ALX4, an epigenetically down regulated tumor suppressor, inhibits breast cancer progression by interfering Wnt/β-catenin pathway
|
|
- Gertrude McCormick
- 6 years ago
- Views:
Transcription
1 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 DOI /s RESEARCH Open Aess ALX4, an epigenetially own regulate tumor suppressor, inhiits reast aner progression y interfering Wnt/β-atenin pathway Juntang Yang, Fei Han, Wenin Liu, Hongqiang Chen, Xianglin Hao, Xiao Jiang, Li Yin, Yongsheng Huang, Jia Cao, Huiong Zhang an Jinyi Liu * Astrat Bakgroun: ALX4 is a paire-like homeomain transription fator mainly expresse in the mesenhymal ompartment of variety of eveloping tissues, ut its funtions, regulation mehanisms an linial values in reast aner remains unlear. Methos: The expression of ALX4 in reast aner ell lines an patients tissues were etete y RT-PCR, qpcr an western lot. Furthermore TCGA ataase was applie to onfirm these results. MSP an BSP methos were use to assess the methylation of ALX4 promoter region. In vitro proliferation, metastasis an in vivo nue mie moel were use to evaluate the anti-tumor effet of ALX4 on reast aner ell lines. Luiferase reporter assay, western lot an TCGA ataase were use to investigate the tumor suppression mehanisms of ALX4. TMA of 142 reast patients was generate to evaluate the linial signifiane of ALX4. Results: Expression analysis reveale that ALX4 expression is own regulate in reast aner ell lines an tissues. MSP stuy showe that the promoter region of ALX4 was hyper-methylate 100% (3/3) in reast aner ell lines an 69.44% (75/108) in primary reast tumors tissues while 0% (0/8) in normal reast tissues. 5-aza- emethylation treatment restore ALX4 expression in reast aner ell lines. Funtional stuies showe that etopi expression of ALX4 in reast aner ells inhiite ell proliferation, metastasis in vitro an in vivo. Mehanism stuy foun that ALX4 exerte its anti-tumor funtion y suppressing the Wnt/β-atenin pathway through promoting the phosphorylation egraation of β-atenin in a GSK3β epenent manner. Clinially multivariate analysis showe that ALX4 expression was an inepenent favorale prognosti fator in reast aner patients. Conlusions: We reveal for the first time that ALX4 ats as a novel funtional tumor suppressor inativate y DNA methylation an is an inepenent prognosti fator in reast aner. Keywors: ALX4, DNA methylation, Wnt/β-atenin an reast aner * Corresponene: jinyiliutmmu@163.om Equal ontriutors Institute of Toxiology, College of Preventive Meiine, Thir Military Meial University, 30 Gaotanyan Street, Shapinga Distrit, Chongqing , People s Repuli of China The Author(s) Open Aess This artile is istriute uner the terms of the Creative Commons Attriution 4.0 International Liense ( whih permits unrestrite use, istriution, an reproution in any meium, provie you give appropriate reit to the original author(s) an the soure, provie a link to the Creative Commons liense, an iniate if hanges were mae. The Creative Commons Puli Domain Deiation waiver ( applies to the ata mae availale in this artile, unless otherwise state.
2 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 2 of 15 Bakgroun Aoring to the latest survey, reast aner is the most frequently iagnose an the leaing ause of aner relate eath among female worlwie [1, 2]. Despite the ramati progress ahieve in iagnosti an treatment tehniques, the prognosis for reast aner patients has not inrease signifiantly [3, 4]. To improve the survival rate of reast aner patients, novel strategies espeially moleularly targete therapies are nee to e urgently pursue, thus etter unerstaning of the key moleular hanges in normal ells that lea to malignant tumor ells is of great importane. From the moleular perspetive, the tumorigenesis of reast aner is a multi-step proess omprise of sequential geneti an epigeneti hanges [5, 6]. Despite the loss of heterozygosity an aquire of mutations, aumulating stuies iniate that DNA hypermethylation is the thir most ommon mehanism of the inativation of tumor suppressor gene [7, 8]. Reently a series of methylation-silene tumor suppression genes have een reporte to e assoiate with aner initiation an progression [9, 10]. Thus, the ientifiation of novel funtional genes assoiate with CpG islan methylation may help to provie insights into the mehanisms for the inativation of the tumor suppressive pathways involve in reast aner an ientify etter potential targets for the iagnosis an treatment. ALX4 is a paire-like homeomain transription fator [11] mainly expresse in the mesenhymal ompartment of variety of eveloping tissues [11 17]. We have previously reporte that ALX4 oul suppress lung aner progression y inuing ell apoptosis [18]. Reent stuies showe its tumor-promoting or tumor-suppressive roles in HCC an ovarian aners, iniating its iverse funtions among ifferent types of aner [19, 20]. Previous mie moel stuy emonstrate that ALX4 is require for normal mammary glan morphogenesis uring mouse puerty an lost expression in stromal an epithelial ells in reast tumors [13, 14], suggesting it may e involve in the preanerous lesions of reast aner. In the present stuy we etete the expression an promoter methylation status of ALX4 in reast aner ell lines, normal human reast tissues an primary human reast tumor tissues. Furthermore the iologial funtion, moleular mehanisms an linial signifiane of ALX4 were investigate in reast aner. Materials an methos Cell lines an patient sample The human reast aner ell lines MCF-7, MB-MDA- 231 an T-47D were otaine from the Cell Bank of the Chinese Aaemy of Siene (Shanghai, China) respetively. All ells were ulture in the orresponing meium (reommene y the suppliers) supplemente with 10% fetal ovine serum, an maintaine at 37 C inuator with 5% CO 2. A total of 108 primary paraffin emee reast aner tissue an 8 normal reast tissues of patients who ha mammary anaplasty were ollete from the Southwest Hospital affiliate to the Thir Military Meial University. All experiments an proeures were approve y the Clinial Researh Ethis Committee of the Thir Military Meial University. Reverse-transription polymerase hain reation (RT-PCR) an real-time qrt-pcr analysis Total RNA was extrate from ells an tissues with Trizol (Invitrogen, Carlsa, CA, USA) aoring to the manufaturer s protool. RT-PCR an real-time quantitative PCR analyses were performe as previously esrie [9]. Primer sequenes are liste in Aitional file 1: Tale S1. Western lot an SiRNA WB was performe as previously esrie [9]. After inuation with the seonary antioy, the proteins were etete y hemiluminesene (Millipore Germany). Primary antioies use in this stuy were anti-alx4 (1:1000; Santa Cruz Biotehnology), anti-ctnnb1 (1:700; Santa Cruz Biotehnology), anti-p-ctnnb1 (1800; Santa Cruz Biotehnology), anti-gsk3β (1:800; Santa Cruz Biotehnology), anti--my (1:1000; Santa Cruz Biotehnology), anti-ccnd1 (1:1000; Santa Cruz Biotehnology), anti-mmp7 (1:1000; Aam) an anti-gapdh (1:2000; Beyotime China). The sirna targeting human GSK3β was purhase from Rioio (stq ). Methylation analysis of ALX4 CpG islans y methylationspeifi PCR (MSP) an isulfite genomi sequening (BGS) DNA samples were moifie using the EZ DNA Methylation-Gol Kit (Zymo Researh, Orange, CA, USA). The MSP an BGS were performe as previously reporte [9, 18]. Primers are liste in Aitional file 1: Tale S1. De-methylation experiments Cells were treate with 5-aza-2-eoxyytiine (Sigma) as previously esrie [9]. MTS an EU assay Briefly, 5000 ells per well were seee in 96-well plates an transfete with pires2-egfp-alx4, ALX4-miRNA an ontrol vetors respetively. The asorane was etermine one ay after ells were plate to onfirm the iential ell numer of eah group. Cell viaility was evaluate y with Cell Proliferation Reagent MTS (Promega) aoring to the manufaturer s instrutions. Flow ytometry assay ALX4 or vetor ontrol-transfete ells ( ells per well) were harveste at 48-h post-transfetion, an fixe in 70% ethanol overnight at 4 C. The ells were staine with propiium ioie (BD Pharmingen, San Jose, CA,
