Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
|
|
|
- Roberta Cameron
- 6 years ago
- Views:
Transcription
1 Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D
2 Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance?
3 Can the use of Genomic Technology enable Superior Product Development?
4 What Do We Know About Causes of Aging? Extrinsic and Intrinsic Smoking Sun Pollution Lifestyle Stress Hormones Genes Ethnicity Biological clock
5 Its not just about skin aging
6 Genes and Genomics
7 What Are Genes? Genes are units of heredity carrying genetic information such as the sequence of amino acids for a protein Inherited from parents Located on chromosomes
8 Cell Nucleus Genetic Material: DNA (stored on chromosomes)
9 DNA, GENES 1953: Structure 2003: Sequence 1953: James Watson and Francis Crick present the structure of DNA 2003: The Human Genome map is completed
10 In 2003, all the gene sequences were published = Human Genome 20,000 25,000 genes form the human genome
11 Genes in Common With Other Organisms Genes are shared with other species Gene may not have exact same code, but function is similar Traces of ancient genes
12 Percent in Common with Humans 98% 90% 21% Species
13 In 2003, all the gene sequences were published = Human Genome tgactgccaatttgccaataccaattattgggggaatatgcccaatatatgcc cgagaccagtattatgactgccaatttgccaataccaattttggcgactgga atatgcccaatatatgcccgagaccagtattatgactgccaatttgccaata ccaattttggacgaatatgcccaatatatgcccgagaccagtattatgactg ccaatttgccaataccaattttgggtgaatatgcccaatatatgcccgagac cagtattatgactgccaatttgccaataccaattattgggggaatatgcccaa tatatgcccgagaccagtattatgactgccaatttgccaataccaattttggc gactggaatatgcccaatatatgcccgagaccagtattatgactgccaattt gccaataccaattttggacgaattatatgcccgagaccagtattatgactgc caatttgccaataccaattttggacgaatatgcccaatatatgcccgagacc agtattatgactgccaatttgccaataccaattttgggtgaatatgcccaatat atgcccgagaccagtattatgactgccaatttgccaataccaattattgggg gaatatgcccaatatatgcccgagaccagtattatgactgccaatttgccaa taccaattttggcgactggaatatgcccaatatatgcccgagaccagtattat gactgccaatttgccaataccaattttggacgaatatgcccaatatatgccc gagaccagtattatgactgccaatttgccaataccaattttgggtgaatatgc ccaatatatgcccgagaccagtattatgactgccaatttgccaataccaatt attgggggaatatgcccaatatatgcccgagaccagtattatgactgccaat ttgccaataccaattttggcgactggaatatgcccaatatatgcccgagacc agtattatgactgccaatttgccaataccaattttggacgaatatgcccaatat atgcccgagaccagtattatgactgccaatttgccaataccaattttgggtga atatgcccaatatatgcccgagaccagtattatgactgccaatttgccaata ccaattattgggggaatatgcccaatatatgcccgagaccagtattatgact gccaatttgccaataccaattttggcgac.. 3 billion base pairs.
14 How do genes influence skin appearance?
15 How does this information influence cell structure, function, phenotype? Gene sequence varies Polymorphisms (SNPs) Mutations Either inherited or acquired Can lead to profound consequences
16 Eg. 1
17 Eg. 2: In skin, SNPS in filaggrin have been an area of great interest Genetic predisposition Dry skin Eczema or psoriasis Polymorphisms vary between different ethnic groups
18 Eg. 3: In skin, SNPS and aging (Verkotter et al, 2010, JID 130, s60) 400 females 70-80y Identified SNPs in genes significantly associated with an aged phenotype (wrinkles and age spots) Eg. Wrinkles: SNPs in MMP-1could be protective ie. less wrinkles Eg. Age spots: SNPs in melanin synthesis (MC1R, TYR, TYRP-1, TPCN-2) predisposed to more age spots Eg. SNP in DNA repair enzyme XPD was protective against UV-induced spot formation Genetic polymorphisms and genetic susceptibilities are relevant in predisposing to extrinsic aging Question remains how do we use this for product development?
