Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

Principles of Genetics and Molecular Biology

Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan Aims To identify genes controlling tumor

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

supplementary information

DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

number Done by Corrected by Doctor Maha Shomaf

number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly

Quantitative Data Analysis Assignment Sample Newessays.co.uk

Absorbance Quantitative Data Analysis Assignment Sample Newessays.co.uk Part A: Results of the Study Is there a difference of curve profile between the MTT assay and the cell number? What do the different

A RENAISSANCE FOR SRC

A RENAISSANCE FOR SRC Timothy J. Yeatman The c-src non-receptor tyrosine kinase is overexpressed and activated in a large number of human malignancies and has been linked to the development of cancer and

Supplemental information

Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

EMT: Epithelial Mesenchimal Transition

EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis

Cell Cell Communication

IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation

Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis

TITLE: The Cadherin Interaction as a Rate Limiting Step in Breast Cancer Metastasis to the Liver

AD Award Number: W81XWH-06-1-0403 TITLE: The Cadherin Interaction as a Rate Limiting Step in Breast Cancer Metastasis to the Liver PRINCIPAL INVESTIGATOR: Christopher R. Shepard CONTRACTING ORGANIZATION:

Cell Cell Communication

IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

ABSTRACT INTRODUCTION. Hsin-Lin Cheng 1,2, Chiao-Wen Lin 3,4, Jia-Sin Yang 1,2, Ming-Ju Hsieh 1,5, Shun-Fa Yang 1,2, Ko-Hsiu Lu 6,7

/, Vol. 7, No. 9 Zoledronate blocks geranylgeranylation not farnesylation to suppress human osteosarcoma U2OS cells metastasis by EMT via Rho A activation and FAK-inhibited JNK and p38 pathways Hsin-Lin

ABSTRACT INTRODUCTION

/, 2017, Vol. 8, (No. 1), pp: 915-932 Non-toxic dose of liposomal honokiol suppresses metastasis of hepatocellular carcinoma through destabilizing EGFR and inhibiting the downstream pathways Jianhong Yang

Positive and Negative Regulators of Metastasis

Positive and Negative Regulators of Metastasis J. Carl Barrett Laboratory of Biosystems and Cancer Center for Cancer Research National Cancer Institute TIME SCALE OF TUMOR PROGRESSION CHEMOPREVENTION PERIOD

Cancer invasion: Growth factor-induced mechanisms and targeting by image-guided surgery. Julia Odenthal

Cancer invasion: Growth factor-induced mechanisms and targeting by image-guided surgery Julia Odenthal Cover design: Julia Odenthal Cover image: UT-SCC58 spheroid cultured in a 3D collagen matrix and stained

Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines

Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines Dra Martha Robles Flores Department of Biochemistry Facultad de Medicina Universidad Nacional Autónoma de México Tissue anatomy of the

SUPPLEMENTARY INFORMATION

DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

Cell Polarity and Cancer

Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

Justyna Sikorska, Damian Gaweł, Hanna Domek, Magdalena Rudzińska and Barbara Czarnocka *

Sikorska et al. BMC Cancer (2019) 19:85 https://doi.org/10.1186/s12885-018-5239-z RESEARCH ARTICLE Open Access Podoplanin (PDPN) affects the invasiveness of thyroid carcinoma cells by inducing ezrin, radixin

PAX8-PPARγ Fusion Protein in thyroid carcinoma

Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan Learning Objectives

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt

Cell Cyc Cell Cy l c e

Mechanisms of Cell Proliferation 1 Cell Cycle G 2 S G 1 2 Multi-cellular organisms depend on cell division/proliferation; Each organism has a developmental plan that determines its behavior and properties;

N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic target in cancer

Mrozik et al. BMC Cancer (2018) 18:939 https://doi.org/10.1186/s12885-018-4845-0 REVIEW N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

Department of Pathology, Wan Fang Hospital, Taipei Medical University, Taipei 116, Taiwan; 2

Int. J. Mol. Sci. 2015, 16, 2530-2558; doi:10.3390/ijms16022530 Article OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms EGCG Inhibits Proliferation, Invasiveness

DNA Microarray Analysis of the Epithelial Mesenchymal Transition of Mesothelial Cells in a Rat Model of Peritoneal Dialysis

Advances in Peritoneal Dialysis, Vol. 27, 2011 Toshimi Imai, Ichiro Hirahara, Yoshiyuki Morishita, Akira Onishi, Makoto Inoue, Shigeaki Muto, Eiji Kusano DNA Microarray Analysis of the Epithelial Mesenchymal

CXC chemokine (ligand/receptor)

