Epigenetics and Cancer

Size: px
Start display at page:

Download "Epigenetics and Cancer"

Transcription

1 Epigenetics and Cancer Ya-Hui Chi March 24, Institute of Biotechnology and Pharmaceutical Research, NHRI, Zhunan, Taiwan Question 1: What causes cancer? Douglas Hanahan and Robert A. Weinberg 2 1

2 The Genetic Code and the Epigenetic Code 3 Stem cell therapy Self-renewal vs. Pluripotency Question 1: Why there are different cell types in an organism with identical gene sequence? ES cells 4 2

3 Changes in genetic sequence during aging? Question 2: Do identical twins have different susceptibility to cancer and other diseases? 5 W. LOVELACE/GETTY British gangster Ronnie Kray (right) was bisexual, unlike his twin, Reggie (left). The disparity could be down to epigenetics. 3

4 Cancer susceptibility among twins Brest cancer Hereditary 29% Mendelian diseases vs. Ovarian cancer Non-Mendelian diseases Hereditary 22% 7 The double helix and the nucleosome The double helix 8 4

5 Histones and the epigenetic code (Image: Nature 441, (11 May 2006) 9 Epigenetic modification of core histones Epigenetic modifications: Me: Histone methylation Ac: Histone acetylation P: Histone phosphorylation SU: Histone sumoylation Ub: Histone ubiquitination DNA methylation 10 5

6 Nature Reviews Drug Discovery 8, (September 2009) doi: /nrd /3/22 Histone and the epigenetic modification enzymes Acetylation: histone acetyltransferases and deacetylases. Methylation: histone methyltransferases and demethylases, DNA methyltransferases. DNA demethylase? Phosphorylation: kinases. Ubiquitination: Ub ligases. Nature Reviews Drug Discovery 8, (September 2009) 11 6

7 Nature Reviews Drug Discovery 8, (September 2009) doi: /nrd /3/22 Histone and the epigenetic modification enzymes Micro RNA 7

8 Long non-coding RNA Mechanisms of LncRNA action. In numerous tissues, lncrnas (indicated in green) have been shown to regulate gene expression at multiple levels: chromatin, transcription, mrna, translation, and protein. Hematopoietic lncrnas may act at any of these levels. MicroRNA sponge refers to the ability of lncrnas to sequester cellular micrornas and prevent them from binding mrna targets. Chromosome regions with differential DNA methylation in young and old monozygous twins Significant DNA methylation changes are indicated as thick red and green blocks in the ideograms. The 50-year-old twin pair shows abundant changes in the pattern of DNA methylation (green=hypermethylation and red=hypomethylation), 3-year-old twins have a very similar DNA methylation (yellow). (Image Copyright (2005) National 16 Academy of Sciences, U.S.A) 8

9 Histone acetyltransferase (HAT) and histone deacetylase (HDAC) Histone acetyltransferase Histone deacetylase GNAT family GCN5 PCAF HAT1 MYST family MYST1 MYST2 HTATIP p300/cbp family p300 CBP Nuclear receptor coactivators AIB1 General transcription factors TAFII250 Class I HDAC1 HDAC2 HDAC3 HDAC8 Class IIa HDAC4 HDAC5 HDAC7 HDAC9 Class IIb HDAC6 HDAC10 Class III SIRT1 SIRT2 SIRT3 SIRT4 SIRT5 SIRT6 SIRT7 Class IV HDAC11 17 Histone methyltransferase (HMT), histone demethylase and DNA methyltransferase (DNMT) Histone methyltransferase H3K4 MLL SET1 SMYD3 H3K9 SUV39H1 SUV39H2 G9a EuHMT SETDB1/ESET RIZ1 H3K27 EZH2 H3K36 NSD1 SMYD2 Histone demethylase H3K4 LSD1 SMCX / JARID1C SMCY / JARID1D RBP2 / JARID1A PLU1/JARID1B H3K9 JHDM2A (JMJD1A) JMJD2A JMJD2B JMJD2C JMJD2D H3K27 UTX JMJD3 H3K36 JMJD2A JMJD2B JMJD2C FBXL10 / JHDM1B DNA methyltransferase DNMT1 DNMT2 DNMT3A DNMT3B DNMT3L 18 9