19 How does this information influence cell structure, function, phenotype? Gene sequence Published in 2003 Variations result in phenotype difference Less tractable Gene expression
20 Gene Expression: The Central Dogma of Molecular Biology DNA information copied into mrna Proteins synthesized using the information in mrna
21 Genes are expressed differently
22 In skin, gene expression patterns have been investigated relative to aging Development of enabling technologies Elucidate differences in young and old skin Investigate effect of actives on gene expression
23 Development of Enabling Technologies Latest genetic tools: DNA microarray or gene chip, RT-PCR, bioinformatics etc Gene expression information for the entire human genome obtainable
24 Methodology Accessible: Changes in Gene Expression Can be Evaluated RNA 1. Elucidate differences in young and old skin 2. Investigate effect of actives on gene expression
25 Challenge for Product Development Distilling data to something usable for product development
26 Genes Expression Influenced by Topical Application of Product UV Protection Pigmentation 7% Hydration 6% 6% Antioxidant 9% DNA Repair 6% Cellular Turnover 15% Skin Structure 21% Inflammatory Response 23% Classified by function cdna microarray data 140 gene changes reported in skin Up and Down regulated 2 fold change compared to untreated Barrier Repair 7%
27 1. Elucidate Differences in Skin
28 Age-Related Changes in Gene Expression Old Arm / Young Buttock Old Arm / Old Buttock Young Arm / Young Buttock Old Arm / Young Arm Old Butt / Young Butt
29 Age-Related Changes in Gene Expression Intrinsic aging & photoaging associated with down-regulation of epidermal differentiation Intrinsic aging & photoaging associated with down-regulation of wound healing Photoaging associated with up-regulation of immune responses Bennett et al., JID 2008, 13, Log 2-fold changes in gene expression
30 2. Investigate Effect of Actives on Gene Expression
31 Examples of Products
32 How does this information influence cell structure, function, phenotype? Gene sequence varies Gene expression patterns vary Epigenetics
33 Epigenetics is a new area Genes are not the whole story Above the genome Unique control mechanisms determine cell fate heart, muscle, hair Molecular switches sirna, methylation, acetylation
34
35 Methyl groups silence gene expression
36 Epigenetics These mice have the exact same genes
37 Rice and Soy reversed negative impact of dietary BPA Proc Natl Acad Sci U S A Aug 7;104(32): Epub 2007 Aug 1. Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Dolinoy DC, Huang D, Jirtle RL.
38 Yellow shows where the twins have similar gene regulation. Red and Green indicate differences (up and down regulation).
39 Genes influence skin appearance by Gene sequence varies Gene expression patterns vary Epigenetic phenomenon
40 Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance?
41 END
Nature vs nurture: Epigenetics
Nature vs nurture: Epigenetics What is epigenetics? Epigenetic processes control whether a gene is switched on or off (gene expression), without altering the underlying DNA sequence They include modifications
Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
Albinism: From genotype to phenotype
Albinism: From genotype to phenotype Phenotype: What does a person with albinism look like? Oculocutaneous albinism is a group of conditions that affect coloring (pigmentation) of the skin, hair, and eyes.
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics
Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects
Gene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
Notes 7.5: Mitosis Gone Wrong
Notes 7.5: Mitosis Gone Wrong Central Dogma Review Information to make a protein is stored in a gene Gene: Segment of DNA that codes for a protein Proteins are used for: growth of tissue and organs, energy,
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called
DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called chromosomes. We have 23 pairs of chromosomes (for a total
The Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
Predisposition of Melanoma
Predisposition of Melanoma Nelleke Gruis Department of Dermatology Leiden University Medical Center The Netherlands OCTOBER 27TH 2017 Melanoma Risk Factors? Melanoma Predisposition 10% familial Manolio
3. What law of heredity explains that traits, like texture and color, are inherited independently of each other?
Section 2: Genetics Chapter 11 pg. 308-329 Part 1: Refer to the table of pea plant traits on the right. Then complete the table on the left by filling in the missing information for each cross. 6. What
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Website: websites.rcc.edu/halama Lecture 1 Self-Evaluation and Healthy Change
Website: websites.rcc.edu/halama Lecture 1 Self-Evaluation and Healthy Change 2 1 Lecture 1 1. Health vs. Wellness 2. DNA and Genes 3. Inheritance 4. Lifestyle Health Choices 5. Public Health 3 Health
Biol115 The Thread of Life"
Biol115 The Thread of Life" Lecture 9" Gene expression and the Central Dogma"... once (sequential) information has passed into protein it cannot get out again. " ~Francis Crick, 1958! Principles of Biology
Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
Ch. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
Epigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
An epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
Genetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
Chapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins?