List of abbreviations -MEM alpha-modified minimal essential AKT protein kinase B (also abbreviated PKB) AMC 7-amino-4-methylcoumarin AP-1 activator protein 1 ARF ADP-ribosylation factor, a small GTP-binding

Epithelial to Mesenchymal Transition in Renal Fibrogenesis: Pathologic Significance, Molecular Mechanism, and Therapeutic Intervention

REVIEW J Am Soc Nephrol 15: 1 12, 2004 Epithelial to Mesenchymal Transition in Renal Fibrogenesis: Pathologic Significance, Molecular Mechanism, and Therapeutic Intervention YOUHUA LIU Division of Cellular

NIH Public Access Author Manuscript Nat Rev Mol Cell Biol. Author manuscript; available in PMC 2014 November 21.

NIH Public Access Author Manuscript Published in final edited form as: Nat Rev Mol Cell Biol. 2014 March ; 15(3): 178 196. doi:10.1038/nrm3758. Molecular mechanisms of epithelial mesenchymal transition

Many Forms of Cell-Cell Communication Regulate Tissue Function and Phenotype Physiological Functions of Gap Junctions Homeostasis buffering/sharing of ions, nutrients, and water Metabolic support nutrient

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer

Research article Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer Punita Dhawan, 1 Amar B. Singh, 2 Natasha G. Deane, 1,3 YiRan No, 1 Sheng-Ru Shiou, 1 Carl Schmidt,

WNT signalling pathways as therapeutic targets in cancer

WNT signalling pathways as therapeutic targets in cancer Jamie N. Anastas 1,2,3,4 and Randall T. Moon 1,2,4 Abstract Since the initial discovery of the oncogenic activity of WNT1 in mouse mammary glands,

Yanrong Su *, Nathan R. Hopfinger, Theresa D. Nguyen, Thomas J. Pogash, Julia Santucci-Pereira and Jose Russo *

Su et al. Journal of Experimental & Clinical Cancer Research (2018) 37:314 https://doi.org/10.1186/s13046-018-0988-8 RESEARCH Open Access Epigenetic reprogramming of epithelial mesenchymal transition in

INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION

INTEGRIN SIGNALLING DURING TUMOUR PROGRESSION Wenjun Guo and Filippo G. Giancotti Abstract During progression from tumour growth to metastasis, specific integrin signals enable cancer cells to detach from

EMT AND CANCERS. Terrence P McGarty White Paper No 157 January, 2019

EMT AND CANCERS Terrence P McGarty White Paper No 157 January, 2019 The epithelial to mesenchymal transition, EMT, is a process that has been closely linked to cancer metastasis. We examine its current

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors

The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway in Prostate Cancer

Grand Valley State University ScholarWorks@GVSU Masters Theses Graduate Research and Creative Practice 4-27-2017 The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway

Wnt signaling. Ramray Bhat.

Wnt signaling Ramray Bhat ramray@mrdg.iisc.ernet.in Starting with animal biology and viral infections The discovery of certain laboratory murine strains that were highly susceptible to mammary gland cancer.

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

IJC International Journal of Cancer

IJC International Journal of Cancer Steps in prostate cancer progression that lead to bone metastasis Jung-Kang Jin 1,2, Farshid Dayyani 1 and Gary E. Gallick 1,2 1 Department of Genitourinary Medical

Biobehavioral Pathways in Epithelial Ovarian Cancer

Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

AD Award Number: W81XWH-05-1-0371 TITLE: The Role of Src in Mammary Epithelial Tumorigenesis PRINCIPAL INVESTIGATOR: Leonard Kusdra, Ph.D. CONTRACTING ORGANIZATION: The University of California Berkeley,

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

Molecular principles of cancer invasion and metastasis (Review)

INTERNATIONAL JOURNAL OF ONCOLOGY 34: 881-895, 2009 881 Molecular principles of cancer invasion and metastasis (Review) MATHIAS FELIX LEBER 1 and THOMAS EFFERTH 2 1 University of Mainz, Mainz; 2 German

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

3D in vitro modelling using material from the Breast Cancer Now Tissue Bank

@QMBCI bartscancerinstitute 3D in vitro modelling using material from the Breast Cancer Now Tissue Bank Richard Grose Barts Cancer Institute Ed Carter Normal Breast Architecture Calponin / CK8 Myoepithelial

Supplementary Information and Figure legends

Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

TITLE: Hyaluronan-CD44 Interactions Decrease the Metastatic Potential of Breast Cancer Cells

Award Number: W81XWH-06-1-0455 TITLE: Hyaluronan-CD44 Interactions Decrease the Metastatic Potential of Breast Cancer Cells PRINCIPAL INVESTIGATOR: Jose I. Lopez CONTRACTING ORGANIZATION: The University

A Specific Inhibitor of TGF-B Receptor Kinase, SB , as a Potent Antitumor Agent for Human Cancers 1

RESEARCH ARTICLE Neoplasia. Vol. 7, No. 5, May 2005, pp. 509 521 509 www.neoplasia.com A Specific Inhibitor of TGF-B Receptor Kinase, SB-431542, as a Potent Antitumor Agent for Human Cancers 1 Sunil K.