10 The histone code hypothesis Strahl BD et al. (2000) Nature 19 Histone Modifying Enzymes Outcome of Gene Expression There are many examples in our everyday lives where common inputs result in differential outcomes, depending on specific control mechanisms. Consider, for example, how a talented musician can produce a wide variety of music on a guitar. A particular piece of music is encoded by the sequence and timing of notes, that are typically transcribed onto sheet music. The guitarist translates the sheet music by spatial and temporal modifications to the guitar strings; that is, he/ she holds down different strings, at different frets, at different times to produce the music (Figure 2A/B). Figure 2 A/B - (A) Music is encoded in the form of notations on sheet music, that define the notes to be played and the tempo at which they are played. (B) A guitarist translates the sheet music into audible music by spatial and temporal control of the guitar strings. In a like manner, gene transcription is spatially and temporally controlled by epigenetic modifications, catalyzed by specific enzymes. 10

11 Dynamic structure of the chromatin in a cycling cell Coordinated recruitment of histone-modifying activities Rosenfeld MG et al. (2006) Gene Dev

12 Nuclear morphology of undifferentiated and differentiated cells undifferentiated (ESC) differentiated Niwa H. (2007) Development Question 3: What are the differences between undifferentiated and differentiated cells in nuclear morphology? 23 Epigenetic Modification and Transcriptional Control Closed chromatin: transcriptionally repressive Open chromatin: transcriptionally active Kristeleit (2004) Expert Opin. Emerg. Drugs 24 12

13 Question 6: Which nucleotide can be methylated? S-adenosylmethionine (SAM) : methylation intermediates 25 DNA demethylation TET: ten eleven translocation TDG: thymine-dna glycosylase C S Nabel, R M Kohli Science 2011;333: Published by AAAS 26 13

14 DNA methylation-induced histone modification for gene silencing 27 Analysis of DNA methylation using bisulphite sequencing

15 Histone Acetylation 29 Acetylation and deacetylation of the lysine residue 30 15

16 Timeline of histone acetylation discovery Lee K. (2007) Nat. Rev. Mol. Cell Bio. 31 Histone acetylation and transcriptional control 32 16

17 Epigenetic gene activation S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH)] : methylation intermediates 33 Epigenetic gene silencing

18 Histone methylation and transcriptional control Niwa H. (2007) Development 35 Epigenetics, Development and Cell Fate Commitment 36 18

19 Epigenetic gene regulation during mammalian development Reik (2007) Nature 37 Phenotypes of mice knocked out for histone modification enzymes Haberland M. (2009) Nat Rev Genetics 38 19

20 Huang S. (2009) BioEssays 39 Pluripotency and the transcriptional regulatory circuitry Jaenisch R. and Young R. (2009) Cell 40 20

21 Nuclear reprogramming genetic code vs. epigenetic code Yamanaga S. (2010) Nature 41 Dolly the sheep

22 Different methods of reprogramming require transcriptional regulators and passage through cell division 43 Egli D. (2008) Nat. Rev. Mol. Cell. Bio

23 45 Bisulfite genomic sequencing of the promoter regions of OCT3/4, REX1, and NANOG in ips cells ips NTERA-2: a human embryonic carcinoma cell line HDF: human dermal fibroblasts Takahashi K. (2007) Cell 46 23

24 The epigenetic mark of embryonic stem cells 47 Epigenetic modification inhibitors enhanced generation efficiency of ips NPC MEFs BIX: Histone methyltransferate G9a inhibitor BayK: a L-channel calcium agonist RG108: a DNMT (DNA methyltransferase) inhibitor 48 24

25 Epigenetic modification inhibitors enhanced generation efficiency of ips + 4 factors 5 -azacytidine (5 -azac): a DNA methyltransferase inhibitor Dexamethasone (dex): a synthetic glucocorticoid, anti-inflammation Valproic acid (VPA): a histone deacetylase inhibitor SAHA: a histone deacetylase inhibitor TSA: a histone deacetylase inhibitor 49 CM+FGF2 SB: sodium butyrate, a HDAC inhibitor +SB, no FGF2 CM+FGF2 +SB no FGF2 With feeder No feeder; on Matrigel 50 25

26 51 Epigenetics and Cancer 52 26

27 Six hallmarks of cancer Epigenetic silencing of tumor suppressor genes (examples in parentheses) plays a significant role in the development of each of these six tumor traits 53 Epigenetic targets in cancer

28 Interaction of TF and epigenetic modification factors Two possible mechanisms by which epigenetic modification can lead to cancer. (A) A previously unmethylated tumor suppressor gene such as p53 becomes methylated. Transcription factor(s) (TF) can no longer bind the promoter region, the gene is not expressed, and damaged cells are allowed to proliferate and become cancerous. (B) A protooncogene is demethylated, allowing TFs to initiate transcription and express the protein product. As in (A), uncontrolled cell growth ensues and leads to cancer. Copyright 2008 Nature Education DNA methylation, gene expression and cancer DNA methylation is normally associated with gene silencing

29 DNA methylation, gene expression and cancer DNA hypomethylation and aberrant gene activation in cancer 57 DNA methylation, gene expression and cancer DNA hypermethylation and aberrant gene silencing in cancer

30 Histone acetylation, Figure 1 Epigenetic gene gene expression silencing in cancer. and cancer Histone acetylation is normally associated with gene activation Yoo CB and Jones PA (2006) Epigenetic therapy of cancer: past, present and future Nature Reviews Drug Discovery 5: doi: /nrd The epigenetic progenitor model of cancer tumor-suppressor gene (TSG) tumor-progenitor genes (TPG) gatekeeper mutation (GKM) oncogene (ONC) Feinberg AP et al. (2005) The epigenetic progenitor origin of human cancer Nat Rev gene. 7: doi: /nri

31 The epigenetic progenitor model of cancer crypt paneth 61 Age-dependent DNA methylation and cancer 62 31

32 Epigenetic Therapy 63 Epizyme 8?autoplay=1&rel=0&enablejsapi=1&playe rapiid=ytplayer 64 32

33 Therapeutic targeting of the hallmarks of cancer Douglas Hanahan and Robert A. Weinberg 65 From Epigenomics: Roadmap for regulation 518, (19 February 2015) doi: /518314a The Roadmap Epigenomics Project has produced reference epigenomes that provide information on key functional elements controlling gene expression in 127 human tissues and cell types 2, 3, 4, 5, 6, 7, 8, 9, and encompassing embryonic and adult tissues, from healthy individuals and those with disease. a, Many of the adult tissues investigated were broken down by cell type or region blood into several types of immune cell, for instance, and the brain into regions including the hippocampus and dorsolateral prefrontal cortex. Tissue samples and cells were subjected to a range of epigenomic analyses, along with genome sequencing and genome-wide association studies (GWAS). b, Embryonic stem (ES) cells, which are taken from the embryo at the 'blastocyst' stage and can give rise to almost every cell type in the body, were used to analyse, for example, the differentiation of stem cells into different neuronal lineages. The ES-cell-derived cell lines underwent the same epigenomic analyses as the tissue samples. 33

34 318 NATURE VOL FEBRUARY 2015 Data sets available for each reference epigenome 34

35 Hypermethylated genes commonly used for cancer detection Carins P. (2007) Nat. Rev. Cancer

36 72 Haberland M. (2009) Nat Rev Genetics 36

37 Hypermethylated genes commonly used for cancer detection Carins P. (2007) Nat. Rev. Cancer 73 HDAC inhibitors for cancer therapy 74 37

38 HDAC inhibitors for cancer therapy Kristensen L. (2009) Eur. J. Pharm. 75 DNMT inhibitors for cancer therapy Kristensen L. (2009) Eur. J. Pharm

39 H2AX inducers for cancer therapy Bonner W. (2008) Nat. Rev. Cancer 77 Tumour-selective action of HDACi in acute promyelocytic leukaemia

40 Discussion

41 81 41

Lecture 8. Eukaryotic gene regulation: post translational modifications of histones

Lecture 8. Eukaryotic gene regulation: post translational modifications of histones Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation

More information

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON ... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

Gene Expression DNA RNA. Protein. Metabolites, stress, environment

Gene Expression DNA RNA. Protein. Metabolites, stress, environment Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory

More information

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Are you the way you are because of the

Are you the way you are because of the EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders

More information

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1 Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos

More information

Histones modifications and variants

Histones modifications and variants Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome

More information

Epigenomics. Ivana de la Serna Block Health Science

Epigenomics. Ivana de la Serna Block Health Science Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications

More information

Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc

Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc P. Matthias, 16 April 2014 DNA methylation basics Acetylation Acetyltransferases/Deacetylases

More information

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII

More information

Chromatin-Based Regulation of Gene Expression

Chromatin-Based Regulation of Gene Expression Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism

More information

Epigenetics ~from mechanism to therapy~ Literature seminar January 31, 2012 Soichi Ito (B4)

Epigenetics ~from mechanism to therapy~ Literature seminar January 31, 2012 Soichi Ito (B4) Epigenetics ~from mechanism to therapy~ Literature seminar January 31, 2012 Soichi Ito (B4) 1 Contents Introduction Central dogma What is the Epigenetics? Topics 1. DNA methylation 2. Histone modification

More information

Epigenetic Inheritance

Epigenetic Inheritance (2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)

More information

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module-9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 6 Epigenetics

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

The silence of the genes: clinical applications of (colorectal) cancer epigenetics

The silence of the genes: clinical applications of (colorectal) cancer epigenetics The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical

More information

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,

More information

Eukaryotic transcription (III)

Eukaryotic transcription (III) Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids

More information

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches

More information

Epigenetics q&more 01.11

Epigenetics q&more 01.11 Laurie. Knight, istockphoto.com Epigenetics 6 Bookmarks About the reading of genes in the Book of Life Prof. Dr. Manfred Jung, Julia M. Wagner, Institute for Pharmaceutical Sciences, Albert-Ludwig-University

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

TMEFF2 is an epigenetic modulator that promotes androgen independent growth in castrationresistant. prostate cancer cells. Joshua Corbin.

TMEFF2 is an epigenetic modulator that promotes androgen independent growth in castrationresistant. prostate cancer cells. Joshua Corbin. TMEFF2 is an epigenetic modulator that promotes androgen independent growth in castrationresistant prostate cancer cells by Joshua Corbin August, 2014 Director of Thesis: Maria Ruiz-Echevarria, Ph.D. Major

More information

Expert Intelligence for Better Decisions Epigenetics:

Expert Intelligence for Better Decisions Epigenetics: Expert Intelligence for Better Decisions Epigenetics: Emerging Targets, Available Technologies, Expert Interviews, and an Epigenetic Community Perspective Using This Document Insight Pharma Reports are

More information

DNA Methylation and Cancer

DNA Methylation and Cancer DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000

More information

DNA and Histone Methylation in Learning and Memory

DNA and Histone Methylation in Learning and Memory EXPERIMENTAL BIOLOGY ANNUAL MEETING April 2010 DNA and Histone Methylation in Learning and Memory J. David Sweatt Dept of Neurobiology McKnight Brain Institute UAB School of Medicine The Molecular Basis

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Transcriptional and post-transcriptional regulation of telomerase reverse transcriptase (htert) expression. Zheng Ge 葛峥

Transcriptional and post-transcriptional regulation of telomerase reverse transcriptase (htert) expression. Zheng Ge 葛峥 Division of Hematology, Department of Medicine Karolinska Institutet, Stockholm, Sweden Transcriptional and post-transcriptional regulation of telomerase reverse transcriptase (htert) expression The role

