(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
|
|
|
- Giles Brooks
- 6 years ago
- Views:
Transcription
1 Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells treated with various concentrations of Cmp302, Cmp308, and Dev4 for 3 days. Cell survival was determined using an ATP-based luminescence assay. (B) Dose response curves of HMLER_shGFP (blue circle), HMLER_shEcad (red square), and HMLER_Twist (black diamond) cells treated with various concentrations of Cmp302, Cmp308, and Dev4 for 3 days. Cell survival was determined using an ATPbased luminescence assay. (C) Representative fluorescence images of HMLE_shGFP_dsRed and HMLE_Twist_GFP cells mixed in 1:1 ratio and treated with 5 nm paclitaxel, 2 μm Cmp302, 2 μm Cmp308 or DMSO control for 5 days. Scale bar: 50 μm (D) Proportion of HMLE_shGFP_dsRed and HMLE_shEcad_GFP cells that were mixed in a 1:1 ratio and treated with doxorubicin or Dev4 at indicated concentrations for 5 days. (E) Molecular structure of Dev2. (F)Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells treated with various concentrations of Dev2 for 3 days. Cell survival was determined using an ATP-based luminescence assay. (G) Representative fluorescence images of MDA-MB-157 cells either cultured under suspension conditions for 36 h and transferred onto adherent cell culture plates for 24h, 1
2 or maintained in standard adherent cell culture. Cells were stained using FITC-conjugated phalloidin to visualize F-actin fibers. Scale bar: 50 μm. (H) Western blot analysis of epithelial (CK8/18, E-cadherin) and mesenchymal (fibronectin) markers of cell lysates from HMLER_shCtrl, HMLER_Twist and MDA- MB-157 cells grown under either adherent or suspension conditions. (I) Flow cytometric analysis of MDA-MB-157 cells, cultured under either adherent or suspension conditions for 36 h, using CD24 and CD44 antibodies. (J) MDA-MB-157 cells in suspension were treated with increasing concentrations of Cmp308 or paclitaxel for 36 h and analyzed for CD44 and CD24 expression by flow cytometry. The numbers of CD44 hi CD24 lo and CD44 lo CD24 hi cells were quantified and normalized relative to DMSO controls. (K) Dose-response curves of MDA-MB-157 cells cultured under adherent (blue circle) or suspension (red diamond) conditions and treated with specified concentrations of paclitaxel, Cmp302, or Cmp308 for 3 days. Cell survival was determined using an ATPbased luminescence assay. Figure S2. EMT increases sensitivity to ER stressors (A) Western blot analysis of HMLER_shGFP and HMLER_Twist cells treated with vehicle (DMSO) or increasing concentrations of Dev4 or thapsigargin for 12 h and probed for ATF4. (B) Dose-response curves of HMLE_shGFP, HMLE_shEcad, and HMLE_Twist cells treated with increasing concentrations of tunicamycin, thapsigargin, DTT, and A23187 for 3 days. Cell survival was determined using an ATP-based luminescence assay. 2
3 (C) Dose-response curves of Panc1cells, pretreated with or without10 ng/ml TGFb for 3 or 8 days, treated increasing concentrations of tunicamycin and thapsigargin for 3 days. Cell survival was determined using an ATP-based luminescence assay. (D) Western blot analysis for intact and cleaved Caspase-3 expression in non-emt (HMLER_shGFP) and EMT (HMLER_Twist) cells treated with increasing concentrations of thapsigargin. (E) IC50 for four luminal breast cancer cells, MCF7, MDA361, T47D and ZR-75-3(blue dots), and six basal-b lines, BT549, 4T1, Hs578T, MDA231, MDA436 and MDA157 (red dots) treated with various concentrations of tunicamycin, thapsigargin, DTT or A23187 for 3 days. (F) MCF7, ZR75-3, MDA231 and 4T1 cells were treated with solvent control, 0.1 µg/ml Tunicamycin (TM), or 10 nm Thapsigargin (TG) for 3 days. Cells were fixed with 70% ethanol, treated with RNase-A, and stained with propidium iodide. Fraction of cells in sub-g1 phrase was analyzed by FACS. Figure S3. Cells that undergo an EMT are highly secretory (A) Gene Set Enrichment Analysis for genes differentially expressed between control HMLE cells and HMLE cells induced into an EMT state with Gsc, shecad, Snail, TGFb, or Twist. The Normalized Enrichment Score for each comparison is plotted and indicates strong overexpression in EMT cells of genes encoding ECM components (upper panel) and Collagens (lower panel). 3