WHAT WILL YOU KNOW? What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins? How could a person have the gene for something that is never apparent?
Gene Expression. From a gene to a protein
Gene Expression From a gene to a protein Central Dogma (Crick 1958) Determines the genetic flow of information Central Dogma First step in decoding a genetic message from DNA is to copy (transcribe) it
ACB Bio-Chelate 5 PF. Skin & Hair Conditioning, Nourishing. Tomorrow s Vision Today!
ACB Bio-Chelate 5 PF Skin & Hair Conditioning, Nourishing Tomorrow s Vision Today! ACB Bio-Chelate 5 PF *20339PF ACB Bio-Chelate 5 PF Product Code: 20339PF INCI Name: Water & Saccharomyces/Zinc Ferment
Phenylketonuria (PKU) the Biochemical Basis. Biol 405 Molecular Medicine
Phenylketonuria (PKU) the Biochemical Basis Biol 405 Molecular Medicine PKU a history In 1934 Følling identified a clinical condition - imbecillitas phenylpyruvica. Mental retardation associated with this
Non-Ablative Rejuvenation
Non-Ablative Rejuvenation Denise Baker, MD Non-Ablative Skin Rejuvenation Denise Baker, MD The following potential conflict of interest relationships are germane to my presentation. Intrinsic Aging Inevitably
LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
Complex Traits Activity INSTRUCTION MANUAL. ANT 2110 Introduction to Physical Anthropology Professor Julie J. Lesnik
Complex Traits Activity INSTRUCTION MANUAL ANT 2110 Introduction to Physical Anthropology Professor Julie J. Lesnik Introduction Human variation is complex. The simplest form of variation in a population
Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
Chapter 4 Genetics and Cellular Function. The Nucleic Acids (medical history) Chromosome loci. Organization of the Chromatin. Nucleotide Structure
Chapter 4 Genetics and Cellular Function The Nucleic Acids (medical history) Nucleus and nucleic acids Protein synthesis and secretion DNA replication and the cell cycle Chromosomes and heredity Organization
Cell Biology and Cancer
Name: Cell Biology and Cancer Date: Questions 1. BRCA1 and BRCA2 are what types of genes? 2. List two ways that cancerous and healthy cells differ. 3. Which organelle makes proteins? 4. At what phase of
Yeast Essence Skin Care Actives. Yeast Essence C90 Yeast Essence E100 Yeast Essence N80 Yeast Essence Z20. Angel Yeast Co., Ltd.
Yeast Essence Skin Care Actives Yeast Essence C90 Yeast Essence E100 Yeast Essence N80 Yeast Essence Z20 Angel Yeast Co., Ltd. Yeast Essence C90 Proposed INCI name: Sodium carboxymethyl beta glucan, water
Breast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie
LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men
Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
General Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
Regulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
Individualising the Diet for Obesity based on Genetic Testing
Individualising the Diet for Obesity based on Genetic Testing Marilyn Glenville PhD Former President, Food and Health Forum, The Royal Society of Medicine Personalised Nutrition Personalised nutrition
INVESTIGATIVE CONSULTATION AND SKIN ASSESSMENT. CASE STUDIES For each of the clients described, interpret the information given in terms of:
1 INVESTIGATIVE CONSULTATION AND SKIN ASSESSMENT CASE STUDIES For each of the clients described, interpret the information given in terms of: The anticipated skin conditions Possible causes and influences
Introduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
Vice - rector for scientific research of Samarkand State Medical Institute Shukhrat Yusupov
STUDY THE INTERACTION BETWEEN GENE POLYMORPHISMS, ETHNIC-SPECIFIC GENETIC BACKGROUNDS AND ENVIRONMENTAL CONTRIBUTIONS TO CHRONIC OBSTRUCTIVE PULMONARY DISEASE OCCURRENCE IN UZBEKISTAN Vice - rector for
ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION
ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004
Lifestyle and aneuploidy: Is there a correlation?