More information

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during

More information

Changes in DNA methylation and histone modification during epigenetic transitions

Changes in DNA methylation and histone modification during epigenetic transitions Oregon Health & Science University OHSU Digital Commons Scholar Archive May 2009 Changes in DNA methylation and histone modification during epigenetic transitions Jon Andrew Oyer Follow this and additional

More information

Unique, expert portfolio

Unique, expert portfolio EPIGENETICS Enzymes Kits Cell Lines Screening Services INNOVATIVE PRODUCTS TO FUEL YOUR EXPERIMENTS Unique, expert portfolio www.bpsbioscience.com HISTONE METHYLTRANSFERASES HISTONE DEMETHYLASES ACETYLTRANSFERASES

More information

Title: Resetting the epigenome for heart regeneration. Author: Gregory A. Quaife-Ryan Choon Boon Sim Enzo R. Porrello James E.

Title: Resetting the epigenome for heart regeneration. Author: Gregory A. Quaife-Ryan Choon Boon Sim Enzo R. Porrello James E. Accepted Manuscript Title: Resetting the epigenome for heart regeneration. Author: Gregory A. Quaife-Ryan Choon Boon Sim Enzo R. Porrello James E. Hudson PII: S1084-9521(15)30035-5 DOI: http://dx.doi.org/doi:10.1016/j.semcdb.2015.12.021

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:

More information

DNA methylation & demethylation

DNA methylation & demethylation DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not

More information

Epigenetic Mechanisms

Epigenetic Mechanisms RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of

More information

Epigenetics & cancer. Present by : Sanaz Zebardast Under supervision : Dr. Gheibi. 31 December 2016

Epigenetics & cancer. Present by : Sanaz Zebardast Under supervision : Dr. Gheibi. 31 December 2016 Epigenetics & cancer Present by : Sanaz Zebardast Under supervision : Dr. Gheibi 31 December 2016 1 contents Introduction Epigenetic & signaling pathways Epigenetic & integral protein Epigenetic & apoptosis

More information

Oncology 520 Epigene0cs and Cancer. February 16, 2011

Oncology 520 Epigene0cs and Cancer. February 16, 2011 Oncology 520 Epigene0cs and Cancer February 16, 2011 Outline What is epigene0cs? What are examples of epigene0c processes? What is the epigenome and how is it decoded? Are epigene0c mechanisms important

More information

The role of epigenetics in breast. cancer progression

The role of epigenetics in breast. cancer progression The role of epigenetics in breast cancer progression Aslı Dilber Yıldırım January 2013 Master thesis, Cancer Genomics & Developmental Biology Under daily supervision of Rick van Nuland, MSc Examiners:

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

Altered Histone Modifications in Gliomas

Altered Histone Modifications in Gliomas REVIEW ARTICLE Brain Tumor Res Treat 2014;2(1):7-21 / pissn 2288-2405 / eissn 2288-2413 http://dx.doi.org/10.14791/btrt.2014.2.1.7 Altered Histone Modifications in Gliomas Young Zoon Kim Division of Neuro-Oncology,

More information

DNA methylation: a potential clinical biomarker for the detection of human cancers

DNA methylation: a potential clinical biomarker for the detection of human cancers DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,

More information

Epigenetics and Colorectal Cancer Pathogenesis

Epigenetics and Colorectal Cancer Pathogenesis Cancers 2013, 5, 676-713; doi:10.3390/cancers5020676 Article OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Epigenetics and Colorectal Cancer Pathogenesis Kankana Bardhan and Kebin Liu

More information

The Institute for Cancer Research Annual Progress Report: 2009 Formula Grant

The Institute for Cancer Research Annual Progress Report: 2009 Formula Grant The Institute for Cancer Research Annual Progress Report: 2009 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The Institute for Cancer Research (formerly Fox Chase Cancer

More information

Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Prokaryotes and eukaryotes alter gene expression in response to their changing environment Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences

More information

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture

More information

Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells

Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie

More information

Epigenetics: A historical overview Dr. Robin Holliday

Epigenetics: A historical overview Dr. Robin Holliday Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Chromatin Structure & Gene activity part 2

Chromatin Structure & Gene activity part 2 Chromatin Structure & Gene activity part 2 Figure 13.30 Make sure that you understand it. It is good practice for identifying the purpose for various controls. Chromatin remodeling Acetylation helps to

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

AGCGGCTGGTGTATGAGG AGCTCGAGCTGCAGGACT AAAGGTGCACTGGTAGCC AGGGCACAAGTGCATGGC CCCGCTGTGCAGAAGTAG

AGCGGCTGGTGTATGAGG AGCTCGAGCTGCAGGACT AAAGGTGCACTGGTAGCC AGGGCACAAGTGCATGGC CCCGCTGTGCAGAAGTAG Supplementary Table S1. Primer sequence information Gene Primer sequence 1 st round PCR 2 nd round PCR Accession# Dnmt3a TCAAGGAGATCATTGATG TGTTCCCACACATGAGCA AGCGGCTGGTGTATGAGG AGCAGATGGTGCAATAGGAC NM_007872.4

More information

IN THE NAME OF GOD CANCER CELL REPROGRAMING

IN THE NAME OF GOD CANCER CELL REPROGRAMING IN THE NAME OF GOD CANCER CELL REPROGRAMING Qazvin university of medical science Presented by: fatane abedy GUIDANCE: Dr. gheibi 1 CONTENT: CANCER REPROGRAMMING OSKM microrna PROBLEM AND ADVANTAGE REFRANCE

More information

EPIGENETICS: A POSSIBLE MECHANISM OF MEMORY Aliza Grossman Rubenstein

EPIGENETICS: A POSSIBLE MECHANISM OF MEMORY Aliza Grossman Rubenstein Epigenetics: a Possible Mechanism of Memory 43 EPIGENETICS: A POSSIBLE MECHANISM OF MEMORY Aliza Grossman Rubenstein INTRODUCTION The mind-body connection has fascinated philosophers and scientists for

More information

Biochimica et Biophysica Acta

Biochimica et Biophysica Acta BBAGRM-00286; No. of pages: 19; 4C: 8, 12 Biochimica et Biophysica Acta xxx (2010) xxx xxx Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbagrm

More information

Abstract. KEY WORDS: epigenetics, DNA methylation, histone modification, one-carbon metabolism, stem cell aging, anti-aging medicine

Abstract. KEY WORDS: epigenetics, DNA methylation, histone modification, one-carbon metabolism, stem cell aging, anti-aging medicine Glycative Stress Research Online edition : ISSN 2188-3610 Print edition : ISSN 2188-3602 Received : May 17, 2018 Accepted : July 18, 2018 Published online : September 30, 2018 doi:10.24659/gsr.5.3_129

More information

Cancer Letters xxx (2012) xxx xxx. Contents lists available at SciVerse ScienceDirect. Cancer Letters

Cancer Letters xxx (2012) xxx xxx. Contents lists available at SciVerse ScienceDirect. Cancer Letters Cancer Letters xxx (2012) xxx xxx Contents lists available at SciVerse ScienceDirect Cancer Letters journal homepage: www.elsevier.com/locate/canlet Mini-review Epigenetic inactivation of DNA repair in

More information

NOVEL HISTONE DEMETHYLASE INHIBITORS SYNERGISTICALLY ENHANCE THE EFFECTS OF A DNA HYPOMETHYLATING AGENT IN BREAST CANCER CELLS. Benjamin R.