4 (B) Log2 fold-change in the expression of 20 secretory pathway component genes in HMLE cells induced into an EMT state with Gsc, shecad, Snail, TGFb or Twist relative to controls. The genes tested were 20 SPCGs (secretory pathway capacity gene), including SARA1, Sec24D, Sec23A, KDELR3, Sec13L1, Sec61A1, Sec61A2, COPZ2, Sec14L1, Sec14L2, COPB2, TRAM2, COPG, ARCN1, Sec31L1, TRAM1, SRPRB, SRP54, Sec24A and KDELR1. (C) Western blotting showing the expression of Sec16-GFP and GAPDH in HMLE_Ctrl and HMLE_shEcad cells transfected with Sec16-GFP construct. (D) Autoradiograph showing 35 S-methionine/cysteine-labeled secreted proteins from HMLE control and HMLE_shEcad cells, pretreated with or without 5 μg/ml of Brefeldin A. Secreted proteins were harvested at the indicated time points. Figure S4. Inhibition of ECM genes abrogates migration and ER stress sensitivity (A) HMLE_shEcad cells infected with shluc or DK-1 hairpins (FN-1 and PAI-1) were seeded onto a 6-well plate with serum free, BPE free culture medium. Conditional media collected at 6 hour or 16 hour post cell seeding were analyzed by PAGE, and the secreted protein from each sample were detected by silver stain. (B) Migratory ability of HMLE_shEcad_shLuc and HMLE_shEcad_DK-1 cells was measured using an in vitro transwell assay (10 hour). Representative images were shown. (C) qpcr analysis for expression of GADD34 and CHOP in HMLE_shEcad_shLuc and HMLE_shEcad_DK-1 cells treated with increasing concentrations of Dev4, thapsigargin, or DMSO solvent for 6 h. 4
5 Figure S5. BiP inhibition activates the UPR in basal-b but not luminal breast cancer cells Expression of UPR pathway components in three luminal cells, MCF7, T47D and ZR75-3, and four basal-b cells, MDA157, Hs578T, MDA231 and BT549 infected with control (shluc) or BiP specific hairpins (shbip) were shown. Expression of phospho-eif2α, total eif2α and tubulin was detected by western blotting. XBP1 and XBP1 splice variant was analyzed by RT-PCR. Figure S6. EMT activates PERK-eIF2a but not IRE1-XBP1 (A) RT-PCR analysis of XBP1 expression in HMLE and HMLER cells induced into EMT (HMLE_Twist, HMLE_shEcad, HMER_Twist, HMLER_shEcad), their non-emt controls (HMLE_shGFP, HMLER_shGFP), and non-emt luminal human breast cancer cell lines, as well as in EMT basal-b breast cancer cell lines. (B) Western blotting showing the expression of markers for EMT and UPR in Panc1 cells treated with 10 ng/ml TGFb for 0, 2, 4, 5, 6, 7 and 8 days. (C) HMLE_shGFP and HMLE_shEcad cells were pretreated with 0, 0.5 µm, 1 µm or 2 µm of PERK inhibitor for 24 hours, then treated with or without 40 nm thapsigargin for another 2 hours prior to protein extraction. Activity of PERK-eIF2alpha pathway was measured by Western blotting. Figure S7. Effects of PERK inhibitor on cellular proliferation (A) HMLE_shGFP and HMLE_shEcad cells, which have been pretreated with DMSO or 1 μm PERK inhibitor for 2 days, were placed with or without 1 μm PERK 5