Lifestyle and aneuploidy: Is there a correlation? Helen Tempest htempest@fiu.edu Chromosome aneuploidy Hallmark of human reproduction Leading cause: Pregnancy loss ~60-80% of conceptions ~4% clinically
Asexual Reproduction & Cancer
Asexual Reproduction & Cancer Asexual Reproduction Only one individual needed No new genetic material added = organism clones itself Reproduction is fast and produces many individuals Gene pool is shallow
DNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Human Genetics (Learning Objectives)
Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,
Impact of Sleep on Skin Aging and other Dermatologic Conditions
Impact of Sleep on Skin Aging and other Dermatologic Conditions Elma (Chat) D. Baron, MD Professor, Dermatology UPMASA Annual Convention July 2017 Albany, New York 1 Disclosures Research contracts Novartis
ACB Bio-Chelate 5 PF. Skin & Hair Conditioning, Nourishing. Tomorrow s Vision Today!
ACB Bio-Chelate 5 PF Skin & Hair Conditioning, Nourishing Tomorrow s Vision Today! ACB Bio-Chelate 5 PF Technical Information Product Code: 20339PF INCI Name: Water & Saccharomyces/Zinc Ferment & Saccharomyces/Copper
CHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
MicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.
Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically
Dimensions of Wellness :
Chapter 1: Self, Family, and Community Dimensions of Wellness : Health and Wellness Health: state of complete physical, mental, social, and spiritual well-being Wellness: process of adopting patterns of
Chapter 1. Self, Family, and Community
Chapter 1 Self, Family, and Community 1 Dimensions of Wellness 2 Health and Wellness Health: state of complete physical, mental, social, and spiritual well-being Wellness: process of adopting patterns
1.2 Genes: Answers and Questions
1.2 Genes: Answers and Questions https://www.youtube.com/watch?v=ubq4eu_tdfc The Nucleus: control centre of the cell The nucleus contains the master set of instructions that determines: what each cell
Cell Cycle Notes --PreAP
Cell Cycle Notes --PreAP I. DNA Deoxyribonucleic acid; located in nucleus A. Long and thread-like DNA in a non-dividing cell B. Thick, short, coiled doubled DNA in a dividing cell chromosome 1. chromosome
Human Genome: Mapping, Sequencing Techniques, Diseases
Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer
Melanin 6/22/2009. Group of compounds that serves predominantly as pigment.
Tessa Sinnige Liliana Joachín-Rodríguez Directed by: David Egan Melanin Group of compounds that serves predominantly as pigment. Pheomelanin (red/yellow) * Eumelanin (brown/black) * Neuromelanin (dark
DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
Outline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018
Fitting Nutrition into Your Genes, Ph.D., R.D. Human Nutrition The Ohio State University Outline I. History (abridged) of the Study of Genetics and Nutrition II. The Skinny on Fats & Genes III. How Dietary
Genomics Up Close And Personal: What Are The Implications For Cancer Nursing? Candy Cooley Head of Education
Genomics Up Close And Personal: What Are The Implications For Cancer Nursing? Candy Cooley Head of Education Aims of this session Understand how genomic information will change your clinical practice Remind
Mitosis and the Cell Cycle
Mitosis and the Cell Cycle Chapter 12 The Cell Cycle: Cell Growth & Cell Division Where it all began You started as a cell smaller than a period at the end of a sentence Getting from there to here Cell
L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza
L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza del DNA. Epigenome provides instructions and regulates
e n ta d i n e Photoprotection Anti-photoaging the most natural way to reinforce skin natural defenses against outdoor and indoor radiations
eno p r e se rvativ e n ta d i n e Photoprotection Anti-photoaging the most natural way to reinforce skin natural defenses against outdoor and indoor radiations Anti-oxidation Anti-inflammation Anti-immunosuppression
Eukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
SHAW ACADEMY NOTES. Diploma in Beauty
SHAW ACADEMY NOTES Diploma in Beauty Diploma in Personal Beauty Lesson 4 - The Role of Lifestyle in Premature Aging Top five factors for premature ageing 1. Lifestyle & Premature Aging how we live our
Epigenetic Variation in Human Health and Disease
Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding
Developing Better Medicine
SURF 2013 Marietta L. Harrison, PhD Director, Oncological Sciences Center in Discovery Park Professor, Medicinal Chemistry and Molecular Pharmacology How we do it today One size fits all Medicines aren
Cell Size Limitations
Cell Size Limitations Cells come in a wide variety of sizes and shapes. Considering this wide range of cells sizes, why then can t most organisms be just one giant cell? Diffusion limits cell size Although
Chapter 6 Heredity The Big Idea Heredity is the passing of the instructions for traits from one generation to the next.