3 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 3 of 15 USA). A total of 30,000 ells were sorte y Auri-C6 (BD Biosienes, Franklin Lakes, NJ, USA) an ell yle profiles were analyze using the Flowjo software. Tissue miroarray (TMA) generation A total of 142 primary Breast aner patients who ha unergone surgial resetion with urative intent etween 2004 an 2009, were otaine from the Southwest Hospital in Chongqing, China. The linio-pathologi information was retrieve from the patients eletroni meial reors inluing age, gener, tumor size, histologial grae, lymph noe (negative or positive) an linial stage (efine aoring to Amerian Joint Committee on Caner 7th eition) an follow-up information (5 10 years) for overall survival rates. This stuy was approve y the ethis ommittee of the Southwest Hospital Affiliate to Thir Military Meial University, an all experiments were arrie out in aorane with approve guielines of Thir Military Meial University. Informe onsent was signe y all of the reruite patients. All samples from reast aner patients were reviewe histologially y hematoxylin an eosin staining. To onstrut the TMA slies, two ores were taken from eah representative tumor tissues (within a istane of 20 mm). The tissues were staine with hematoxylin-eosin an then reviewe histologially y at least two pathologists. Dupliate yliners from intratumoral an peritumoral areas were otaine. Finally, the TMAs were onstrute (in ollaoration with Shanghai Biohip Company Lt., Shanghai, China). Immuno-histohemial (IHC) analysis an soring IHC staining was performe using the antioy against ALX4 as esrie previously [21]. The staining was evaluate for the tumor ells. The immunostaining was onsiere positive when 10% of the tumor ells eing immunoreative. A oule-lin metho was arrie out inepenently y two investigators without knowing the patients linial an pathologial features to analyze the IHC results. Three visual fiels from ifferent areas of eah speimen were hosen ranomly for the IHC evaluation. ALX4 expression was sore aoring to staining intensity an the perentage of positive ells as previously esrie [22]. The perentage of positive ells was sore as follows: 0% -10% (0), 11% 30% (1), 31% 50% (2), 51% 80% (3) an 81% 100% (4). Staining intensity was sore as follows: no staining (0), week (1), moerate (2), an strong (3). Comprehensive sore = staining perentage intensity. ALX4 expression was lassifie as follows: 4 low expression, >4 high expression aoring to the meian of 142 reast aner patients. Generation of stale ell lines The ALX4 over expression or knok own ell lines were generate as previously esrie [9, 21]. Briefly the PIRES2-EGFP-ALX4 vetor or the pdna6.2-gw/ EmGFP-miR vetor was transfete using ViaFet transfetion reagent. The staly transfete ells were sreene with G418 (Caliohem, La Jolla, CA, USA) or Blastiiin (Invitrogen Preservation). Single lone was otaine y the yliner metho. Several positive lones were onfirme y qpcr an then mixe for onsequent experiments. Colony formation assay MDA-MB-231 an MCF-7 ells were plate in 6-well plates at ells per well. For knokown, MDA- MB-231-ALX4 an MCF-7-ALX4 staly ells were plate in 6-well plates at ells per well. After ulturing for 24 h, ells were transfete with ALX4 or vetor ontrol an mirna or negative ontrol, respetively. After 48 h of transfetion, ells were ollete, ilute 1:3, plate in 6- well plates an selete with 0.8 mg/ml of G418 or 2 μg/ ml of Blastiiin for 14 ays to estalish stale lones in whih the plasmis ha staly integrate into genomi DNA. Surviving olonies ( 50 ells per olony) were staine y using rystal violet (Sigma-Alrih, St Louis, MO, USA) an ounte. Cell migration an invasion assay For migration assay, ells ( / well) were suspene in 300 μl serum-free meium an seee in the upper transwell hamer (8 μm pore size, BD Biosienes). For invasion assay, ells in serum-free meium were plae into the upper hamer of an insert oate with Matrigel (BD Biosienes). After inuation for 12 h at 37 C, non-migrate or non-invae ells on the upper memrane were remove y a otton swa. Cells that ha migrate or invae through the memrane were staine with 0.1% rystal violet an three fiels were ranomly selete for ell numer ounting. Animal experiments BALB/-nue mie (4 5 weeks of age, g) were purhase from the Center of Experimental Animal of Thir Military Meial University, China an house in a sterile environment. For tumor formation experiment six 4- week-ol female BALB/-nue mie were ranomly ivie into two groups (n = 3/group). MDA-MB-231 ells ( ) with ALX4 or ontrol vetor staly expression were injete suutaneously into the right flanks of the nue mie, respetively. The tumor volume was etermine using the eq. V = 0.5 D 2 (V, volume; D, longituinal iameter;, latituinal iameter). The eveloping tumors were oserve over the next 33 ays. For metastasis experiment six 4-week-ol female BALB/-nue mie were ranomly ivie into two groups (n = 3/group) an MDA-MB-231 ells ( ) with ALX4 or ontrol vetor staly expression were injete via tail veins, respetively.
4 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 4 of 15 Tumor metastasis were oserve y H&E staining an qualifie y human-speifi β 2 -MG (eta-2-mirogloulin) [23] 5 weeks later. All experimental animal proeures were approve y the Institutional Animal Care an Use Committee of Thir Military Meial University, China. TOP/FOP flash reporter assays The previously reporte promoter region for CTNNB1 ( 2760/+27) was amplifie an lone into the pgl3 vetor (Promega, Maison, WI, USA) [24]. MDA-MB-231 an MCF-7 ells were transfete with the pgl3-ctnnb1/ promoter together with pires2-egfp-alx4 or ontrol vetor an prtk-lu (Renilla-TK-luiferase vetor, Promega) to normalize the transfetion effiieny. 36 h later, the ativities of Firefly luiferase an Renilla luiferase were measure using the Dual Luiferase Reporter Assay System (Promega). For TOP an FOP flash assay, MDA-MB-231 an MCF-7 ells were plate into 24-well plates at a onentration of ells per well. Cells were otransfete with 300 ng of either TOP flash (T-ell fator reporter plasmi) or FOP flash (mutant T-ell fator reporter plasmi) expression plasmis (Millipore, Temeula, CA, USA), an 300 ng of pires2-egfp-alx4 or ontrol vetor an 30 ng prl-tk. Luiferase ativity was measure in tripliate using the fluoresene miroplate reaer measurement system Varioskan LUX (Thermo Fisher, Waltham, MA, USA) using a Dual-luiferase reporter kit (Promega) as previously esrie [25]. Analysis of pulily availale atasets TCGA ataset ( site/xena) was applie to analysis the relationship etween ALX4 expression prognosti outomes of reast aner patients. Log in the wesite an lik launh Xena Browser an in the first setion Selet a Stuy to Explore, selet TCGA reast aner (BRCA) ata set in the ase of our stuy. In the seon setion Selet Your First Variale, selet Phenotypi for the ata type an sample type for the Phenotype. In the thir setion Selet Your Seon Variale, selet Genomi for the ata type an input the gene name ALX4 then selet Gene expression. When all the parameters are selete we will proee to the next page an input Primary tumor in the filter ations an lik Filter. Finally lik Kaplan Meier plotter the relationship etween ALX4 expression prognosti outomes of reast aner patients will e showe. The TCGA reast aner RNAseq (IlluminaHiSeq; N = 1124) ata was applie to analyze the expression of ALX4 an genes relate to Wnt/β-atenin signaling. The heat maps of gene expression were generate using First lik a atasets on the left orner an the selet TCGA reast aner RNAseq (IlluminaHiSeq; N = 1124). By inputting the gene names the expression heap map will e generate automatially. For statistially analysis, own loa the raw ata in.tgz form an open it with Exel software an analyze the ata with relative statistial methos. Statistial analysis Statistial analyses were performe using the SPSS 16.0 software (SPSS, In., Chiago, IL). Data were expresse as means ± stanar eviation (SD). Kaplan-Meier survival plots an the Cox regression methos were use to ompare the survival outome etween two ALX4 expression groups. The relationship etween ALX4 expression an linial-pathologial parameters was analyze y Chi-square test an Linear-y-Linear Assoiation (2-sie). P-value <0.05 was onsiere to enote statistial signifiane. Results ALX4 expression is own regulate in reast aner ell lines an tissues The expression status of ALX4 in reast aner ell lines an normal reast tissues were etete y RT-PCR, qrt- PCR an WB. The results showe that ALX4 was own regulate in reast aner ell lines ompare with the normal reast tissues oth on mrna an protein level (Fig. 1a, ). To further onfirm this oservation, the expression pattern of ALX4 was susequently analyze using The Caner Genome Atlas (TCGA) ataase (111 normal reast tissue an 1097 reast aner tissue). Consistent with our results, ALX4 expression was own regulate in TCGA reast aner tissues ompare with normal reast tissues (P <0.01) (Fig. 1). Colletively these results suggeste that ALX4 was own regulate in reast aner, thus it may play an important role in reast aner evelopment. Methylation of ALX4 is assoiate with its own regulation in reast aner Our previous stuy on lung aner has ientifie numers of CpG islans on the ALX4 promoter region [18] an epigenetially silening y promoter hyper-methylation have een reporte to e a major reason for gene own regulation [25 27]. To investigate whether the expression of ALX4 was assoiate with promoter methylation in reast aner, the methylation status of the ALX4 promoter region was firstly etete y MSP. Complete methylate status was oserve in three reast aner ell lines MDA-MB-231, MCF-7 an T47D (Fig. 1). We further examine the methylation of linial samples an the results showe that the methylation rate of the promoter region of ALX4 gene was 69.44% (75/108) in reast aner tissues of patients, an 0% (0/8) in 8 normal reast tissues (Fig. 1). To further valiate the aove results, we use the BSP metho to quantitatively etet the methylation status of ALX4 promoter in normal reast tissue an two ommonly use reast aner ell lines. The results showe that CpG islan methylation was not etete in
5 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 5 of 15 a e f Fig. 1 The own regulation of ALX4 in reast aner is ause y promoter methylation. a Analysis of ALX4 mrna expression levels in normal reast tissues an reast aner ells using RT-PCR an qpcr. ALX4 was own regulate in reast aner ells ompare with normal reast tissues. The protein expression of ALX4 was etete in normal reast tissues an reast aner ells. Down regulation of ALX4 in reast aner patients was further onfirme using TCGA ataase. ALX4 mrna expressioninthetcgareastanerrnaseq(illuminahiseq;n = 1208, normal tissue = 111, reast aner tissue = 1097) ata sets. Error ars iniate s.. ** P < ALX4 promoter methylation was analyze y MSP metho. ALX4 gene promoter was methylate in reast aner ell lines, unmethylate in all normal reast tissues an frequently methylate in reast tumor tissues. M: PCR prout amplife y methylate -speifi primers; U: PCR prout amplife y unmethylate speifi primers; N: normal tissue; T: tumor tissues; PC: positive ontrol, inluing fully unmethylate or fully methylate ontrol; NC: negative ontrol. e Methylation status of ALX4 promoter region of normal reast tissue an reast aner ell lines was analyze y BSP metho. CpG islans were represente as open ots (unmethylate) or fille ots (methylate). f Re-expression of ALX4 in MDA-MB-231 an MCF-7 ell lines after treatment y pharmaologi emethylation. : DMSO ontrol; +: 5-aza-C the ranomly selete normal reast tissue, while signifiant CpG islan methylation was etete in the two reast aner ell lines MDA-MB-231 an MCF-7 (Fig. 1e). These aove results emonstrate that the promoter region of ALX4 exhiite hyper-methylation status in reast aner. To investigate the relationship etween low expression an methylation status of ALX4, we first analyze the TCGA ata using ioportal wesite ( After ownloaing the original ata, we analyze the relationship etween methylation an expression, an foun the expression of ALX4 gene was negatively orrelate with the methylation egree (P < 0.00) (Aitional file: Fig. S1). In orer to further verify that own regulation of ALX4 in reast aner is relate to methylation, reast aner ell lines were treate with 5-aza-, a pharmaologial inhiitor of DNA methylation as previously esrie [9, 28] an the results showe that ALX4 expression was restore (Fig. 1f). These results iniate that promoter methylation is responsile for the own regulation of ALX4 in reast aner. ALX4 over expression inhiits reast aner ell proliferation, migration an invasion in vitro To investigate the funtion of ALX4 in reast aner, we first transfete MDA-MB-231 an MCF-7 ell lines using ontrol vetor an ALX4 expression vetor an verifie the expression of ALX4 y WB an RT-PCR (Fig. 2a). The effets of ALX4 over expression on ell proliferation an viaility were firstly etete. A four ays growth urve showe that ALX4 over expression inhiite the proliferation of MDA-MB-231 an MCF-7 ells (Fig. 2). The suppressive funtion of ALX4 was further verifie y olony formation assay an EDU assay. ALX4 over expression inhiite the olony formation an the EDU positive rate of MDA- MB-231 an MCF-7 ell lines (Fig. 2, ). Furthermore, we foun that ALX4 over expression inue G1 / S lokae of reast aner ell lines (Fig. 2e). We
6 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 6 of 15 a e f Fig. 2 ALX4 suppresses reast aner ell proliferation an metastasis in vitro. a Transfetants of the ontrol vetor an ALX4 were ientifie WB an RT-PCR in MDA-MB-231 an MCF-7 ell lines. MTS assays were performe to examine the effet of ALX4 over expression on the relative numer of viale ells ase on the asorane. Over expression of ALX4 reue the olony formation aility of MDA-MB-231 an MCF-7 ell lines. Error ars iniate s.. (n = 3).* P < 0.05, ** P < EDU assay was performe to etet the effet of ALX4 over expression on proliferation. e Cell yles were analyze after ALX4 over expression using PI stainning. f Transwell assays were use to examine the effet of ALX4 on ell migration an invasion in MDA-MB-231 an MCF-7 ell lines further investigate the effet of ALX4 on reast aner ell metastasis. Transwell assays with or without matrix gel showe that ALX4 suppresse the migration an invasion aility of MDA-MB-231 an MCF-7 (Fig. 2f). These ata suggeste that ALX4 inhiite the proliferation an metastasis of reast aner ell lines. Knokown of ALX4 expression reover ell proliferation, migration an invasion of reast aner ells To further onfirm the role of ALX4 in reast aner ell growth an metastasis. We knoke own ALX4 expression in the MDA-MB-231-ALX4 an MCF-7-ALX4 staly ell lines with ALX4-miRNA. ALX4 expression was reue in ells
7 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 transfete with ALX4-miRNA as shown y WB an RT-PCR (Fig. 3a). Knokown of ALX4 markely enhane ell viaility an olony formation aility ompare with the ontrol group (Fig. 3, ). Furthermore, knokown of ALX4 reverse the inhiitory effet on ell metastasis of MDA-MB-231-ALX4 an MCF7-ALX4 staly ells (Fig. 3). These knokown results, together with the aove otaine ata from ALX4 over expression stuy suggeste that ALX4 might funtion as a potential tumor suppressor in reast aner. Page 7 of 15 Overexpression of ALX4 inhiits tumor formation an metastasis in nue mie To further investigate the tumor suppression funtion in vivo, nue mie xenograft tumor moel was applie to etermine the onogeni role of ALX4 in tumorigeniity of reast aner ells. MDA-MB-231-ALX4 an vetor ontrol staly over expression ells were suutaneously injete into nue mie to evaluate the effet on tumor formation. The result showe that mie reeiving MDA-MB-231-ALX4 staly ells exhiite a Fig. 3 Knokown of ALX4 in MDA-MB-231-ALX4 an MCF-7-ALX4 staly ells reovere the inhiition effet. a Knokown of ALX4 in MDA-MB231-ALX4 an MCF-7-ALX4 staly ells was ientifie y WB an RT-PCR. MTS assays were use to examine the effet of ALX4 knokown on the relative numer of viale ells ase on the asorane. Knokown of ALX4 reovere the olony formation aility. Transwell assays were performe to examine the effet of ALX4 knokown on ell migration an invasion. Error ars iniate s.. (n = 3).* P < 0.05; ** P < 0.01
8 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 8 of 15 signifiantly reue tumor formation aility ompare with vetor ontrol ells (Fig. 4A-C). Furthermore, we investigate the effet of ALX4 over expression on reast aner ells metastasis in vivo via tail veins injetion metho. H&E staining results showe that ALX4 oul suppress the liver metastasis (Fig. 4D) an this oservation was further onfirme y qpcr using human-speifi β 2 - MG (eta-2-mirogloulin) [23] with mouse-speifi β 2 - MG as internal ontrol (Fig. 4E). Colletively, these ata iniate that ALX4 ha a signifiant effet on impeing tumor formation an metastasis, supporting ALX4 as a tumor suppressor in reast aner in vivo. ALX4 exerts its anti-aner funtion via Wnt/β-atenin pathway y egraation of β-atenin in reast aner We next went to explore the possile mehanism y whih ALX4 suppresse reast aner progression. Aumulating eviene suggeste that anormally ativate Wnt/β-atenin pathway ontriute to the malignant phenotype of reast aner [29 31]. Using the TCGA ata ase, we foun that ALX4 expression was positively orrelate with the negative regulator of Wnt/βatenin pathway, suh as WIF1 an CTNNBIP1, ut negatively orrelate with Wnt/β-atenin ativate genes, LEF1 an Cylin D1 (Fig. 5a) (Aitional file 1: Figure S2 A, B). In light of this oservation, we hypothesize that ALX4 may exerte its inhiitory funtion y isrupting the Wnt/β-atenin signal. To test this presumption, we first performe Top/Fop flash reporter assay, the results showe that ALX4 oul signifiantly inhiit the transription ativity of β-atenin/t-ell fator (TCF) ompare with the vetor ontrol group in MDA-MB-231 an MCF-7 ell lines (Fig. 5). We susequently analyze the expression of the ownstream target genes of Wnt/β-atenin pathway, an foun that ALX4 oul erease the mrna an protein level of CylinD1, -My an MMP7 (Fig. 5, ). Next we thought to figure out the possile mehanism y whih ALX4 oul interrupt the Wnt/βa e Fig. 4 ALX4 inhiits tumor formation an metastasis in nue mie. a Control vetor an ALX4 staly expressing MDA-MB-231 ells ( ) were suutaneously injete into the right flank of nue mie. Pitures of BALB/-nue mie an soli tumor tissues were taken after 33 ays. The tumor growth urve of ALX4 over expressing ells was ompare with vetor ontrol ells. Tumor weights in the vetor ontrol an ALX4 groups were etermine. Error ars iniate s.. (n = 3). Liver metastases were oserve y H&E staining in the ontrol group ut not in the ALX4 group y tail veins injetion metho. Arrows iniate the metastati loi. e Liver metastasis was further quantifie using RT-qPCR. Human-speifi β 2 -MG levels were use to quantify metastati human aner ells with the mouse-speifi β 2 -MG level as an internal ontrol. The nue mie that were injete with ALX4 over expressing ells emonstrate a signifiantly lower numer of metastati aner ells in the liver ompare with those that were injete with an empty ontrol. Error ars iniate s.. (n = 3).*P <0.05;**P <0.01
9 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 9 of 15 a Fig. 5 ALX4 suppresses the Wnt/β-atenin pathway. a ALX4 was positively orrelate with CTNNBIP1 expression (R = 0.093, P = 0.00) an negatively orrelate with Cylin D1 expression (R = 0.102, P = 0.00). ALX4 erease the transriptional ativity of the Wnt/β-atenin pathway as etermine y a TOP flash/fop flash reporter luiferase ativity assay in MDA-MB-231 an MCF-7 ell lines. TOP an FOP flash plasmis were o-transfete with ontrol vetor or ALX4 an PRL-TK plasmis in MDA-MB-231 an MCF-7 ells., ALX4 inhiite the expression of Wnt/ β-atenin pathway target genes at oth the mrna an protein levels. Error ars iniate s.. (n = 3). *P < 0.05; **P < 0.01 atenin signaling. As a transription fator, we first examine the effet of ALX4 over expression on the transription of β-atenin (the key signal transmitter involve in Wnt/β-atenin pathway). However, luiferase reporter assay showe that ALX4 ha no signifiant inhiition effets on the transription of β-atenin in the two reast aner ell lines (Fig. 6a). Furthermore no signifiant hange was oserve for the mrna expression of β- atenin after ALX4 overexpression (ata not shown). Nevertheless we foun that the protein level of β-atenin was erease after ALX4 expression (Fig. 6). Aumulating eviene iniate that the protein level of β- atenin was tightly ontrolle y the egraation omplex ompose y AXIN, ICAT, APC an GSK-3β y whih GSK-3β phosphorylates β-atenin leaing to its proteolyti egraation [32 35]. Thus we speulate that ALX4 may promote the phosphorylation egraation of β-atenin. To test this hypothesis, we etete the relative protein expression an the results showe that ALX4 inue the level of p-β-atenin an GSK-3β (Fig. 6). To further investigate whether GSK3β play important role in ALX4 meiate β-atenin phosphorylation an egraation, we knoke own GSK3β expression in MDA-MB-231- ALX4 staly ell line using sirna an the level of p-βatenin was reue while the protein level of β-atenin was reovere (Fig. 6). We further onsoliate our oservation y eteting the expression of ALX4, β-atenin, p-β-atenin an GSK-3β in xenograft tumor tissues y WB (Fig. 6). Furthermore, y analyzing the TCGA reast aner ata, we foun that the expression of ALX4 was positively orrelate with the expression of the key memers of the β-atenin egraation omplex (Aitional file 1: Figure S2C). To efine whether β-atenin was require for the anti-tumorigenesis funtion of ALX4, we re-expresse β-atenin in MDA-MB-231-ALX4 staly ell line (Fig. 7a). β-atenin re-expression reverse the inhiitory effet of ALX4 on ell proliferation an metastasis (Fig. 7, ). These ata iniate that β-atenin was important for the tumor suppression funtion of ALX4 in reast aner. We further examine the effet of GSK3β knok own on the phenotypes of MDA-MB-231-ALX4 staly ell line. Knok own of GSK3β was onfirme y WB (Fig. 7), an the results showe that knok own of GSK3β oul reverse the inhiitory effets of ALX4 on ell proliferation an metastasis at least in part (Fig. 7e, f). Taken together our results supporte that ALX4 inhiite the progression of reast aner through interfering Wnt/ β-atenin signaling via promoting phosphorylation egraation of β-atenin in a GSK3β epenent manner (Fig. 7g). The low expression of ALX4 is assoiate with poor survival outomes of reast aner patients To investigate the linial signifiane of ALX4 expression in reast aner patients, we first onute IHC on a TMA ontaining 142 reast aner patients with overall survival linial statistis. After IHC, we use the
10 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 10 of 15 a Fig. 6 ALX4 represses the Wnt/β-atenin pathway y promoting the phosphorylation egraation of β-atenin. a The full length human β-atenin promoter ( 2760 p to +27 p) was lone into the PGL3-Basi luiferase reporter vetor. The β-atenin transription ativity was examine after etopi expression of ALX4 in MDA-MB-231 an MCF-7 ell lines. ALX4 promote the phosphorylation egraation of β-atenin in reast aner ell lines. Knok own of GSK3β y sirna in MDA-MB-231-ALX4 ells erease the p-β-atenin an reovere the protein level of β-atenin. The protein expression of β-atenin, p-β-atenin an GSK3β were etete in xenograft tumors soring system to onsoliate the results for intensity an positive staining perentage. Base on the results, positive staining of tumor ell was quantifie an lassifie into two groups: high an low aoring to the meian sore of 142 reast aner patients (Fig. 8a). Survival analysis using Kaplan-Meier metho an log rank test showe that patients with high ALX4 expression (n = 42) presente a longer survival time than that of low ALX4 expression (n =100)(P < 0.01) (Fig. 8). To orret for ias ause y univariate analysis, ALX4 expression as well as other parameters were examine in a multivariate Cox-regression analysis (after ajusting for age, histologial grae, linial stage, tumor size an lymph noe status). In aition to tumor size (HR = 1.268, P = 0.00), ALX4 expression was foun to e an inepenent prognosti fator (HR = 0.345, P = 0.01) for the overall survival of reast aner patients (Fig. 8). To further onfirm these results, we performe a meta-analysis of the assoiation etween ALX4 gene expression an prognosti outomes among 1080 reast aner patients using the TCGA ata ase. The results showe that high expression of ALX4 preite longer survival time (n = 1080, p = 0.00, 2 group; n = 1080, p = 0.03, 3 group) (Aitional file 1: Figure S4). Next, we sought to etermine the impat of ALX4 expression on patient survival onsiering tumor size, linial stage, lymph noe an histologial grae. After stratifying patients ase on ALX4 expression, we analyze patients survival ata an foun a signifiant assoiation etween ALX4 expression an patients at linial stages II + III (P = 0.00) (Fig. 8, e). We further investigate the relationship etween ALX4 expression an linial parameters, an foun that ALX4 expression was eviently orrelate to linial stages (n = 140, P = 0.01), tumor size (n = 142, P = 0.01) an lymph noe status (n = 138, P = 0.00) of reast aner patients (Tale 1). Taken together our ata showe that ALX4 is an inepenent favorale prognosti fator for reast aner patients an its expression is assoiate with linial parameters. Disussion Homeoox genes are a family of genes that share highly onserve struture while maintaining a high egree of iversity [36, 37]. Its onserve sequenes enoe proteins ontaining homologous omains that are apale of ining DNA whih enow them with the aility to e involve extensively in the proess of emryos, tissues an organs evelopment an human iseases [36, 37]. ALX4, a paire-like homeomain transription fator, is mainly expresse in the mesenhymal ompartment of variety of