NOVEL HISTONE DEMETHYLASE INHIBITORS SYNERGISTICALLY ENHANCE THE EFFECTS OF A DNA HYPOMETHYLATING AGENT IN BREAST CANCER CELLS. Benjamin R. NOVEL HISTONE DEMETHYLASE INHIBITORS SYNERGISTICALLY ENHANCE THE EFFECTS OF A DNA HYPOMETHYLATING AGENT IN BREAST CANCER CELLS By Benjamin R. Leadem A dissertation submitted to The Johns Hopkins University

More information

The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML)

The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Campbell Drohan BIOL 463 December 2016 The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Introduction Epigenetic modifications of DNA and histones are key to gene regulation

More information

Genetic Disorders. SCPA 501: General Pathology. Amornrat Naranuntarat Jensen

Genetic Disorders. SCPA 501: General Pathology. Amornrat Naranuntarat Jensen Genetic Disorders SCPA 501: General Pathology Amornrat Naranuntarat Jensen amornrat.nar@mahidol.ac.th Human has 46 chromosomes (23 pairs) Sex chromosomes Human genome contains approximately 3 billion base

More information

DNA Methylation and Demethylation as Targets for Anticancer Therapy

DNA Methylation and Demethylation as Targets for Anticancer Therapy Biochemistry (Moscow), Vol. 70, No. 5, 2005, pp. 533-549. Translated from Biokhimiya, Vol. 70, No. 5, 2005, pp. 651-669. Original Russian Text Copyright 2005 by Szyf. DNA Methylation and Demethylation

More information

Epigenetic mechanisms behind cellular sensitivity to DNA damage

Epigenetic mechanisms behind cellular sensitivity to DNA damage www.cell-stress.com Review Epigenetic mechanisms behind cellular sensitivity to DNA damage Amanda K. Williamson 1, Zijing Zhu 1 and Zhi-Min Yuan 1, * 1 Department of Environmental Health, John B. Little

More information

Lecture 27. Epigenetic regulation of gene expression during development

Lecture 27. Epigenetic regulation of gene expression during development Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:

More information

Epigenetics: How Nutrients Affect Gene Expression.

Epigenetics: How Nutrients Affect Gene Expression. Epigenetics: How Nutrients Affect Gene Expression. David Heber, MD, PhD, FACP, FASN Professor Emeritus of Medicine and Public Health and Founding Director, UCLA Center for Human Nutrition David Geffen

More information

Cancer Problems in Indonesia

Cancer Problems in Indonesia mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency

More information

Lecture 10. Eukaryotic gene regulation: chromatin remodelling

Lecture 10. Eukaryotic gene regulation: chromatin remodelling Lecture 10 Eukaryotic gene regulation: chromatin remodelling Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation sequences Transcriptional

More information

The role of G9a gene in various cancers

The role of G9a gene in various cancers Health Biotechnology and Biopharma (2017), 1(3): 5-11 Minireview Article The role of G9a gene in various cancers Hassan Taghizadeh 1, Eskandar Taghizadeh 2 * 1 Cellular and Molecular Research Center, Yasuj

More information

Epigenetics in evolution and disease

Epigenetics in evolution and disease Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger

More information

Transcriptional and Epigenetic Mechanisms of Addiction

Transcriptional and Epigenetic Mechanisms of Addiction Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find

More information

Host cell activation

Host cell activation Dept. of Internal Medicine/Infectious and Respiratory Diseases Stefan Hippenstiel Epigenetics as regulator of inflammation Host cell activation LPS TLR NOD2 MDP TRAF IKK NF-κB IL-x, TNFα,... Chromatin

More information

HDAC1 Inhibitor Screening Assay Kit

HDAC1 Inhibitor Screening Assay Kit HDAC1 Inhibitor Screening Assay Kit Catalog Number KA1320 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

An introduction to Epigenetics and Psychology

An introduction to Epigenetics and Psychology An introduction to Epigenetics and Psychology Dr Emma Meaburn e.meaburn@bbk.ac.uk Centre for Brain and Cognitive Development Department of Psychological Sciences Birkbeck, University of London Learning

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/32781 holds various files of this Leiden University dissertation. Author: Benard, Anne Title: Epigenetic prognostic biomarkers in colorectal cancer Issue

More information

Introduction to Cancer Biology

Introduction to Cancer Biology Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.