Chapter 6 Heredity The Big Idea Heredity is the passing of the instructions for traits from one generation to the next. Section 1 Mendel and His Peas Key Concept The work of Gregor Mendel explains the
PRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.
PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available
Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis
5/17/13 Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis Johannes Kratz, MD Post-doctoral Fellow, Thoracic Oncology Laboratory
Beauty from the Inside Out
Beauty from the Inside Out Brooke Erickson, MS, CN 6 KEYS TO HEALTHY GLOWING SKIN American s spend billions of dollars a year on products, treatments, and cosmetic procedures to fight the signs of aging
Biology 12. Mendelian Genetics
Mendelian Genetics Genetics: the science (study) of heredity that involves the structure and function of genes and the way genes are passed from one generation to the next. Heredity: the passing on of
Part I: The Cell Cycle
Cellular Differentiation Part I: The Cell Cycle During your lifetime, trillions of your cells will undergo the cell cycle. This process allows you to grow, heal, and maintain your vital tissues and organs.
Lesson 4A Chromosome, DNA & Gene
Lesson 4A Chromosome, DNA & Gene Chromosome, Gene and DNA Chromosome: A thread-like structure made mostly of DNA Found in the nucleus Chromosome, Gene and DNA DNA: Deoxyribonucleic acid Materials found
3.0 DNA is the Inherited Material Responsible for Variation
2.2 Asexual and Sexual Reproduction Homework: p. 29 #1-3 p. 36 #1-6 Create a table that looks like this: Read pages 35-36 and fill in your table. Asexual Reproduction Sexual Reproduction Advantages Disadvantages
GENDER James Bier
GENDER 2005-2008 James Bier Objectives 1. State the method of determining gender in several genetic systems. 2. List the three regions of the Y chromosome. 3. Describe the events that promote sexual development
Single SNP/Gene Analysis. Typical Results of GWAS Analysis (Single SNP Approach) Typical Results of GWAS Analysis (Single SNP Approach)
High-Throughput Sequencing Course Gene-Set Analysis Biostatistics and Bioinformatics Summer 28 Section Introduction What is Gene Set Analysis? Many names for gene set analysis: Pathway analysis Gene set
Introduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
Methylation. Taking the guesswork out of diagnosis. Proper functioning of the methylation cycle helps to reduce the risk of:
Methylation The methylation cycle is a biochemical pathway that manages or contributes to a wide range of crucial bodily functions. Methylation is not just one specific reaction, there are hundreds of
Section Chapter 14. Go to Section:
Section 12-3 Chapter 14 Go to Section: Content Objectives Write these Down! I will be able to identify: The origin of genetic differences among organisms. The possible kinds of different mutations. The
Genetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
Searching for the Cause of Autism:
Searching for the Cause of Autism: How genetics and social experience may intersect Dr Lane Strathearn, MBBS FRACP PhD Professor, Department of Pediatrics, University of Iowa Physician Director, Center
Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions
Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions John Milner, Ph.D. Director, USDA Beltsville Human Nutrition Research Center Beltsville, MD 20705 john.milner@ars.usda.gov
Workshop. Factors influencing food intake? How decrease food choice related morbidity/mortality
Workshop Factors influencing food intake? How decrease food choice related morbidity/mortality Modifiable behavioral traits? Strength /weakness Limits to success of interventions? Describe current research
Epigenetics in evolution and disease
Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger
Investigation of Genomic Imprinting in the X- linked Transketolase-like Protein 1 (TKTL1) in Human and the Implications for Autism
University of Connecticut DigitalCommons@UConn Honors Scholar Theses Honors Scholar Program Spring 5-1-2015 Investigation of Genomic Imprinting in the X- linked Transketolase-like Protein 1 (TKTL1) in
Epigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
Genetic Testing for Familial Cutaneous Malignant Melanoma
MP 2.04.33 Genetic Testing for Familial Cutaneous Malignant Melanoma Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013
Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
Each Tablet Contains: Supportive Function: When is Methyl Renew helpful? Clinical Applications/Research: Methylation DNA Methylation
methyl renew Each Tablet Contains: Niacin (as niacinamide) 20 mg, Folate (as L-5-Methyltetrahydrofolate) 500 mcg, Vitamin B-12 (as methylcobalamin) 500 mcg, Biotin 2000 mcg. Proprietary blend 415 mg* of:
Human Genetics 542 Winter 2018 Syllabus
Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis