Title: Anti-proliferative effect of extremely low frequency electromagnetic field on preneoplastic lesions formation in the rat liver
|
|
- Grace Sullivan
- 6 years ago
- Views:
Transcription
1 Author's response to reviews Title: Anti-proliferative effect of extremely low frequency electromagnetic field on preneoplastic lesions formation in the rat liver Authors: Mónica N Jiménez-García (mony.piensa@gmail.com) Jaime Arellanes-Robledo (jarellanes@gmail.com) Diana I Aparicio-Bautista (adbi2401@hotmail.com) Miguel A Rodríguez-Segura (mars@fis.cinvestav.mx) Saúl Villa-Treviño (svilla@cell.cinvestav.mx) Juan J Godina-Nava (jj@fis.cinvestav.mx) Version: 2 Date: 1 February 2010 Author's response to reviews: see over
2 1 Dear editors of BMC Cancer journal, We considered all suggestions of reviewers. Thank to those, the manuscript was substantially improved. All new or modified paragraphs are showed highlighted in blue throughout the manuscript. Reviewer Comments: Referee 1 Reviewer: Santi Tofani 1. Describe how animals were held during the exposure, how many of them were contemporarily exposed or sham exposed, provide also info on the timing of the entire experimental section (s). A scheme of the experimental setup should be given with all the necessary information for in theory allowing a replica of the experiment. Results of all physical parameters monitored during the animal exposure as well as during sham exposure sections should also be given. In the Methods section we included a new subsection entitle: Animal exposure which explains part of these questions: Animal exposure During the exposure, CTF group was divided in two subgroups of three rats each one and placed in a Plexiglas cage (16 x 16 x 25 cm) inside of solenoid. Each subgroup was exposed to 4.5 mt Hz ELF-EMF for 50 min daily as shown Figure 1; the first group was exposed from 10:00 10:50 h and the second was from 12:00 12:50 h, alternating them on this schedule, during 32 consecutive days (from 7 days before carcinogenic treatment until 25 days after). After exposure all animals were returned to their home cages. Moreover, we also included a new figure (Figure 2) for a better explanation and understanding of entire experimental section. Additionally, in the legend of the Figure 1 we improved the explanation about our experimental setup: Figure 1. Schematic representation of the carcinogenic treatment and ELF-EMF exposure. The sham-exposure or exposure to ELF-EMF was applied before and during carcinogenic treatment, as indicated in schemes of CT and CTF groups, respectively. NC, normal control; CT, carcinogenic treatment and sham-exposure; CTF, carcinogenic treatment plus ELF-EMF exposure. S, sacrifice; DEN, N-diethylnitrosamine; 2AAF, 2- acetylaminofluorene; PH, partial hepatectomy; n = 6 for each group. In the subtitle Experimental design of the Methods section, additional information was included, like light/dark cycle, temperature and humidity in which the animals were held throughout the experiment: Male Fischer-344 rats weighing 160 to 200 g, obtained from the Production Unit of Experimental Laboratory Animals (UPEAL-CINVESTAV, México DF, Mexico), were fed ad libitum and housed in a controlled environment (12 h light/12 h dark cycle, room temperature of ºC with relative humidity at %).
3 2 To clarify the moment of the exposure during the days when the carcinogenic treatments were given, in the subtitle Experimental design of the Methods section we included the next paragraph: CTF group. For this group, the administrations of DEN, 2AAF and PH were carried out before ELF-EMF exposure schedule. 2. How and where temperature was recorded inside the coil (in respect to the animal position) and corresponding results obtained during the animal exposure as well as during sham exposure section (s) should be given. For answering this question, in the subtitle System of ELF-EMF exposure of Methods section was included the next paragraph and the figure 2: The temperature sensor location and the shape of signal wave are shown in Figure 2. In the subtitle General observations of the Results section, we also included the next explanation: We also monitored the temperature of sham-exposure (CT) or exposure (CTF) groups during the 32 days and their values were recorded at specific times shown in Table 1. Table 1. Average values of the temperature recorded during the exposure time Treatment group CT CTF Time/min T/ C T/ C ± ± ± ± ± ± ± ± ± ±0.7 All values are expressed as the mean ± SEM 3. About the histological and immunoistological exams please report the number sections used for each animal and how sections were selected. Please also report results for every single animal in a table where also the number of liver sections is shown. Please provide also the timing of when these exams were performed (i.e. in different days?) for the different experimental groups. Please also report on the knowledge by the examiner of the exposure group. In the subtitles GGT histochemical staining and TUNEL assay and immunohistochemical analysis of the Methods section, we included the number sections used and how were selected them, moreover we included when the exams were performed: GGT histochemical staining For each animal 3 tissue sections were analyzed randomly. The experimental procedure was carried out at the same time for all comparative groups. TUNEL assay and immunohistochemical analysis 4 sequential sections per rat were analyzed; For detection of each protein, the immunostaining protocol was carried out at the same time for all comparative groups.
4 3 Note: The figures that include tissue sections only show representative tissues of one animal per treatment group. A table (Table 2) that shows the number of liver sections reported as the mean of foci number per cm 2 and the percent of area GGT-positive for every single animal was included. Table 2. Effect of ELF-EMF exposure on foci number per cm 2 and the percent of area GGT-positive Group # animal Foci number/cm 2 % of GGT-positive area CT ± ± ± ± ± ± ± ± ± ± ± ± 1.1 CTF ± ± ± ± ± ± ± ± ± ± ± ± 0.7 Values represent the mean ± SEM of three liver sections evaluated per animal. In the subtitle of Experimental design of the Methods section we also report on the knowledge by the examiner of the exposure group: Biochemical and molecular evaluations were performed under blind conditions by expert people not involved in the animal exposure. Referee 3 Reviewer: Arthur A Pilla 1. The authors indicate temperature in the coil was monitored, but provide no values for temperature for active and inactive coil states. These should be included. In the subtitle General observations of the Results section, we included the next explanation for this question and we also included the Table 1: We also monitored the temperature of sham-exposure (CT) or exposure (CTF) groups during the 32 days and their values were recorded at specific times shown in Table 1. Table 1. Average values of the temperature recorded during the exposure time Treatment group CT CTF Time/min T/ C T/ C ± ± ± ± ± ± ± ±0.6
5 ± ±0.7 All values are expressed as the mean ± SEM 2. The authors should look at: Strauch et al. Evidence-based use of pulsed electromagnetic field therapy in clinical plastic surgery. Aesthet Surg J. 2009;29: for further insight into possible mechanisms of PEMF therapeutic effects. In the Discussion section, we included a paragraph that gives an additional possible mechanism of electromagnetic fields effects: Furthermore, evaluations in experimental models have been established that the electromagnetic fields are able to modulate the intracellular calcium (Ca 2+ ) when cellular homeostasis is disrupted [32]. Calcium is a highly versatile intracellular signal that can regulate many different cellular functions, whether normal or pathological; thus, the consequences of Ca 2+ signaling depend of steady state between Ca 2+ influx, efflux, and storage [33]. Cancer development takes place through rapid proliferation and the continuous increase of altered cells that modify the cellular environment [19], including the flow of ionic charges across the cell membrane, such as Ca 2+ flow. Given that several blockers of Ca 2+ entry inhibit tumor growth [34], we cannot discount that ELF-EMF could be regulating Ca 2+ flow in the cells. Therefore, Referee 2 Reviewer: Ronald J Midura Commentary 1 The manuscript should provide a detailed diagram of db/dt versus the time domain for the chosen electro-magnetic field (EMF) treatment. For covering this suggestion, in the manuscript was included the Figure 2 which is mentioned in the subtitle System of ELF-EMF exposure of Methods section. The Figure 2 shows the waveform measured inside the coil. 1. Figure 1 shows that EMF treatments began a week before the first drug treatment to induce the modified resistant hepatocyte model (MRHM) of pre-neoplastic lesions. A rationale for starting EMF treatments PRIOR to induction of MRHM is not described. Furthermore, from a relevance view point, it is hard to justify a biophysical treatment prior to diagnosis of a disease state from ethical and clinical standpoints. What would have happened if EMF treatments started after DEN treatment, or after partial hepatectomy? Without an adequate rationale for this research design, the biological and clinical significance of this work is jeopardized. For example, would the EMF treatments prior and during subsequent drug treatments have had an effect on the pharmacokinetics of these drugs and thus alter their bioavailability in liver tissue? If so, then one would conclude that EMF reduced pre-neoplastic lesions in the liver because it reduced the negative influences of these drugs via altering their accessibility to the liver. With regard to this suggestion, the rationale by which the EMF treatment was given prior to MRHM is that although HCC takes several years to reach invasiveness, the inability to diagnose HCC patients at an early development stage causes it to be a high mortality malignancy (Jia HL et al, Clin Cancer Res 2007;13: ). Thus, prevention strategies administered during initial stages represent a promising strategy for the treatment of HCC. In this way, by identifying strategies that modulate molecular
6 5 targets in preclinical models, these could be applied in populations at high risk of developing the disease. In the subtitle Animal exposure of the Methods section and in the Conclusion section, we included information to cover this suggestion: Animal exposure We decided to apply the ELF-EMF from 7 days before starting the carcinogenic treatment, because our initial approach was to assess its effect on the inhibition of preneoplastic lesions development in rat liver, as a strategy to prevent the disease in the early stages of its development. Conclusion Finally, considering that hepatocellular carcinoma is a common form of cancer and that its incidence around the world remains high [35], this finding could be the basis for the design of strategies and clinical applications of ELF-EMF to treat this disease, aimed primarily at high-risk populations. 2. The immunohistochemistry data in Table 1 need to be broken down with regard to signal detection within the boundaries of the pre-neoplastic lesions versus signal detection outside lesion boundaries. Only with this kind of assessment can one determine whether the EMF effects are specific to the cells within the lesion as opposed to having generalized effects on all cells within the liver tissue. Although the carcinogenic treatment induces the formation of preneoplastic lesions, which can be detected by specific markers as the expression of GST-p, the expression of other proteins, such as proliferation and cell cycle proteins, are not limited to preneoplastic lesions, they also are found outside the lesions; indicating that the carcinogenic treatment alters the whole tissue at other levels. Previously, altered cells were already quantified both within and outside the preneoplastic lesions and it was reported that more than 70% of them are located within lesions after carcinogenic treatment (Arellanes-Robledo J, et al, Anticancer Res 2006;26: ). Furthermore, in the present work, the effects of electromagnetic fields on expression of these proteins were confirmed quantitatively in total tissue by Western blot analysis. That showed a clear effect on the general phenomenon. For this reason, we quantified the changes in proteins expression of the whole tissue. 3. Figure 3 TUNEL results are of good quality, but the authors need to realize that TUNEL detects free 3 -OH in genomic DNA via DNA strand breaks resulting from damaging insults. Thus, TUNEL is best interpreted as an assay of DNA damage, and can only be interpreted regarding apoptosis when additional corroboration is made. The study shows activated (cleaved) caspase 3 Western blots for NC, CT, and CTF liver samples. Close inspection of these Western blots demands that more sampling of liver tissues from additional animals needs to be obtained in order to provide a truly representative sampling. Specifically, in the CTF group two of the sample signals were noticeably lower in intensity than even the NC signals; only one CTF sample exhibited relatively high signal intensity. Does this one specimen skew the data erroneously, and if so, then the CTF would actually be shown to reduce overall activated caspase 3 levels. This would lend an interpretation that EMF treatment might have reduced overall apoptosis levels in the liver tissue. Closer inspection of the TUNEL results support this claim as the intensity of the TUNEL signal per nucleus seems greater in the CT group versus NC or CTF groups. In fact, the TUNEL signal of he CT group seems closer to
7 6 the DNaseI digestion positive control for the assay. The authors are suggested to reanalyze their activated caspase 3 and TUNEL results and seek a higher level of confidence regarding the quantifiable attributes of their data. Given a lack of a statistical power analysis in the Methods section, it is unclear at present whether a sufficient sample population for each outcome was definitively established. We are agree with this suggestion, TUNEL assay only can tell us if an agent breaks the DNA strands but no if it is able to induce apoptosis; in this way, in the subtitle TUNEL assay and immunohistochemical analysis of the Methods section, we change the aim by which we used the TUNEL assay, remain as follow: Liver tissue sections, 4 µm thick, were deparaffinized and hydrated gradually. DNA fragmentation was determined by a Colorimetric TUNEL System kit, Similarly, in the subtitle ELF-EMF exposure did not induce apoptosis of the Results section, as well as in Discussion section, we modified our insight. ELF-EMF exposure did not induce apoptosis To evaluate the effect of ELF-EMF exposure on the apoptosis induction of altered hepatocytes, we used two different procedures applied to the three groups. First, cells with DNA fragmented were identified in tissues by a TUNEL assay. Representative tissue sections of each treatment are depicted in Figure 4. Although a slight increase of TUNEL-positive cells is observed in the rat tissues of CT group (Figure 4C), these were not different from those of rats in the NC group or those in the CTF group (Figures 4B and 4D). According to this result, the levels of cleaved caspase 3 were not affected by either the CT or the CTF protocols as compared to the NC protocol (Figure 4E). These results indicate that the application of 4.5 mt Hz ELF-EMF does not induce either DNA fragmentation or the caspase-3 activation, indicating that it does not promote apoptosis of altered hepatocytes. Discussion These results indicate that the application of 4.5 mt Hz ELF-EMF does not induce either DNA fragmentation or the caspase-3 activation, indicating that it does not promote apoptosis of altered hepatocytes. Respect to detection of cleaved caspase-3 by Western blot analysis, in the Figure 3 (now Figure 4); we only show representative images of six independent animals per group. We consider that six animals per group are enough. Moreover, in Figure 3 (now Figure 4) you can see that two of three animals that belonging to the CTF group presented less intensity in the cleaved caspase-3 band, and not vice versa, this support our results respect to the ELF-EMF dose not induce caspase-3 activation. Initially, we designed our experiments including only the TUNEL assay to see DNA integrity; however, for us also the results of this assay were not clear, and then we decided to include the cleaved caspase-3 by Western blot analysis to confirm the first. Western blot was selected because is a quantitative analysis and we could associate it to apoptosis phenomenon. Respect to a statistical power analysis, we re-analyzed our casapse-3 values but now using one-way analysis of variance (ANOVA) test; and our results were the same. We did not find statistical differences, you can see it below: One Way Analysis of Variance Data source: Data 1 in Notebook 1
8 7 Normality Test: Passed (P = 0.129) Equal Variance Test: Passed (P = 0.558) Group Name N Missing Mean Std Dev SEM CN CT CTF Source of Variation DF SS MS F P Between Groups Residual Total The differences in the mean values among the treatment groups are not great enough to exclude the possibility that the difference is due to random sampling variability; there is not a statistically significant difference (P = 0.932). Power of performed test with alpha = 0.050: The power of the performed test (0.049) is below the desired power of Less than desired power indicates you are more likely to not detect a difference when one actually exists. Be cautious in over-interpreting the lack of difference found here. 4. The above mentioned limitations in the TUNEL and activated caspase 3 analyses reported in this manuscript are also impacted by a re-analysis of the PCNA versus Ki-67 immunostaining results for nuclei in liver tissue sections. Ki-67 is strictly a marker of replication fork presence due to proliferation, while PCNA has been demonstrated to positively stain both proliferating nuclei and those actively undergoing DNA repair [Nucleic Acids Res 27:4476, 1999; Circulation 99:2757, 1999]. Given that serial sections were used to immunostain the liver tissue sections, this study should be able to assess how many nuclei stained positive for both Ki-67 & PCNA, as opposed to those nuclei that stained positive only for PCNA. This would provide an assessment of cell nuclei that are not actively engaged in replication, but rather DNA damage repair. This type of assessment would be able to be cross referenced against the TUNEL/caspase3 data in Figure 3 in order to provide a more definitive assessment of whether EMF was altering apoptosis outcomes. For example in Table 1, if one assumes that all nuclei staining positive for Ki-67 were also staining positive for PCNA, then one could perform a simple subtraction [PCNA results Ki-67 results = # nuclei undergoing DNA damage repair] to provide an assessment of the number of liver cells attempting to repair DNA damage. This type of calculation would yield the following data: Group PCNA Ki67 # DNA damage repair cells # cyclin D1 positive NC 22-7 cells/mm2 = 15 cells/mm2 49 cells/mm2 CT cells/mm2 = 300 cells/mm2 265 cells/mm2 CTF cells/mm2 = 34 cells/mm2 45 cells/mm2 There is a remarkable similarity in the proportions of cells exhibiting DNA damage repair and cyclin D1 detection. I do not believe this similarity is a coincidence, and this possibility needs to be more rigorously investigated. If this holds true, then EMF altered the amounts of DNA damage to liver cells in the MRHM model. To reveal the serial tissues by immunohistochemistry, the sequence of the analysis was as follows: tissue 1, Cyclin D1, tissue 2, Ki-67; tissue 3, GSTP and tissue 4, PCNA. As you can see the tissue section used to reveal Ki-67 is distant from the tissue section to reveal PCNA, considering that the nucleus of each hepatocyte has an average of 8 µm and each serial tissue has a thickness of 4 µm, it is not possible to observe accurately the marks of each protein overlapped. In addition, the quantification of positive nuclei for
9 8 PCNA, Ki-67 and cyclin D1 was performed by taking 10 random areas from each tissue section independently per animal, so that no overlaps between them. To make the suggested analysis, it would take us much longer. However, we consider this important suggestion and we decided to discuss it only as a possibility, which was included in the "Discussion" section. Moreover, we included additional information in the subtitled "The application of 4.5 mt Hz ELF-EMF inhibits proliferation during in vivo hepatocarcinogenesis" of the Results section. Dear Dr. Ronald J Midura, we are grateful for this important suggestion, because it given us insights to investigate new aspects related to our project. "Discussion" The correlation between the presence of Ki-67, PCNA and cyclin D1 has already been studied; while PCNA participates in replication and DNA repair and is also closely associated with the cell cycle machinery, Ki-67 is a specific replication marker associated with cell cycle entry given that participates in all active phases of the cell cycle except for the G0 phase [15, 16, 27]. We evaluated their expression by immunohistochemestry and found that ELF-EMF altered the amounts of positive cell expressing these proteins and we concluded that this effect is associated with the diminishing of cell proliferation. However, given that PCNA takes part else in DNA repair and that the amount of PCNA-positive cells were larger than Ki-67 (see Table 1); if we assume that all Ki-67-positive cells were also PCNA-positive, it is striking to observe that from the subtraction between them ([PCNA Ki67]), the number of remaining PCNA-positive cells is similar to the number of cyclin D1-positive cells. Thus, the remaining PCNA-positive cells would be involved in DNA repair, but not in proliferation processes. A similar analysis was reported in human myocytes, where was observed that TUNEL-positive cells can simultaneously express PCNA, but not Ki-67 [28]. This also could explain why the slight increase of TUNEL-positive cells observed in CT group, was not confirmed by cleaved caspase-3 detection. Together this information, suggests that the ELF-EMF could be altering the amount of cells bearing DNA damage in the MRHM model. Further studies are required to determine the nature of this possible association. The application of 4.5 mt Hz ELF-EMF inhibits proliferation during in vivo hepatocarcinogenesis" To determine whether the application of 4.5 mt Hz ELF-EMF had an effect on cell proliferation, which is a characteristic alteration from the induction of experimental hepatocarcinogenesis, we analyzed the expression of PCNA, which participates in replication and DNA repair, and the expression of Ki-67, a specific replication marker, Referee 4 Reviewer: Luciana Dini - Major Compulsory Revisions 1. The last part of the discussion section is too speculative and only one reference, but no data, is given in support of the hypothesis.
10 9 In the Discussion section, we included additional information the supports our hypothesis about electromagnetic fields effects on hepatocarcinogesis model used: ELF-EMF are able to interact with moving electrons and to increase electron transfer rates in chemical reactions [30]. However, the interaction of ELF-EMF exposure with biological systems, from a physical point of view, remains unclear. Nevertheless, a biophysical model has recently been hypothesized. In this model, the action mechanism of the electromagnetic fields in cells occurs through the forced vibration of each of the free ions that exist on both sides of all plasma membranes and that can move across of them using transmembrane proteins, which disrupt the electrochemical balance of the plasma membrane and, therefore, the whole function of the cell [31]. Furthermore, evaluations in experimental models have been established that the electromagnetic fields are able to modulate the intracellular calcium (Ca 2+ ) when cellular homeostasis is disrupted [32]. Calcium is a highly versatile intracellular signal that can regulate many different cellular functions, whether normal or pathological; thus, the consequences of Ca 2+ signaling depend of steady state between Ca 2+ influx, efflux, and storage [33]. Cancer development takes place through rapid proliferation and the continuous increase of altered cells that modify the cellular environment [19], including the flow of ionic charges across the cell membrane, such as Ca 2+ flow. Given that several blockers of Ca 2+ entry inhibit tumor growth [34], we cannot discount that ELF-EMF could be regulating Ca 2+ flow in the cells. Therefore, 2. Magnification of figs 3 and 4 must be the final magnification and not reported whit the magnification of the objective. The magnifications of figures 3 and 4 (now 4 and 5, respectively) in the Figure legends section were changed; moreover, on their down-right part, the figures show the scale bar corresponding to their magnifications. Figure 4. Effect of ELF-EMF exposure on apoptosis. Representative liver sections of each treatment are shown. (A) Positive control tissue that was treated with DNase I. (B) Normal control tissue. (C) CT protocol. (D) CTF protocol; images magnification 200x. (E) Western blot analysis for cleaved caspase 3 levels. Caspase 3 was normalized with actin expression used as the loading control. The expression of NC was adjusted to one in the densitometric units scale; n = 6 for each group. Figure 5. Immunohistochemical analysis of GST-p, PCNA, Ki-67 and cyclin D1 expression. Four serial liver sections from each treatment are shown in columns. Immunostaining for each protein is displayed in rows. GST-p detection shows the preneoplastic lesions for localization of PCNA, Ki-67 and cyclin D1 (CD1) expression. NC, normal control; CT, carcinogenic treatment; CTF, carcinogenic treatment plus ELF-EMF exposure; images magnification 200x; n = 6 for each group. - Discretionary Revisions 1. It should be also taken into account the effect of ELF-EMF on the normal liver tissue, since the cells response to exposure could also depend on their physiological conditions. Effectively, our normal control group (NC) was not subjected to ELF-EMF exposure, however, there are investigations where normal rats Fischer 344 were exposed to electromagnetic fields by a longer period to demonstrate the effects of electromagnetic
11 10 fields on the induction of general carcinogenesis and at level of hematological modifications. The results showed that electromagnetic fields were not able to induce the carcinogenesis and to modify the hematological variations in the rats. (R Mandeville, et al. FASEB journal 1997,11: ; DU Cakir, et al. Archives of Medical Research 2009, 40: ). 2. Why the Authors have not investigated on the cytoskeleton, whose modifications exerted by exposure via the action on the membrane ions, could block the formation of the mitotic spindle? We realize that we did not investigate the effect of field exposure on the cell cytoskeleton, and we did not due to different reasons: First, our experiments were conducted in an in vivo model, which has the advantage that it includes all the variables of an organism and not just those contained in the isolated cells. Second, we are also aware that during the initial investigation of a specific area, from the results emerge many questions which must be resolved. However, this work represents our first approach about the effect of electromagnetic field on experimental hepatocarcinogenesis. Undoubtedly there are many unanswered questions, for these reasons we consider to perform further analysis to answer that emerged in this work. Finally, this study clearly demonstrate a phenomenon induced by the electromagnetic field on development of preneoplastic lesions in rat liver, which is supported by the analyses performed at the level of preneoplastic lesions quantification, proliferation and apoptosis.
Quantification of early stage lesions for loss of p53 should be shown in the main figures.
Reviewer #1 (Remarks to the Author): Expert in prostate cancer The manuscript "Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers" uses a number of novel genetically engineered
More informationAuthor's response to reviews
Author's response to reviews Title: Rapid Induction of Orthotopic Hepatocellular Carcinoma in Immune-competent Rats by Ultrasound-guided Method and the Subsequent Low-dose Chemotherapy Authors: Hoi-Hung
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationTitle: Healthy snacks at the checkout counter: A lab and field study on the impact of shelf arrangement and assortment structure on consumer choices
Author's response to reviews Title: Healthy snacks at the checkout counter: A lab and field study on the impact of shelf arrangement and assortment structure on consumer choices Authors: Ellen van Kleef
More informationTitle:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells
Author's response to reviews Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Authors: Ingvild J Brusevold (i.j.brusevold@medisin.uio.no) Ingun H Tveteraas
More informationTitle: Identifying work ability promoting factors for home care aides and assistant nurses
Author's response to reviews Title: Identifying work ability promoting factors for home care aides and assistant nurses Authors: Agneta Larsson (agneta.larsson@ltu.se) Lena Karlqvist (lena.karlqvist@ltu.se)
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationTitle: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles
Author's response to reviews Title: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles Authors: Julia Tchou (julia.tchou@uphs.upenn.edu) Andrew V Kossenkov (akossenkov@wistar.org)
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationTitle: Cystatin E/M suppresses legumain activity and invasion of human melanoma
Author's response to reviews Title: Cystatin E/M suppresses legumain activity and invasion of human melanoma Authors: Jon J Briggs JJB (jbriggs33@yahoo.com) Mads H Haugen MHH (Mads.Haugen@rr-research.no)
More informationTITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer
AD Award Number: TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer PRINCIPAL INVESTIGATOR: Audrey van Drogen, Ph.D. CONTRACTING ORGANIZATION: Sidney
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Fong PC, Boss DS, Yap TA, et al. Inhibition of poly(adp-ribose)
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationAuthor's response to reviews
Author's response to reviews Title: Contribution of Interferon Gamma Release Assays testing to the Diagnosis of Latent Tuberculosis Infection in HIV-Infected Patients: A comparison of QuantiFERON Gold
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationTitle: Overlap of Cognitive Concepts in Chronic Widespread Pain: An Exploratory Study
Author's response to reviews Title: Overlap of Cognitive Concepts in Chronic Widespread Pain: An Exploratory Study Authors: Aleid de Rooij (a.d.rooij@reade.nl) Martijn P.M. Steultjens (martijn.steultjens@gcal.ac.uk)
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationCell Cycle, Mitosis, and Microtubules. LS1A Final Exam Review Friday 1/12/07. Processes occurring during cell cycle
Cell Cycle, Mitosis, and Microtubules LS1A Final Exam Review Friday 1/12/07 Processes occurring during cell cycle Replicate chromosomes Segregate chromosomes Cell divides Cell grows Cell Growth 1 The standard
More informationAuthor's response to reviews
Author's response to reviews Title: Corticosteroid co-treatment induces resistance to chemotherapy in surgical resections, xenografts, and established cell lines of pancreatic cancer Authors: Chengwen
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationPEER REVIEW FILE. Reviewers' Comments: Reviewer #1 (Remarks to the Author)
PEER REVIEW FILE Reviewers' Comments: Reviewer #1 (Remarks to the Author) Movement-related theta rhythm in the hippocampus is a robust and dominant feature of the local field potential of experimental
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationGenesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
More informationSupporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)
Supporting Information Table of contents Calculation of the relative contributions of myocyte proliferation, stem cell differentiation and cardioprotection (page 2) Supporting Information Fig 1 (page 9)
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationTechnique and feasibility of a dual staining method for estrogen receptors and AgNORs
151 Technical note Technique and feasibility of a dual staining method for estrogen receptors and AgNORs Lukas Günther a, and Peter Hufnagl b a Department of Surgery, University of Heidelberg, Heidelberg,
More informationDr/ Sherein Saeid AbdElgayed, ph.d
هللامسب Dr/ Sherein Saeid AbdElgayed, ph.d Professor of Veterinary Pathology, Cairo University, Giza, Egypt. Chairman of the Editorial Board of Arab Journal of Science & Research Publishing (AJSRP) http://www.ajsrp.com
More informationTitle: The effect of Breast Cancer Awareness Month on Internet search activity - a comparison with awareness campaigns for lung and prostate cancer
Author's response to reviews Title: The effect of Breast Cancer Awareness Month on Internet search activity - a comparison with awareness campaigns for lung and prostate cancer Authors: Ronan W Glynn (ronanglynn@doctors.net.uk)
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationAuthor's response to reviews
Author's response to reviews Title: Characteristic mtor activity in Hodgkin-lymphomas offers a potential therapeutic target in high risk disease - a combined tissue microarray, in vitro and in vivo study
More informationTitle: Synuclein Gamma Predicts Poor Clinical Outcome in Colon Cancer with Normal Levels of Carcinoembryonic Antigen
Author's response to reviews Title: Synuclein Gamma Predicts Poor Clinical Outcome in Colon Cancer with Normal Levels of Carcinoembryonic Antigen Authors: Caiyun Liu (liucaiyun23@yahoo.com.cn) Bin Dong
More informationChapter 12. The Cell Cycle
Chapter 12 The Cell Cycle The Key Roles of Cell Division The ability of organisms to produce more of their own kind is the one characteristic that best distinguishes living things from nonliving things.
More informationTitle: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis
Author's response to reviews Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis Authors: Kensuke Akaogi (kensuke.akaogi@gmail.com) Wakana Ono (wakana315@gmail.com)
More informationEditorial Note: this manuscript has been previously reviewed at another journal that is not operating a transparent peer review scheme.
Editorial Note: this manuscript has been previously reviewed at another journal that is not operating a transparent peer review scheme. This document only contains reviewer comments and rebuttal letters
More informationSupplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationAPPLICATION AND DEPLOYMENT OF ADVANCED NDE TECHNIQUES IN HIGH PRESSURE VESSELS
APPLICATION AND DEPLOYMENT OF ADVANCED NDE TECHNIQUES IN HIGH PRESSURE VESSELS Jeffrey P. Milligan, Daniel T. Peters, Structural Integrity Associates, Inc., USA Many advances in Non-Destructive Examination
More informationReporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Roger Thompson NNA52598C Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 9 # Supplementary Tables:
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Kethandapatti Balaji, M.D. CONTRACTING ORGANIZATION:
More informationTitle: Spontaneous Feline Mammary Intraepithelial Lesions as a Model for Human Estrogen Receptor- and Progesterone Receptor-Negative Breast Lesions
Author's response to reviews Title: Spontaneous Feline Mammary Intraepithelial Lesions as a Model for Human Estrogen Receptor- and Progesterone Receptor-Negative Breast Lesions Authors: Giovanni P Burrai
More informationDOCTORAL THESIS SUMMARY
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA DOCTORAL THESIS HISTOPATHOLOGICAL AND IMMUNOHISTOCHEMICAL STUDY OF GASTRIC CARCINOMAS SUMMARY Scientific Coordinator: Univ. Prof. Dr. SIMIONESCU CRISTIANA EUGENIA
More informationCesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in
More informationAuthor's response to reviews
Author's response to reviews Title:Mental health problems in the 10th grade and non-completion of upper secondary school: the mediating role of grades in a population-based longitudinal study Authors:
More informationWhat can lead to aneuploidy?
11.06.17 What can lead to aneuploidy? A Mitotic checkpoint defects B Cohesion defect C Centrosome amplification D Hyperstabilized kinetochore microtubule interactions IB SL Biology Exam. Deadlines and
More informationTitle:Association of resting heart rate with cardiovascular function: a cross-sectional study in 522 Finnish subjects
Author's response to reviews Title:Association of resting heart rate with cardiovascular function: a cross-sectional study in 522 Finnish subjects Authors: Jenni K Koskela (jenni.k.koskela@uta.fi) Anna
More informationTitle:Evaluation of 11C Acetate and 18F-FDG PET/CT in Mouse Multidrug Resistance Gene-2 Deficient Mouse Model of Hepatocellular Carcinoma
Author's response to reviews Title:Evaluation of 11C Acetate and 18F-FDG PET/CT in Mouse Multidrug Resistance Gene-2 Deficient Mouse Model of Hepatocellular Carcinoma Authors: Paul R Teritto (pterrito@iupui.edu)
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationApril 5, :45 AM 1:45 PM MARRIOTT MARQUIS HOTEL & MARINA, MIRAMAR VIGNETTE 1 VIGNETTE 2 VIGNETTE 3* VIGNETTE 4* VIGNETTE 5*
April 5, 2016 11:45 AM 1:45 PM MARRIOTT MARQUIS HOTEL & MARINA, MIRAMAR CHAIR: DANNY A. MILNER, JR., BRIGHAM & WOMEN S HOSPITAL, BOSTON, MA VIGNETTE 1 VIGNETTE 2 VIGNETTE 3* VIGNETTE 4* VIGNETTE 5* *VIGNETTES
More informationTitle: Oral administration of PPC enhances antigen-specific CD8+ T cell responses while reducing IgE levels in sensitized mice.
Author's response to reviews Title: Oral administration of PPC enhances antigen-specific CD8+ T cell responses while reducing IgE levels in sensitized mice. Authors: Mike Burrows (mburrows@tampabayresearch.org)
More informationKinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis
The Journal of Clinical Investigation Kinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis Trieu-My Van, 1,2,3 Apostolos Polykratis, 1,2,3 Beate Katharina Straub,
More informationTitle: Seroprevalence of Human Papillomavirus Types 6, 11, 16 and 18 in Chinese Women
Author's response to reviews Title: Seroprevalence of Human Papillomavirus Types 6, 11, 16 and 18 in Chinese Women Authors: Jia Ji (jackie.j.ji@gmail.com) He Wang (hewangpeking@gmail.com) Jennifer S. Smith
More information25. Two-way ANOVA. 25. Two-way ANOVA 371
25. Two-way ANOVA The Analysis of Variance seeks to identify sources of variability in data with when the data is partitioned into differentiated groups. In the prior section, we considered two sources
More informationTitle:Intermittent whole-body vibration attenuates a reduction in the number of the capillaries in unloaded rat skeletal muscle
Author's response to reviews Title:Intermittent whole-body vibration attenuates a reduction in the number of the capillaries in unloaded rat skeletal muscle Authors: Akinori Kaneguchi (sg12202@ym.hirokoku-u.ac.jp)
More information5.2. Mitosis and Cytokinesis. Chromosomes condense at the start of mitosis.
5.2 Mitosis and Cytokinesis VOCABULARY chromosome histone chromatin chromatid centromere prophase metaphase anaphase telophase Biochemistry As you will learn in the chapter From DNA to Proteins, a nucleotide
More informationReporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Alex Pouget NN-A46249B Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 3 # Supplementary Tables:
More informationIn addition, we have asked an English-editing service to edit the text, and you will find an English-edited version of the paper submitted as well.
Author s response to reviews Title: Resource Use and Disease Course in Dementia - Nursing Home (REDIC-NH): A Norwegian Cohort Study from Admission to a Nursing Home until Death. A description of study
More informationA mouse model for oral squamous cell carcinoma
4 A mouse model for oral squamous cell carcinoma Remilio A. L. Schoop Robert J. Baatenburg de Jong Abstract Despite recent advances, the prognosis of oral squamous cell carcinoma is still poor. Therapeutic
More informationChapter 3 subtitles Action potentials
CELLULAR NEUROPHYSIOLOGY CONSTANCE HAMMOND Chapter 3 subtitles Action potentials Introduction (3:15) This third chapter explains the calcium current triggered by the arrival of the action potential in
More informationScientific Editing Report
Acknowledge editing support International publication guidelines such as ICMJE guidelines state that all non-author contributions, including editing, should be acknowledged. If you are satisfied with the
More informationFig. 1. Simple columnar epithelial cells lining the small intestine.
Mitosis Prelab Reading Fig. 1. Simple columnar epithelial cells lining the small intestine. The tall cells pictured in Fig. 1 form the lining of the small intestine in humans and other animals. These cells
More informationMuscle and Muscle Tissue
Muscle and Muscle Tissue Make up about half of total body mass Exerts force by converting chemical energy, ATP, to mechanical energy Muscle tissue is classified based on Shape Number and position of nuclei
More informationComparison and Evaluation of Mitotic Figures in Oral Epithelial Dysplasia using Crystal Violet and Feulgen Stain
Comparison and Evaluation of Mitotic Figures in Oral Epithelial Dysplasia using 10.5005/jp-journals-10024-1527 Crystal Violet and Feulgen Stain Original research Comparison and Evaluation of Mitotic Figures
More informationchapter 4. The effect of oncogenic HPV on transformation zone epithelium
chapter 4. The effect of oncogenic HPV on transformation zone epithelium CHAPTER 1 All squamous cervical cancer (and probably all cervical adenocarcinoma) is associated with oncogenic HPV, and the absence
More informationThe rationale to study EVs from the ES-2 cell line and use as control EVs from a 5th cell line, which has not been previously tested, is unclear.
Reviewers' comments: Reviewer #1 (Remarks to the Author): This study attempts to demonstrate that extracellular vesicles (EVs) shed by aggressive ovarian cancer cells promote metastatic abilities of less
More informationA model of parallel time estimation
A model of parallel time estimation Hedderik van Rijn 1 and Niels Taatgen 1,2 1 Department of Artificial Intelligence, University of Groningen Grote Kruisstraat 2/1, 9712 TS Groningen 2 Department of Psychology,
More informationMyelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity
Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide
More informationM2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination
Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.