More information

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)

BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural

More information

H3K27me3 may be associated with Oct4 and Sox2 in mouse preimplantation embryos

H3K27me3 may be associated with Oct4 and Sox2 in mouse preimplantation embryos H3K27me3 may be associated with Oct4 and Sox2 in mouse preimplantation embryos F.-R. Wu, Y. Zhang, B. Ding, X.-H. Lei, J.-C. Huang, C.-H. Wang, Y. Liu, R. Wang and W.-Y. Li School of Biological Science

More information

Transcription and chromatin. General Transcription Factors + Promoter-specific factors + Co-activators

Transcription and chromatin. General Transcription Factors + Promoter-specific factors + Co-activators Transcription and chromatin General Transcription Factors + Promoter-specific factors + Co-activators Cofactor or Coactivator 1. work with DNA specific transcription factors to make them more effective

More information

Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C

Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription

More information

Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome

Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

Genetically Similar, Epigenetically Different

Genetically Similar, Epigenetically Different & For FSHD Research Genetically Similar, Epigenetically Different Peter L. Jones, Ph.D. and Takako I. Jones, Ph.D. Principal Investigators The Wellstone Program Departments of Cell and Developmental Biology

More information

Repression of IP-10 by Interactions between Histone Deacetylation and Hypermethylation in Idiopathic Pulmonary Fibrosis

Repression of IP-10 by Interactions between Histone Deacetylation and Hypermethylation in Idiopathic Pulmonary Fibrosis MOLECULAR AND CELLULAR BIOLOGY, June 2010, p. 2874 2886 Vol. 30, No. 12 0270-7306/10/$12.00 doi:10.1128/mcb.01527-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Repression of

More information

Epigenetics in ovarian cancer: premise, properties, and perspectives

Epigenetics in ovarian cancer: premise, properties, and perspectives Yang et al. Molecular Cancer (2018) 17:109 https://doi.org/10.1186/s12943-018-0855-4 REVIEW Epigenetics in ovarian cancer: premise, properties, and perspectives Open Access Qilian Yang 1, Yuqing Yang 2,

More information

'''''''''''''''''Fundamental'Biology' BI'1101' ' an'interdisciplinary'approach'to'introductory'biology' Five'Levels'of'Organiza-on' Molecular'

'''''''''''''''''Fundamental'Biology' BI'1101' ' an'interdisciplinary'approach'to'introductory'biology' Five'Levels'of'Organiza-on' Molecular' '''''''''''''''''Fundamental'Biology' BI'1101' ' an'interdisciplinary'approach'to'introductory'biology' Anggraini'Barlian,' Iriawa-' Tjandra'Anggraeni' SITH4ITB' Five'Levels'of'Organiza-on' Molecular'

More information

An Overview of the Molecular Basis of Epigenetics

An Overview of the Molecular Basis of Epigenetics C H A P T E R 1 An Overview of the Molecular Basis of Epigenetics J. David Sweatt, 1 Eric J. Nestler, 2 Michael J. Meaney 3 and Schahram Akbarian 4 1 McKnight Brain Institute, Department of Neurobiology,

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

From genetics to epigenetics The world beyond Mendel s laws

From genetics to epigenetics The world beyond Mendel s laws Sapienza University of Rome Master in Medicine and Surgery From genetics to epigenetics The world beyond Mendel s laws What about epigenetics?..the branch of biology which studies the causal interactions

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic

More information

Chapter 11 How Genes Are Controlled

Chapter 11 How Genes Are Controlled Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary

More information

MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A

MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A Heba Alkhatabi, PhD Assistant Professor Department of Medical Laboratory Collage of Applied Medical science King Abdul Aziz

More information

Quantitative profile of lysine methylation and acetylation of histones by LC-MS/MS

Quantitative profile of lysine methylation and acetylation of histones by LC-MS/MS Quantitative profile of lysine methylation and acetylation of histones by LC-MS/MS DISSERTATION zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Fakultät Mathematik

More information