SOLUBLE E-CADHERIN AS A MICROENVIRONMENTAL FACTOR WHICH ENHANCES TUMOR PROGRESSION. Pratima U. Patil

SOLUBLE E-CADHERIN AS A MICROENVIRONMENTAL FACTOR WHICH ENHANCES TUMOR PROGRESSION by Pratima U. Patil A dissertation submitted to the Faculty of the University of Delaware in partial fulfillment of the

Apoptosis inhibitor 5 increases metastasis via Erk-mediated MMP expression

BMB Reports BMB Rep. 2015; 48(6): 330-335 www.bmbreports.org Apoptosis inhibitor 5 increases metastasis via Erk-mediated MMP expression Kwon-Ho Song 1,3,#, Seok-Ho Kim 2,#, Kyung Hee Noh 1,3,#, Hyun Cheol

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

Animal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari

Animal Tissue Culture SQG 3242 Biology of Cultured Cells Dr. Siti Pauliena Mohd Bohari The Culture Environment Changes of Cell s microenvironment needed that favor the spreading, migration, and proliferation

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

Regulation of EMT by TGFb in cancer

FEBS Letters 586 (2012) 1959 1970 journal homepage: www.febsletters.org Review Regulation of EMT by TGFb in cancer Carl-Henrik Heldin a,, Michael Vanlandewijck a, Aristidis Moustakas a,b a Ludwig Institute

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis

SUPPLEMENTARY INFORMATION

b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for more deaths than both cervical and endometrial tumours.

The role of microrna in metastatic processes of non-small cell lung carcinoma

The role of microrna in metastatic processes of non-small cell lung carcinoma Zuzana Pastorkova a, Jozef Skarda a, Jozef Andel b Background. MicroRNAs are small non-coding one-stranded RNA molecules that

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

Biol403 MAP kinase signalling

Biol403 MAP kinase signalling The mitogen activated protein kinase (MAPK) pathway is a signalling cascade activated by a diverse range of effectors. The cascade regulates many cellular activities including

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing

IN VIVO ANALYSIS OF THE ROLE OF TENASCIN-C IN TUMORIGENESIS

IN VIVO ANALYSIS OF THE ROLE OF TENASCIN-C IN TUMORIGENESIS Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Fakultät der

Prostaglandin E 2 reduces radiation-induced epithelial apoptosis through a mechanism involving AKT activation and bax translocation

Research article Prostaglandin E 2 reduces radiation-induced epithelial apoptosis through a mechanism involving AKT activation and bax translocation Teresa G. Tessner, Filipe Muhale, Terrence E. Riehl,

Intercellular indirect communication

Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter

Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma.

Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma Lajos István Nagy Ph.D thesis summary Supervisor: László Puskás, PhD, DSc Scientific

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer?

Should the tumor necrosis factor (TNF) pathway be activated or silenced in the treatment of triple-negative breast cancer? Sonja Kesselmans. S2242362. Bachelorscriptie. 20-06-2014 Supervisor: Marcel van

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation

Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:

A holistic approach to targeting breast cancer part II: Micronutrient synergy. Presented by: Dr. Neha Shanker DRRI

A holistic approach to targeting breast cancer part II: Micronutrient synergy Presented by: Dr. Neha Shanker DRRI Overview of the previous webinar In the last presentation we talked about: Increase in

Rearrangements of the Actin Cytoskeleton and E-Cadherin Based Adherens Junctions Caused by Neoplasic Transformation Change Cell Cell Interactions

Rearrangements of the Actin Cytoskeleton and E-Cadherin Based Adherens Junctions Caused by Neoplasic Transformation Change Cell Cell Interactions Dmitry V. Ayollo., Irina Y. Zhitnyak., Jury M. Vasiliev,

The crosstalk between p38 and Akt signaling pathways orchestrates EMT by regulating SATB2 expression in NSCLC cells

706212TUB0010.1177/1010428317706212Tumor BiologyKucuksayan and Akca research-article20172017 Original Article The crosstalk between p38 and Akt signaling pathways orchestrates EMT by regulating SATB2 expression

Supplementary Figures

Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human