More informationVERDIN MANUSCRIPT REVIEW HISTORY REVISION NOTES FROM AUTHORS (ROUND 2)
1 VERDIN MANUSCRIPT REVIEW HISTORY REVISION NOTES FROM AUTHORS (ROUND 2) Thank you for providing us with the opportunity to revise our paper. We have revised the manuscript according to the editors and
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationTitle: TIMP-1 and VEGF-165 serum concentration during first-line therapy of ovarian cancer patients
Author's response to reviews Title: TIMP-1 and VEGF-165 serum concentration during first-line therapy of ovarian cancer patients Authors: Sven Mahner (Sven.Mahner@gmx.de) Linn Woelber (lwoelber@uke.uni-hamburg.de)
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationTITLE: Enhancing the Anti-Tumor Activity of ErbB Blockers with Histone Deaccetylase (HDAC) Inhibition in Prostate Cancer Cell Lines
AD Award Number: W81XWH-05-1-0040 TITLE: Enhancing the Anti-Tumor Activity of ErbB Blockers with Histone Deaccetylase (HDAC) Inhibition in Prostate Cancer Cell Lines PRINCIPAL INVESTIGATOR: Prakash Chinnaiyan,
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More information5.2. Mitosis and Cytokinesis. Chromosomes condense at the start of mitosis. Connecting
5.2 Mitosis and Cytokinesis KEY CONCEPT Cells divide during mitosis and cytokinesis. MAIN IDEAS Chromosomes condense at the start of mitosis. Mitosis and cytokinesis produce two genetically identical daughter
More informationTitle:Validity and Reliability of Arm Abduction Angle Measured on Smartphone: a cross-sectional study
Author's response to reviews Authors: Antonio I Cuesta-Vargas (acuesta.var@gmail.com) Cristina Roldan-Jimenez (CRISTINA.ROLDAN005@gmail.com) Version:3Date:27 January 2016 Author's response to reviews:
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
More informationFebruary 8, World Journal of Gastroenterology. Re: ESPS Manuscript No Dear Dr. Qi:
February 8, 2017 World Journal of Gastroenterology Re: ESPS Manuscript No. 32025 Dear Dr. Qi: My co-authors and I respectfully submit the accompanying revised manuscript, Early hepatitis B viral DNA clearance
More informationTable of Contents. 1. Overview. 2. Interpretation Guide. 3. Staining Gallery Cases Negative for CINtec PLUS
Staining Atlas Table of Contents 1. Overview 1.1 Introduction 1.2 Role of p16 INK4a 1.3 Role of Ki-67 1.4 Molecular Pathogenesis 1.5 p16 INK4a Expression in Cervical Dysplasia 1.6 The Concept of CINtec
More informationINSTRUCTIONS FOR AUTHORS
INSTRUCTIONS FOR AUTHORS Chinese Journal of Integrative Medicine is a peer-reviewed monthly journal sponsored by Chinese Association of Integrative Medicine and China Academy of Chinese Medical Sciences.
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationPulsed Electromagnetic Fields and their Role in Breast Cancer Impedance
Pulsed Electromagnetic Fields and their Role in Breast Cancer Impedance Sarah Stephany, University of Colorado Boulder sarah.stephany@colorado.edu ABSTRACT As the predicted number of deaths due to cancer
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationTitle: Use of food labels by adolescents to make healthier choices on snacks: a cross sectional study from Sri Lanka
Author s response to reviews Title: Use of food labels by adolescents to make healthier choices on snacks: a cross sectional study from Sri Lanka Authors: Ishanka Talagala (drmaheshkeerthi@gmail.com;drishanka@gmail.com)
More informationCell Injury MECHANISMS OF CELL INJURY
Cell Injury MECHANISMS OF CELL INJURY The cellular response to injurious stimuli depends on the following factors: Type of injury, Its duration, and Its severity. Thus, low doses of toxins or a brief duration
More informationTitle: Depression in Medical Students: insights from a longitudinal study
Author s response to reviews Title: Depression in Medical Students: insights from a longitudinal study Authors: Vanessa Silva (avcrsilva@gmail.com) Patricio Costa (pcosta@ecsaude.uminho.pt) Inês Pereira
More informationEPS 625 INTERMEDIATE STATISTICS TWO-WAY ANOVA IN-CLASS EXAMPLE (FLEXIBILITY)
EPS 625 INTERMEDIATE STATISTICS TO-AY ANOVA IN-CLASS EXAMPLE (FLEXIBILITY) A researcher conducts a study to evaluate the effects of the length of an exercise program on the flexibility of female and male
More informationReporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Simon Musall NNA47695 Article Reporting Checklist for Nature Neuroscience # Main Figures: 6 # Supplementary Figures: 14 # Supplementary Tables:
More informationDAPI ASY1 DAPI/ASY1 DAPI RAD51 DAPI/RAD51. Supplementary Figure 1. Additional information on meiosis in R. pubera. a) The
a % 10 Number of crossover per bivalent b 0 1 c DAPI/telomere 80 1 60 40 1 2 20 d 0 0 1 2 >=3 DAPI ASY1 DAPI/ASY1 e DAPI RAD51 DAPI/RAD51 Supplementary Figure 1. Additional information on meiosis in R.
More informationTargeted proteomics reveals strain-specific changes in the mouse insulin and central metabolic pathways after sustained high-fat diet
Molecular Systems Biology Peer Review Process File Targeted proteomics reveals strain-specific changes in the mouse insulin and central metabolic pathways after sustained high-fat diet Eduard Sabidó, Yibo
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSEMINAR ON SERVICE MARKETING
SEMINAR ON SERVICE MARKETING Tracy Mary - Nancy LOGO John O. Summers Indiana University Guidelines for Conducting Research and Publishing in Marketing: From Conceptualization through the Review Process
More informationAuthor's response to reviews
Author's response to reviews Title: Brain metastasis development and poor survival associated with carcinoembryonic antigen (CEA) level in advanced non-small cell lung cancer: a prospective analysis Authors:
More informationCell Division: Mitosis
Cell Division: Mitosis How do eukaryotic cells divide to produce genetically identical cells or to produce gametes with half the normal DNA? BACKGROUND One of the characteristics of living things is the
More informationThe Cell Cycle and Cell Division
Content Vocabulary Directions: On each line, write the term from the word bank that correctly replaces the underlined words in each sentence. NOTE: You may need to change a term to its plural form. cell
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationTitle: What 'outliers' tell us about missed opportunities for TB control: a cross-sectional study of patients in Mumbai, India
Author's response to reviews Title: What 'outliers' tell us about missed opportunities for TB control: a cross-sectional study of patients in Authors: Anagha Pradhan (anp1002004@yahoo.com) Karina Kielmann
More informationTITLE: Identification of Chromosomes Alterations in Primary Breast Cancer Using Premature Chromosome Condensation
AD Award Number: DAMD17-99-1-9237 TITLE: Identification of Chromosomes Alterations in Primary Breast Cancer Using Premature Chromosome Condensation PRINCIPAL INVESTIGATOR: Constance A. Griffin, M.D. CONTRACTING
More information