6 inhibitor for 4 days. Relative cell growth was measured by counting with a hemacytometer. (B) HMLE_shGFP and HMLE_shEcad cells, which have been pretreated with DMSO or 1 μm PERK inhibitor for 2 days, were placed without PERK inhibitor for 4 days. Relative cell growth was measured by counting with a hemacytometer. Figure S8. EMT primary breast cancer cells are more sensitive to ER stressors BT5104 (non-emt) and BT5094 (EMT) cells were treated with solvent control, 0.1 µg/ml Tunicamycin (TM), or 10 nm Thapsigargin (TG) for 3 days. Cells were fixed with 70% ethanol, treated with RNase-A, and stained with propidium iodide. Fraction of cells in sub-g1 phrase was analyzed by FACS. Table S1 GSEA of microarray data from Cmp302-treated cells (A) Top 50 genes induced by Cmp302 in HMLE_Twist cells. UPR genes were highlighted. (B) List of genes in gene sets TM, TG, DOX and HYPOXIA Table S2 ECM gene expression in luminal and basal-b breast cancer lines 6
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Peter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response
Peter Walter, UCSF IRE1 Signaling Affects Cell Fate during the Unfolded Protein Response Jenn Hou Burke Group Literature Seminar November 19 th 2016 Protein Synthesis Pathway 4. Final Destination: proteins
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel
Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Supplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
supplementary information
DOI:.38/ncb1963 a wild 5.3kb 11.2kb targeting vector stop PCR primer KKpn NNhe targeted allele 5.7kb 6.8kb probe b d (g) 35 3 25 2 genomic Southern blot Kpn I digest Nhe I digest / / / / / / 11.2 kb 5.7
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Samali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
SUPPLEMENTAY FIGURES AND TABLES
SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
SUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes
Nrf2 mediates induced CLEC5A and TNFα Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNFα production by mononuclear phagocytes YiLin Cheng 1,2, YeeShin Lin 1,2,3, ChiaLing
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
ELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS
7 CHAPTER SEVEN ELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS 136 7.1 INTRODUCTION Breast cancer is one of the leading causes of death in women (Stephens et al., 2012). Several chemotherapeutic
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Jae Won Choi, Mark A. Schroeder, Jann N. Sarkaria, and Richard J. Bram 1 Figure S1. Pharmacological
Molecularly defined unfolded protein response subclasses have distinct correlations with fatty liver disease in zebrafish
2014. Published by The Company of Biologists Ltd (2014) 7, 823-835 doi:10.1242/dmm.014472 RESEARCH ARTICLE Molecularly defined unfolded protein response subclasses have distinct correlations with fatty
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
CD4 and CD8 T cells show a similar accumulation in the tumor stroma.
Fig S1 CD4 Fibronectin EpCM CD8 CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fluorescently-labeled CD4 (CMFD, green) and CD8 (Hoechst, yellow) T cells were added to a human lung
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
a" b" 2N c" d" e" f" !!Aurora!A!!!CP110!
DLD1/Reference a" 2N 2N 2N/DLD1 2N/ /DLD1 c" d" e" f" TargetID 2N.AVG_Sig 2N.Det Pval.AVG_Sig.Det Pval Diff Pval DiffScore SYMBOL ILMN_26396 18.35238 0.0080058 44.81118 0.0021834 0.000323 34.90542 KRTHA4
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Supplementary Information for
Supplementary Information for Anticipatory Estrogen Activation of the Unfolded Protein Response is Linked to Cell Proliferation and Poor Survival in Estrogen Receptor Positive Breast Cancer Neal Andruska
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via
Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces
Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Comparative study of multicellular tumor spheroid formation methods and implications for drug screening
Supporting Information Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Maria F. Gencoglu, Lauren E. Barney, Christopher L. Hall, Elizabeth A. Brooks,
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences