome that carries genetic information
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationSubcloneSeeker: a computational framework for reconstructing tumor clone structure for cancer variant interpretation and prioritization
Qiao et al. Genome Biology 2014, 15:443 METHOD Open Access SubcloneSeeker: a computational framework for reconstructing tumor clone structure for cancer variant interpretation and prioritization Yi Qiao
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationSNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation carrier and normal blastocysts
J Assist Reprod Genet (2016) 33:1115 1119 DOI 10.1007/s10815-016-0734-0 TECHNOLOGICAL INNOVATIONS SNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationA general framework for analyzing tumor subclonality using SNP array and DNA sequencing data
Li and Li Genome Biology 2014, 15:473 METHOD A general framework for analyzing tumor subclonality using SNP array and DNA sequencing data Bo Li 1 and Jun Z Li 2 Open Access Abstract Intra-tumor heterogeneity
More informationContents. 1.5 GOPredict is robust to changes in study sets... 5
Supplementary documentation for Data integration to prioritize drugs using genomics and curated data Riku Louhimo, Marko Laakso, Denis Belitskin, Juha Klefström, Rainer Lehtonen and Sampsa Hautaniemi Faculty
More informationSeven cases of intellectual disability analysed by genomewide SNP analysis. Rodney J. Scott
Seven cases of intellectual disability analysed by genomewide SNP analysis Rodney J. Scott Ability to interrogate Genomic Material ~1930 Crude analyses 2012 Highly precise analyses A (very) brief history
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationAnalysis of CGH and SNP arrays for the detection of chromosomal aberrations in single cells
Analysis of CGH and SNP arrays for the detection of chromosomal aberrations in single cells Peter Konings 1 Evelyne Vanneste 1,2 Thierry Voet 1 Cédric Le Caignec 1 Michèle Ampe 1 Cindy Melotte 1 Sophie
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationUsing CART to Mine SELDI ProteinChip Data for Biomarkers and Disease Stratification
Using CART to Mine SELDI ProteinChip Data for Biomarkers and Disease Stratification Kenna Mawk, D.V.M. Informatics Product Manager Ciphergen Biosystems, Inc. Outline Introduction to ProteinChip Technology
More informationCopy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics
Copy Number Variations and Association Mapping 02-715 Advanced Topics in Computa8onal Genomics SNP and CNV Genotyping SNP genotyping assumes two copy numbers at each locus (i.e., no CNVs) CNV genotyping
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationAdvances In Measurement Modeling: Bringing Genetic Information Into Preventive Interventions And Getting The Phenotype Right
Advances In Measurement Modeling: Bringing Genetic Information Into Preventive Interventions And Getting The Phenotype Right Bengt Muthen, UCLA bmuthen@ucla.edu 1 Modeling The Influence On A Person s Behavior
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationSupplementary Material to. Genome-wide association study identifies new HLA Class II haplotypes strongly protective against narcolepsy
Supplementary Material to Genome-wide association study identifies new HLA Class II haplotypes strongly protective against narcolepsy Hyun Hor, 1,2, Zoltán Kutalik, 3,4, Yves Dauvilliers, 2,5 Armand Valsesia,
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationCHAPTER 2. Cancer Res Nov 15; 65(22):
RELIABLE HIGH-THROUPHGPUT GENOTYPING AND LOSS OF HETEROZYGOSITY DETECTION IN FORMALIN- FIXED, PARAFFIN-EMBEDDED TUMORS USING SINGLE NUCLEOTIDE POLYMORPHISM ARRAYS CHAPTER 2 Reliable high-throughput genotyping
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationPloidy and large-scale genomic instability consistently identify basal-like breast
Supplementary Data and Figures Ploidy and large-scale genomic instability consistently identify basal-like breast carcinomas with BRCA1/2 inactivation Popova T, Manié E, Rieunier G, Caux-Moncoutier V,
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationGenetics and Diversity Punnett Squares
Genetics and Diversity Punnett Squares 1 OUTCOME QUESTION(S): S1-1-12: How are the features of the parents inherited to create unique offspring? Vocabulary & Concepts Allele Dominant Recessive Genotype
More informationWhat can we contribute to cancer research and treatment from Computer Science or Mathematics? How do we adapt our expertise for them
From Bioinformatics to Health Information Technology Outline What can we contribute to cancer research and treatment from Computer Science or Mathematics? How do we adapt our expertise for them Introduction
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationUNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms.
UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES Many things come in many forms. Give me an example of something that comes in many forms. Genes, too, come in many forms. Main Idea #1 The same gene
More informationTutorial on Genome-Wide Association Studies
Tutorial on Genome-Wide Association Studies Assistant Professor Institute for Computational Biology Department of Epidemiology and Biostatistics Case Western Reserve University Acknowledgements Dana Crawford
More informationHematopathology Service Memorial Sloan Kettering Cancer Center, New York
SH2017-0334 t(14;18) Negative Follicular Lymphoma with 1p36 abnormality associated with In Situ Follicular Neoplasia with t(14;18) translocation Pallavi Khattar MD, Jennifer Maerki MD, Alexander Chan MD,
More informationNature Medicine: doi: /nm.3967
Supplementary Figure 1. Network clustering. (a) Clustering performance as a function of inflation factor. The grey curve shows the median weighted Silhouette widths for varying inflation factors (f [1.6,
More informationSystematic Analysis for Identification of Genes Impacting Cancers
Systematic Analysis for Identification of Genes Impacting Cancers Arpita Singhal Stanford University Saint Francis High School ABSTRACT Currently, vast amounts of molecular information involving genomic
More informationNovember 9, Johns Hopkins School of Medicine, Baltimore, MD,
Fast detection of de-novo copy number variants from case-parent SNP arrays identifies a deletion on chromosome 7p14.1 associated with non-syndromic isolated cleft lip/palate Samuel G. Younkin 1, Robert
More informationAnalysis of Somatic Alterations in Cancer Genome: From SNP Arrays to Next Generation Sequencing
Analysis of Somatic Alterations in Cancer Genome: From SNP Arrays to Next Generation Sequencing Tatiana Popova, Valentina Boeva, Elodie Manié, Yves Rozenholc, Emmanuel Barillot, Marc-Henri Stern To cite
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
More informationThe 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis
The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics
More informationNature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationAddressing the challenges of genomic characterization of hematologic malignancies using microarrays
Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University
More informationAspects of Statistical Modelling & Data Analysis in Gene Expression Genomics. Mike West Duke University
Aspects of Statistical Modelling & Data Analysis in Gene Expression Genomics Mike West Duke University Papers, software, many links: www.isds.duke.edu/~mw ABS04 web site: Lecture slides, stats notes, papers,
More informationBy Mir Mohammed Abbas II PCMB 'A' CHAPTER CONCEPT NOTES
Chapter Notes- Genetics By Mir Mohammed Abbas II PCMB 'A' 1 CHAPTER CONCEPT NOTES Relationship between genes and chromosome of diploid organism and the terms used to describe them Know the terms Terms
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More informationUnit 5: Genetics Notes
Unit 5: Genetics Notes https://goo.gl/fgtzef Name: Period: Test Date: Table of Contents Title of Page Page Number Date Warm-ups 3-4 Mendelian Genetics Notes 5-6 Mendelian Genetics Lets Practice 7 Monohybrid
More informationWhite Paper. Copy number variant detection. Sample to Insight. August 19, 2015
White Paper Copy number variant detection August 19, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationDistinguishing Second Primary Cancers From Metastases: Statistical Challenges in Testing Clonal Relatedness of Tumors
Distinguishing Second Primary Cancers From Metastases: Statistical Challenges in Testing Clonal Relatedness of Tumors Colin Begg Department of Epidemiology and Biostatistics Memorial Sloan-Kettering Cancer
More informationCompound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13
Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive
More informationNature Genetics: doi: /ng Supplementary Figure 1. Mutational signatures in BCC compared to melanoma.
Supplementary Figure 1 Mutational signatures in BCC compared to melanoma. (a) The effect of transcription-coupled repair as a function of gene expression in BCC. Tumor type specific gene expression levels
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationCytogenetics Technologies, Companies & Markets
Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationQuantification of Normal Cell Fraction and Copy Number Neutral LOH in Clinical Lung Cancer Samples Using SNP Array Data
Quantification of Normal Cell Fraction and Copy Number Neutral LOH in Clinical Lung Cancer Samples Using SNP Array Data Hanna Göransson 1, Karolina Edlund 2, Maria Rydåker 1, Markus Rasmussen 1, Johan
More information