11 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 a Page 11 of 15 e f g Fig. 7 ALX4 inhiite the progression of reast aner via promoting phosphorylation egraation of β-atenin in a GSK3β epenent manner. a The expression of ALX4 an β-atenin was analyze y WB 48 h after transfetion with ontrol vetor or β-atenin over expression vetor in MDA-MB-231-ALX4 ells. MTS assays were use to examine the effet of β-atenin re-expression on ell proliferation in MDA-MB-231-ALX4 ells. Transwell assays were use to examine the effet of β-atenin re-expression on ell metastasis of MDA-MB-231-ALX4 ell. The expression of ALX4 an GSK3β was analyze y WB 48 h after transfetion with ontrol vetor or GSK3β sirna vetor in MDA-MB-231-ALX4 ells. e MTS assays were use to examine the effet of GSK3β knok own on ell proliferation in MDA-MB-231-ALX4 ells. f Transwell assays were use to examine the effet of GSK3β knok own on ell metastasis in MDA-MB-231-ALX4 ell. g Shemati iagram of the mehanisms of ALX4 meiate suppression of reast aner ell proliferation an metastasis ase on our stuy. ALX4 reues the protein level of β-atenin y promoting its phosphorylation egraation via up regulation of GSK3β, whih susequently inhiits the ativation of Wnt/β-atenin signaling eveloping tissues suh as skull an lims [11 17]. Reent stuies showe its opposing roles in HCC an ovarian aners via istint mehanisms [20, 38] iniating the funtions an regulation mehanisms of ALX4 in the progression of ifferent tumor remain largely uninvestigate. In the present stuy we firstly showe that ALX4 was own regulate in reast aner. Using MSP an BSP methos we foun that the promoter region of ALX4 was frequently methylate in reast aner an emethylation treatment oul reover the expression of ALX4. These results iniate that hyper-methylation ontriute to the own regulation of ALX4 in reast aner. Stuies have shown that DNA methylation patterns in tumourigenesis is omprise of genome-wie hypo-methylation an CpG islans hyper-methylation an its main signifiane may e the moleular asis for tumor suppressor gene inativation, proto-onogene ativation an genomi instaility [7, 8, 39]. Reently, numers of epigenetially silene genes were prove to e tumor suppressor in ifferent types of aner [9, 25, 40, 41]. These evienes inite that ALX4 may e involve in the tumorigenesis of reast aner. Thus gain an loss of funtion stuies were arrie out to examine the funtion of ALX4 in reast aner. Etopi expression of ALX4 inue apoptosis (ata not shown) an G1/S loking thus inhiite the proliferation of reast aner ells in vitro. Distane invasiveness is another malignant phenotype whih ontriutes to the high mortality of reast aner [5, 6] an we foun that ALX4 oul attenuate the metastasis aility of reast aner ell lines in vitro an in vivo. These ata suggeste that ALX4 funtion as a tumor suppressor in reast aner. Previous stuy foun that ALX4 promote ovarian aner invasion y forming a omplex with HOXB13 [20] ut our ata showe that ALX4 inhiite reast aner metastasis.
12 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 12 of 15 a e Fig. 8 High expression of ALX4 preits a longer survival time in reast aner patients. a 142 reast aner patients were ivie into two groups aoring to the expression of ALX4 y ientifie y IHC. Sale ar, 100 μm. Kaplan-Meier survival analysis of ALX4 expression in reast aner patients. Long OS was oserve in the high ALX4 expression group ompare with the low ALX4 group. Multivariate Coxregression analysis of the relationship etween ALX4 expression an OS of reast aner patients. ALX4 was etermine to e an inepenent favorale prognosti fator. Kaplan-Meier survival analysis of ALX4 expression in reast aner patients at linial stage II + III. Long OS was oserve in the high ALX4 expression group ompare with the low ALX4 group. e Multivariate Coxregression analysis of the relationship etween ALX4 expression an OS of reast aner patients at linial stage II + III. ALX4 was etermine to e an inepenent favorale prognosti fator These results suggeste that the funtion of ALX4 varie epening on ifferent aner types iniating its important roles in tumorigenesis. We further etermine the possile mehanisms of the tumorinhiitioneffetofalx4inreastaner.anormal ativating of Wnt/β-atenin signaling has een reognize as an important mehanism of reast aner initiation an progression [29 31]. We foun that etopi expression of ALX4 oul inhiit the anonial Wnt signaling ativity in reast aner y TOP/FOP flash reporter assay an the Wnt target funtional genes MMP7, -My an Cylin D1 were own regulate oth at protein an mrna level. These results emonstrate that ALX4 suppresse reast aner progression y inhiiting the Wnt/β-atenin pathway. We have previously showe that ALX4 suppresse lung aner proliferation y ativating the aspase asae [18] an a reent stuy showe that ALX4 suppresse the EMT of liver aner y inhiiting the soni hegehog (Shh) pathway [38]. These results iniate that the moleular mehanisms of ALX4 as tumor suppressor may e varie among ifferent aner types. We further investigate the possile mehanism y whih ALX4 inhiiting the Wnt/β-atenin pathway. In the anonial Wnt/β-atenin signaling, β-atenin funtions as a key meiator to ativate the expression of Wnt target genes thus promoting ell proliferation an metastasis [42 45] an a previous stuy foun that β- atenin is require for the tumorigeni ehavior of
13 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 13 of 15 Tale 1 Correlation etween ALX4 expression an linial parameters from TMA ata ALX4 expression Clinial parameter Total High Low P value Clinial stages I II III Histologial grae Lymph noe status Negative Positive Tumor size < 3 m m Her Positive Negative PR Positive Negative ER Positive Negative reast aner ells [46]. Our ata showe that etopi expression of ALX4 reue the protein level of β-atenin ut ha no signifiant effets on the transription of β- atenin. Previous stuies have suggeste that the protein level of β-atenin is tightly ontrolle y the estrution omplex ompose y APC AXIN, ICAT an GSK-3β [32, 44, 47, 48] through whih β-atenin is finally phosphorylate y GSK-3β at the Ser33 an Ser37 leaing to its proteolyti egraation [49 51]. We foun that ALX4 oul erease the protein level of β-atenin y promoting its phosphorylation via upregulating the GSK3β.Aumulating eviene iniate that GSK3β meiate β-atenin phosphorylation is the key step to generate the β-trcp-ining site for the susequent egraation [35, 52, 53]. A reent stuy in HCC also showe that GSK-3β suppresses HCC ell issoiation in vitro y inhiiting Wnt/β-atenin signaling pathway [19]. Furthermore we foun that the expression of ALX4 was positively orrelate with the expression of the key memers of the β-atenin egraation omplex. Colletively, our ata suggeste for the first time that ALX4 exerte its inhiitory funtion y suppressing the Wnt/β-atenin pathway through promoting the phosphorylation egraation of β-atenin in a GSK3β epenent manner. Aumulating stuies have iniate that the ifferent expression pattern of gene showe tight orrelation with the linial progression of aner patients [22, 25]. Despite the ramati progress ahieve in reast aner relate iagnosti an treatment tehniques, the prognosis for reast aner patients has not inrease signifiantly, thus ientifiation of novel iomarker is in urgent nee [3, 4]. Therefore, to evaluate the linial signifiane of ALX4 in reast aner patient, we performe a tissue miroarray on 142 reast aner patients with linial an survival ata. We foun that ALX4 expression is an inepenent favorale prognosti fator an is in tight relationship with linial stages, tumor size an lymph noe status in reast aner patients. These ata suggeste that the expression of ALX4 may provie information for preiting the survival of reast aner patients. Conlusions In summary, our stuy iniates for the first time that ALX4 is an epigenetially inativate tumor suppressor in reast aner ating through inhiition the Wnt/β-atenin pathway. This as to our urrent knowlege of the tumorigenesis proess of reast aner. Furthermore the expression of ALX4 is an inepenent favorale prognosti fator in reast aner patients an is in tightly relationship with tumor progression. This may provie a new iomarker to preit the survival of reast aner patients. Aitional file Aitional file 1: Figure S1. The orrelation etween ALX4 expression an methylation was analyze using TCGA ata set ( A: Cohort1:TCGA, Cell 2015, n = 552;Cohort2. B: TCGA, Provisional 2012, n = 656 Figure S2. Analysis the relationship etween ALX4 an Wnt/β-atenin suppression an ativation genes in reast aner using TCGA Dataase. (A) ALX4 was positively orrelate with WIF1 expression (R = 0.503, P = 0.00). (B) ALX4 was negatively orrelate with LEF1 expression (R = 0.062, P = 0.03). (C) AXL4 was positively orrelate with the expression of the key memers of βatenin egraation omplex Figure S3. The illustration of full length human β-atenin promoter ( 2760 p to +27 p) that was lone into the PGL3-Basi luiferase reporter vetor Figure S4. Relationship etween ALX4 expression an survival of reast aner patients retrieve from puli atasets( (A) Survival analysis using TCGA ataset, the results showe that high expression of ALX4 preite longer survival time (n = 1080, p = 0.00, 2 group). (B) Survival analysis using TCGA ataset the results showe that high expression of ALX4 preite longer survival time (n = 1080, p = 0.03, 3 group) Tale S1. Primers use in this stuy. (DOCX 895 k) Areviations AlX4: Aristaless-like homeoox-4; BSP: Bisulfite genomi sequene; H&E: Hematoxylin-eosin staining; IHC: Immunohistohemistry; MSP: Methylation speifi PCR; OS: overall survival; TCGA: The Caner Genome Atlas; TMA: Tissue miroarray analysis
14 Yang et al. Journal of Experimental & Clinial Caner Researh (2017) 36:170 Page 14 of 15 Aknowlegements The authors thank the Institute of Caner, Southwest Hospital for proviing human reast normal an tumor tissues. Funing This work was supporte y the National Natural Siene Founation of China [No , an ]. Availaility of ata an materials The atasets generate an/or analyze uring the urrent stuy are availale in the: an hgheatmap/. Authors ontriutions JY, FH an JL oneive the stuy; JY, FH an WL esigne the experiments. JY, HC an XH ollete the patients samples an onute the experiments; XJ, LY an YH analyze the online ataase; JY an FH interprete the ata an wrote the manusript; HZ an JL supervise the stuy. JC an JL provie with valuale avies, an proofrea the manusript. All authors rea an approve the final manusript. Ethis approval an onsent to partiipate All sujets signe an informe onsent form. This stuy was approve y the ethis ommittee of the Southwest Hospital, affiliate with Thir Military Meial University. Moreover, written onsent was reeive from patients. Animal researh was approve y the Institutional Animal Care an Use Committee of Thir Military Meial University. Consent for puliation Not appliale. Competing interests The authors elare that they have no ompeting interests. Pulisher s Note Springer Nature remains neutral with regar to jurisitional laims in pulishe maps an institutional affiliations. Reeive: 23 Septemer 2017 Aepte: 20 Novemer 2017 Referenes 1. Chen W, Zheng R, Baae PD, Zhang S, Zeng H, Bray F, Jemal A, XQ Y, He J. Caner statistis in China, CA Caner J Clin. 2016;66(2): Siegel RL, Miller KD, Jemal A. Caner statistis, CA Caner J Clin. 2017; 67(1): MB A, VS R, ME J, AO A. Breast aner iomarkers: risk assessment, iagnosis, prognosis, preition of treatment effiay an toxiity, an reurrene. Curr Pharm Des. 2014;20(30): Bertozzi S, Lonero AP, Ceolini C, Uzzau A, Seriau L, Bernari S, Bahetti S, Pasqual EM, Risaliti A. Prevalene, risk fators, an prognosis of peritoneal metastasis from reast aner. SpringerPlus. 2015;4: Charafe-Jauffret E, Ginestier C, Iovino F, Tarpin C, Dieel M, Esterni B, Houvenaeghel G, Extra JM, Bertui F, Jaquemier J, et al. Alehye ehyrogenase 1-positive aner stem ells meiate metastasis an poor linial outome in inflammatory reast aner. Clin Caner Res. 2010;16(1): Mego M, Mani SA, Cristofanilli M. Moleular mehanisms of metastasis in reast aner linial appliations. Nat Rev Clin Onol. 2010;7(12): Esteller M. Caner epigenomis: DNA methylomes an histone-moifiation maps. Nat Rev Genet. 2007;8(4): Rish A, Plass C. Lung aner epigenetis an genetis. Int J Caner. 2008; 123(1): Han F, Liu W, Jiang X, Shi X, Yin L, Ao L, Cui Z, Li Y, Huang C, Cao J, et al. SOX30, a novel epigeneti silene tumor suppressor, promotes tumor ell apoptosis y transriptional ativating p53 in lung aner. Onogene. 2015; 34(33): Zhu H, Wu K, Yan W, Hu L, Yuan J, Dong Y, Li Y, Jing K, Yang Y, Guo M. Epigeneti silening of DACH1 inues loss of transforming growth fatoreta1 antiproliferative response in human hepatoellular arinoma. Hepatology. 2013;58(6): Wuyts W, Cleiren E, Homfray T, Rasore-Quartino A, Vanhoenaker F, Van Hul W. The ALX4 homeoox gene is mutate in patients with ossifiation efets of the skull (foramina parietalia permagna, OMIM ). J Me Genet. 2000;37(12): Qu S, Tuker SC, Ehrlih JS, Levorse JM, Flaherty LA, Wisom R, Vogt TF. Mutations in mouse Aristaless-like4 ause Strong's luxoi polyatyly. Development. 1998;125(14): Chang H, Mohair N, Done S, Hamel PA. Loss of ALX4 expression in epithelial ells an ajaent stromal ells in reast aner. J Clin Pathol. 2009;62(10): Joshi PA, Chang H, Hamel PA. Loss of Alx4, a stromally-restrite homeoomain protein, impairs mammary epithelial morphogenesis. Dev Biol. 2006;297(1): Kayserili H, Uz E, Niessen C, Vargel I, Alanay Y, Tunilek G, Yigit G, Uyguner O, Canan S, Okur H, et al. ALX4 ysfuntion isrupts raniofaial an epiermal evelopment. Hum Mol Genet. 2009;18(22): Kuijper S, Feitsma H, Sheth R, Korving J, Reijnen M, Meijlink F. Funtion an regulation of Alx4 in lim evelopment: omplex geneti interations with Gli3 an Shh. Dev Biol. 2005;285(2): Valente M, Valente KD, Sugayama SS, Kim CA. Malformation of ortial an vasular evelopment in one family with parietal foramina etermine y an ALX4 homeoox gene mutation. AJNR Am J Neuroraiol. 2004;25(10): Liu WB, Han F, XH D, Jiang X, Li YH, Liu Y, Chen HQ, Ao L, Cui ZH, Cao J, et al. Epigeneti silening of Aristaless-like homeoox-4, a potential tumor suppressor gene assoiate with lung aner. Int J Caner. 2014;134(6): Zhang JH, Jiao LY, Li TJ, Zhu YY, Zhou JW, Tian J. GSK-3eta suppresses HCC ell issoiation in vitro y upregulating epithelial juntion proteins an inhiiting Wnt/eta-atenin signaling pathway. J Caner. 2017;8(9): Yuan H, Kajiyama H, Ito S, Chen D, Shiata K, Hamaguhi M, Kikkawa F, Senga T. HOXB13 an ALX4 inue SLUG expression for the promotion of EMT an ell invasion in ovarian aner ells. Onotarget. 2015;6(15): Yang JT, Han F, Liu WB, Zhang MQ, Huang YS, Hao XL, Jiang X, Yin L, Chen HQ, Cao J, et al. LHX6, an inepenent prognosti fator, inhiits lung aenoarinoma progression through transriptional silening of etaatenin. J Caner. 2017;8(13): Han F, Liu W, Xiao H, Dong Y, Sun L, Mao C, Yin L, Jiang X, Ao L, Cui Z, et al. High expression of SOX30 is assoiate with favorale survival in human lung aenoarinoma. Si Rep. 2015;5: Luperger J, Kreuzer KA, Baskaynak G, Peters UR, le Coutre P, Shmit CA. Quantitative analysis of eta-atin, eta-2-mirogloulin an porphoilinogen eaminase mrna an their omparison as ontrol transripts for RT-PCR. Mol Cell Proes. 2002;16(1): Li Q, Dashwoo WM, Zhong X, Al-Fageeh M, Dashwoo RH. Cloning of the rat eta-atenin gene (Ctnn1) promoter an its funtional analysis ompare with the Catn an CTNNB1 promoters. Genomis. 2004;83(2): Yuan S, Yu Z, Liu Q, Zhang M, Xiang Y, Wu N, Wu L, Hu Z, Xu B, Cai T, et al. GPC5, a novel epigenetially silene tumor suppressor, inhiits tumor growth y suppressing Wnt/eta-atenin signaling in lung aenoarinoma. Onogene. 2016;35(47): Shivakumar M, Lee Y, Bang L, Garg T, Sohn KA, Kim D. Ientifiation of epigeneti interations etween mirna an DNA methylation assoiate with gene expression as potential prognosti markers in laer aner. BMC Me Genet. 2017;10(Suppl 1): Yang Y, Fuentes F, Shu L, Wang C, Pung D, Li W, Zhang C, Guo Y, Kong AN. Epigeneti CpG methylation of the promoter an reativation of the expression of GSTP1 y Astaxanthin in human prostate LNCaP ells. AAPS J. 2017;19(2): Holliay R, Ho T. DNA methylation an epigeneti inheritane. Methos. 2002;27(2): Laezza C, D'Alessanro A, Palaino S, Maria Malfitano A, Chiara Proto M, Gazzerro P, Pisanti S, Santoro A, Ciaglia E, Bifulo M, et al. Ananamie inhiits the Wnt/eta-atenin signalling pathway in human reast aner MDA MB 231 ells. Eur J Caner. 2012;48(16): Li Y, Jin K, van Pelt GW, van Dam H, Yu X, Mesker WE, Ten Dijke P, Zhou F, Zhang L. C-My enhanes reast aner invasion an metastasis through the Wnt/eta-atenin/Axin2 pathway. Caner Res. 2016;76(11): Zhang ZM, JF W, Luo QC, Liu QF, QW W, Ye GD, She HQ, Li BA. Pygo2 ativates MDR1 expression an meiates hemoresistane in reast aner via the Wnt/eta-atenin pathway. Onogene. 2016;35(36): Kimelman D, Xu W. Beta-atenin estrution omplex: insights an questions from a strutural perspetive. Onogene. 2006;25(57):
% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More information100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
More informationb PolyA RNA-seq c RNA-seq read distribution FPKM
a Repliate 2 (FPKM) Poly+ RN-seq 14 1-2 R2 =.998 1-4 -4-2 1 1 14 Repliate 1 (FPKM) Repliate 2 (FPKM) Poly RN-seq 14 1-2 R2 =.996 1-4 1-4 1-2 14 Repliate 1 (FPKM) RN-seq rea istriution Intron 12% 14% Intergeni
More informationMicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer
Zhang et al. Moleular Caner (8) 7: DOI.86/s94-7-75- RESEARCH Open Aess MiroRNA-494 promotes aner progression and targets adenomatous polyposis oli in oloretal aner Ying Zhang, Lu Guo,, Yuhuan Li,, Gui-Hai
More informationFOXO3 signalling links ATM to the p53 apoptotic pathway following DNA damage
Reeive 19 Jan 212 Aepte 11 Jul 212 Pulishe 14 Aug 212 DOI: 1.138/nomms28 signalling links to the p apoptoti pathway following DNA amage Young Min Chung 1, *, See-Hyoung Park 1, *, Wen-Bin Tsai 2, Shih-Ya
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationa n a ly s i s Probabilistic modeling of Hi-C contact maps eliminates systematic biases to characterize global chromosomal architecture
Proailisti moeling of Hi-C ontat maps eliminates systemati iases to haraterize gloal hromosomal arhiteture Eitan Yaffe & Amos Tanay 2 Nature Ameria, In. All rights reserve. Hi-C experiments measure the
More informationSupplementary Material for. Inflammation induced repression of Foxp3-bound chromatin in regulatory T cells
Supplementary Material for Inflammation inue repression of -oun hromatin in regulatory T ells Aaron Arvey 1,2, Joris van er Veeken 1,2, Roert M. Samstein 1,2, Yongqiang Feng 1,2, John A. Stamatoyannopoulos
More informationWorld Journal of Gastroenterology
ISSN 1007-9327 (print) ISSN 2219-2840 (online) Worl Journal of Gastroenterology Worl J Gastroenterol 2018 Feruary 21; 24(7): 767-876 Pulishe y Baishieng Pulishing Group In S Contents Weekly Volume 24 Numer
More informationCircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
More informationUse of Parents, Sibs, and Unrelated Controls for Detection of Associations between Genetic Markers and Disease
Am. J. Hum. Genet. 63:492 506, 998 Use of Parents, Sibs, an Unrelate Controls for Detetion of Assoiations between Geneti Markers an Disease Daniel J. Shai,2 an Charles Rowlan Departments of Health Sienes
More informationSupplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
More informationPharmaceutical care of stroke patients. Course activities
Pharmaeutial are of stroke patients Course ativities Pharmaeutial are of stroke patients Course ativities page 2 Case Stuy 1 4 Case Stuy 2 6 Case Stuy 3 8 Multiple Choie Questionnaire Case Stuy 1 Mr Ferguson
More informationSupplementary Figure 1 - Ling
HA1 (%) Insulin seretion (SI) e 7. p=....... 7 p=.7 1 7 a-ell granules -ell granules BMI (kg/m ) -ells / (a- + -ells) p=. 1 7 1. p=.1..... 7 Age: -ell ontent: % Age: -ell ontent: % Age: -ell ontent: %
More information100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of
Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3
More informationTethering by lamin A stabilizes and targets the ING1 tumour suppressor
Tethering y lamin A stailizes an targets the tumour suppressor Xijing Han 1,6, Xiaolan Feng 1,6, Jerome B. Rattner 2, Heather Smith 1, Pinaki Bose 1, Keiko Suzuki 1, Mohame A. Soliman 1,3, Mihelle S. Sott
More informationMir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
More informationAssociation between downexpression of mir-1301 and poor prognosis in patients with glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.
More informationRapid onset of efficacy predicts response to therapy with certolizumab plus methotrexate in patients with active rheumatoid arthritis
ORIGINAL ARTICLE Korean J Intern Me 218;33:1224-1233 https://oi.org/1.394/kjim.216.213 Rapi onset of effiay preits response to therapy with ertolizumab plus methotrexate in patients with ative rheumatoi
More informationPartial Occlusion Modulates Contour-Based Shape Encoding in Primate Area V4
12 The Journal of Neurosiene, Marh 16, 11 31(11):12 24 Behavioral/Systems/Cognitive Partial Olusion Moulates Contour-Base Shape Enoing in Primate Area V4 Brittany N. Bushnell, Philip J. Haring, Yoshito
More informationPIG3 promotes NSCLC cell mitotic progression and is associated with poor prognosis of NSCLC patients
Li et al. Journal of Experimental & Clinial Caner Researh (2017) 36:39 DOI 10.1186/s13046-017-0508-2 RESEARCH Open Aess PIG3 promotes NSCLC ell mitoti progression and is assoiated with poor prognosis of
More informationExpression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.
More informationLong noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,
More informationPROGRAMME SPECIFICATION FOR POSTGRADUATE DEGREE
كيفية إػدإد توصيف إملقررإت إدلرإس ية لدلرإسات إلؼليا توصيف إملقررإت إدلرإسية يتضمن توضيح أقل إملتطلبات إلوإحب توإفرها يف طالب إدلرإسات إلؼليا للحصول ػىل درخة إملاحستري وإدلكتورإه. يشمل توصيف إملقرر إدلرإيس
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationDown-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer
European Review for Medical and Pharmacological Sciences 2016; 20: 5143-5147 Down-regulation of long non-coding RNA MEG3 serves as an unfavorable risk factor for survival of patients with breast cancer
More informationExpression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.
More informationExpression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.
More informationCytotoxic and antimicrobial activity of selected Cameroonian edible plants
Dzoyem et al. BMC Complementary an Alternative Meiine 2013, 13:78 RESEARCH ARTICLE Open Aess Cytotoxi an antimiroial ativity of selete Cameroonian eile plants Jean Paul Dzoyem 1,2,4*, Santosh Kumar Guru
More informationSequence Analysis using Logic Regression
Geneti Epidemiology (Suppl ): S66 S6 (00) Sequene Analysis using Logi Regression Charles Kooperberg Ingo Ruzinski, Mihael L. LeBlan, and Li Hsu Division of Publi Health Sienes, Fred Huthinson Caner Researh
More informationAngiogenesis is the process of new vessel formation from the preexisting
Diagn Interv Raiol 2010; 16:186 192 Turkish Soiety of Raiology 2010 GENERAL RADIOLOGY REVIEW The role of ynami ontrast-enhane MRI in aner iagnosis an treatment Barış Türkey, Davi Thomasson, Yuxi Pang,
More informationSpontaneous persistent ac.vity in entorhinal cortex modulates cor.co- hippocampal
Spontaneous persistent a.vity in entorhinal ortex moulates or.o- hippoampal intera.ons in vivo Thomas T. G. Hahn, James M. MFarlan, Sven Bererih, Bert Sakmann, Mayank R. Mehta Neoortial persistent Up states
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationData Retrieval Methods by Using Data Discovery and Query Builder and Life Sciences System
Appendix E1 Data Retrieval Methods by Using Data Disovery and Query Builder and Life Sienes System All demographi and linial data were retrieved from our institutional eletroni medial reord databases by
More information[PHAR03] The effects of palm vitamin E supplementation on oxidative status in steroid-induced cataract formation
The 4th Annual Seminar of National Siene Fellowship 24 [PHAR3] The effets of palm vitamin E supplementation on oxiative status in steroi-inue atarat formation Norul Aini Zakariya, Noor Aini Abul Hami,
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationThe effects of bilingualism on stuttering during late childhood
Additional information is published online only at http:// ad.bmj.om/ontent/vol93/ issue11 1 Division of Psyhology and Language Sienes, University College London, London, UK; 2 Department of Language and
More informationDecreased expression of mir-490-3p in osteosarcoma and its clinical significance
European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,
More informationPrognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma
European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.
More informationOverexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients
European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG
More informationOriginal Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome
Int J Clin Exp Pathol 2017;10(2):2030-2035 www.ijcep.com /ISSN:1936-2625/IJCEP0009456 Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationKeywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION:
International Journal of Medial Siene and Eduation An offiial Publiation of Assoiation for Sientifi and Medial Eduation (ASME) Original Researh Artile ASSOCIATION BETWEEN QUALITY OF LIFE AND ANXIETY, DEPRESSION,
More informationInvestigating Critical Driver Behavioral Patterns during the Yellow Phase at Signalized Intersections
Investigating Critial Driver Behavioral Patterns uring the Yellow Phase at Signalize Intersetions Yue Liu, Gang-Len Chang, an Jie Yu Abstrat This paper presents the investigation results of river behavioral
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationPharmaceutical care of people with chronic obstructive pulmonary disease. Course activities
Pharmaeutial are of people with hroni ostrutive pulmonary isease Course ativities Pharmaeutial are of people with hroni ostrutive pulmonary isease Course ativities page 2 Case Stuy 1 4 Case Stuy 2 7 Case
More informationLong noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma
JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis
More informationHigh expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.
Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei
More informationCorrelation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients
1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationa b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
More informationExpression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationCircular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.
More informationStudy of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice
THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,
More informationSelection for Increased Marbling
Seletion for Inrease Marbling Floria is primarily a ow-alf prouing state, that markets most of the alves as stokers an feeers to western feeing areas for growing an finishing in feelots an then slaughtering
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationRho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling
Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationThe metabolic checkpoint kinase mtor is essential for IL-15 signaling during the development and activation of NK cells
The metaoli hekpoint kinase mtor is essential for IL- signaling uring the evelopment an ativation of NK ells Antoine Marçais, Julien Cherfils-Viini 6,, Charlotte Viant 7,, Sophie Degouve, Séastien Viel,8,
More informationSupplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationEfficacy and Safety/Toxicity Study of Recombinant Vaccinia Virus JX-594 in Two Immunocompetent Animal Models of Glioma
The Amerian Soiety of Gene & Cell Therapy MT Open original artile Effiay an Safety/Toxiity Stuy of Reominant Vainia Virus JX-594 in Two Immunoompetent Animal Moels of Glioma XueQing Lun 1 4, Jennifer Chan
More informationEdinburgh Research Explorer
Einburgh Researh Explorer Prevalene an orrelates of ognitive impairment in euthymi aults with bipolar isorer Citation for publishe version: Cullen, B, War, J, Graham,, Deary, IJ, Pell, JP, Smith, DJ &
More informationThe Loss of MCP-1 Attenuates Cutaneous Ischemia Reperfusion Injury in a Mouse Model of Pressure Ulcer
ORIGINAL ARTICLE The Loss of MCP- Attenuates Cutaneous Ishemia Reperfusion Injury in a Mouse Moel of Pressure Uler Yuki Saito, Minoru Hasegawa, Manabu Fujimoto, Takashi Matsushita, Mayuka Horikawa, Motoi
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More informationLong non-coding RNA Loc is a potential prognostic biomarker in non-small cell lung cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 3808-3812 Long non-coding RNA Loc344887 is a potential prognostic biomarker in non-small cell lung cancer B. WU 1, X.-J. ZHANG 2, X.-G.
More informationRetraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury
Hindawi BioMed Researh International Volume 217, Artile ID 8234878, 1 page https://doi.org/1.1155/217/8234878 Retration Retrated: Study of Effet of Salvianoli Aid B on Motor Funtion Reovery in Rats with
More informationMeasurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1
Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publiation lik this link. http://hdl.handle.net/2066/24753
More informationLong noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4
European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing
More informationSupplementary Information
Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland
More informationOriginal Article MicroRNA-101 is a novel biomarker for diagnosis and prognosis in breast cancer
Int J Clin Exp Pathol 2017;10(3):3279-3285 www.ijcep.com /ISSN:1936-2625/IJCEP0022926 Original Article MicroRNA-101 is a novel biomarker for diagnosis and prognosis in breast cancer Na Wei, Qing Ni, Min
More informationLncRNA LET function as a tumor suppressor in breast cancer development
European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.
More informationLearned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationDownregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients
European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,
More informationIncreased long noncoding RNA LINP1 expression and its prognostic significance in human breast cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 8749-8754 Increased long noncoding RNA LINP1 expression and its prognostic significance in human breast cancer X.-M. LIU 1, B. YANG 2,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationChemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype
hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationReading and communication skills after universal newborn screening for permanent childhood hearing impairment
1 Shool of Psyhology, University of Southampton, Southampton, UK; 2 Shool of Mediine, Southampton General Hospital, University of Southampton, Southampton, UK; 3 UCL Institute of Child Health, London,
More informationMETHODS JULIO A. PANZA, MD, ARSHED A. QUYYUMI, MD, JEAN G. DIODATI, MD, TIMOTHY S. CALLAHAN, MS, STEPHEN E. EPSTEIN, MD, FACC
JACC Vol. 17. No.3 Marh 1. 1991 :657-63 657 METHODS Predition of the Frequeny and Duration of Ambulatory Myoardial Ishemia in Patients With Stable Coronary Artery Disease by Determination of the Ishemi
More informationP. Sharma, J. Kaur and S. N. Sanyal. Department of Biophysics. Panjab University. Chandigarh India. Abstract
Nutr Hosp. 2010;25(1):39-48 ISSN 0212-1611 CODEN NUHOEQ S.V.R. 318 Original Effet of etorioxi, a ylooxygenase-2 seletive inhiitor on aerrant rypt formation an apoptosis in 1,2 imethyl hyrazine inue olon
More informationUp-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma
European Review for Medical and Pharmacological Sciences 2018; 22: 8624-8629 Up-regulation of long non-coding RNA SNHG6 predicts poor prognosis in renal cell carcinoma H.-X. AN 1, B. XU 2, Q. WANG 3, Y.-S.
More informationInactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice
Inativation of the ferroptosis regulator Gpx4 triggers aute renal failure in mie Jose Pero Friemann Angeli 1, Manuela Shneier 2, Bettina Proneth 1, Yulia Y. Tyurina 3, Vlaimir A. Tyurin 3, Vitoria J. ammon
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationmir-218 tissue expression level is associated with aggressive progression of gastric cancer
mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,
More informationInfluenza affects elderly patients
INFORMATION FOR THE PHARMACIST This artile was sponsored y Seqirus In. FLUAD (influenza vaine, adjuvanted) to Help Protet Elderly Patients Against Influenza Influenza affets elderly patients disproportionately,
More informationAnalysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma
European Review for Medical and Pharmacological Sciences 2017; 21: 498-503 Analysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma J.-J. WEN
More informationMineral Oil Application Experiments: Reducing Current Season PVY
Mineral Oil Appliation Experiments: Reduing Current Season PVY Prinipal Investigator(s). Russell L. Groves, Assistant Professor and Entomology Extension Speialist, Department of Entomology, 537 Russell
More informationSupplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1
Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic
More informationHigh Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10621 RESEARCH ARTICLE High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas Yao-Wu Wang 1, Chun-Li Yin 2, Hong-Yi Zhang
More informationThe diagnostic value of determination of serum GOLPH3 associated with CA125, CA19.9 in patients with ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4039-4044 The diagnostic value of determination of serum GOLPH3 associated with CA125, CA19.9 in patients with ovarian cancer H.-Y. FAN
More informationSurvivin withdrawal by nuclear export failure as a physiological switch to commit cells to apoptosis
Citation: (2010) 1, e57; doi:10.1038/ddis.2010.34 & 2010 Mamillan Pulishers Limited All rights reserved 2041-4889/10 www.nature.om/ddis withdrawal y nulear export failure as a physiologial swith to ommit
More informationOriginal Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma
Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for
More informationmir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells
European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationLong non-coding RNA TUSC7 expression is independently predictive of outcome in glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 3605-3610 Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma X.-L. MA 1, W.-D. ZHU 2, L.-X. TIAN 2,
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More information