MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation"

Transcription

1 MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang Liu 1# 1 Cell and Cancer Biology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, 37 Convent Dr., Bethesda, MD Institute for Medical Sciences, Ajou University School of Medicine, Suwon, Korea *These authors contributed equally to this work and are listed alphabetically by their last names. # To whom correspondence should be addressed. Figure S1. Monocyte differentiation Mo Mo GM-CSF-7days Figure S1. Monocyte differentiation. The purity of the elutriated monocytes was checked by staining with anti-cd14 and analyzing by flow cytometry (upper panel). Monocytes (Mo) were differentiated into Macrophages (M )by culturing 7 days in presence of rhgm-csf, as shown by phase contrast microscopy (bottom panel).

2 Figure S2. Treatment of monocytes with GM-CSF alone leads to macrophage differentiation and not to dendritic cell differentiation CD 14 CD 1a GM-CSF CD 14 CD 1a GM-CSF + IL-4 CD 14 CD 1a GM-CSF + IL-6 Figure S2. Treatment of monocytes with GM-CSF alone leads to macrophage differentiation and not to dendritic cell differentiation. Monocytes were cultured for 7 days in presence of rhgm-csf alone (top). Differentiated cells were analyzed by FACS using antibodies to CD14 or CD1a (red, unstained; blue, stained.) For comparison, we induced dendritic cell fate by culturing in the presence of rhgm-csf plus IL-4. As a second comparison, we cultured in the presence of rhgm-csf and IL-6, which has been reported to restrict cell linage to the macrophage fate. No significant change in these markers was observed, suggesting that in our hands, rhgm-csf alone was sufficient to induce macrophage differentiation.

3 Figure S3. IKKα is up-regulated during monocyte differentiation #1 #2 #3 #4 Mo Mo Mo Mo - IKKα - TRADD Figure S3. IKK! is up-regulated during monocyte differentiation. Cell extracts of monocytes (Mo) vs. macrophages (M ) from different donors were analyzed by immunoblot with anti- IKK!, TRADD blots indicate the loading of lanes.

4 Figure S4. IKK! is downregulated by transfected mirna mimic pool during monocyte differentiation Monocyte GM-CSF: ctrl pool IKKα - TRADD - β-actin Figure S4. IKKα is downregulated by transfected mirna mimic pool during monocyte differentiation. Monocytes (Mo) were transfected with an mirna mimic pool (mir-15a, mir16, mir) at day 0 and were analyzed after 4 days by immunoblot with anti- IKKα antibody. Actin and TRADD blots indicate the loading of lanes. Transfection of these cells by mirna or sirna was successful, as shown by western blot, which shows downregulation of IKK levels in the pool-transfected cells. However, control or pool- transfected cells failed to fully differentiate (as detected by morphology) into macrophages. As noted in the blot, the control cells did not upregulate IKK as highly as untransfected cells and died before 7 days of GMCSF treatment.

5 Figure S5. Down-regulation of IKKα in Hela cells by an mirna mimic pool results in less p52 processing mirna mimics HeLa Ctrl: a: : - + : IKKα - p100 - p52 - TRADD - β-actin Figure S5. Down-regulation of IKK in Hela cells by an mirna mimic pool results in less p52 processing. HeLa cells were transfected with micrornas mimic control oligo and pooled mirna mimics 15a, 16, and. 48 hours after transfection, cell lysates were analyzed by immunoblot with anti- IKK, anti-p100/p52, TRADD and β-actin blots indicate loading of lanes.

6 Figure S6. Decreased p52 processing in HeLa cells transfected with the microrna mimic pool correlates not only with decreased IKKα levels, but also increased TRAF2 levels and decreased NIK levels. Hela - IKKα - TRADD - TRAF2 - NIK - TRADD Figure S6. Decreased p52 processing in HeLa cells transfected with the microrna mimic pool correlates not only with decreased IKKa levels, but also increased TRAF2 levels and decreased NIK levels. HeLa cells were transfected with micrornas mimic control oligo and pooled mirna mimics 15a, 16, and. 48 hours after transfection, cell lysates were analyzed by immunoblot with anti- IKK, anti-traf2, anti-nik antibodies. TRADD blots indicate loading of lanes in the two blots of the same lysate.

7 Figure S7. The noncanonical NF-κB pathway regulates basal ELC expression Relative Quantity ELC mrna 0.0 Figure S7. The noncanonical NF- B pathway regulates basal ECL expression. Macrophages (M ) were transfected with mirna mimic control or pooled mirna mimics. 48 hours after transfection, total RNA was extracted and mrna of ELC were measured by real time PCR, ELC mrna level was normalized to GAPDH mrna, data representative of three independent experiments.

8 Figure S8. Canonical and noncanonical NF-κB pathways are capable of upregulating ELC expression. Relative Quantity ELC mrna 0 TNFα: LTα 1 β 2 : Figure S8. Canonical and noncanonical NF- B pathways are capable of up-regulating ELC expression. Macrophages (M ) were pre-treated with LTα1β2 for 4 hours or not followed by 6 hours of TNFα treatment as indicated, total RNAs were isolated and ELC mrna was measured by real time PCR, ELC mrna level was normalized to GAPDH mrna, data are representative of three independent experiments.

9 Figure S9. mirna targeting IKKα affect basal canonical NF-κB gene expression. A20 mrna Basal ICAM mrna Basal Relative Quantity Relative Quantity Relative Quantity CCL4 mrna Basal Relative Quantity IL10 mrna Basal Figure S9. mirnas targeting IKK affect basal canonical NF- B gene expression Macrophages (M ) were transfected with mirnas control mimic or pooled mimics. 48 hours after transfection, total RNA was extracted and mrna of A20, ICAM, CCL4 and IL-10 were measured by real time PCR, target mrna level was normalized to GAPDH mrna, data are representative of three independent experiments.

10 Figure S10. p52-containing complexes have higher mobility than RelA or crel containing complexes, consistent with the formation of p52 homodimers. WCL P100 WCL P100 - BME: DSP: KD- 150 KD- 100 KD- - p100 - p52 - p KD- 50 KD- - p52 WCL DSP: - + WCL DSP: KD- 150 KD- 250 KD- - Rel A - c-rel 150 KD- 100 KD- 75 KD- 50 KD- - Rel A 100 KD- 75 KD- 50 KD- - c-rel Figure S10. p52-containing complexes have higher mobility than RelA- or crelcontaining complexes, consistent with the formation of p52 homodimers. Macrophages were cross-linked with DSP (1mM in PBS incubated at room temperature for 30 minutes) followed by p100 depletion by specific anti-p100 C-terminal antibody. The un-depleted and depleted cell lysated were analyzed by immunoblot with indicated antibodies. The cross-links were removed by mercaptoethanol (BME) in the right two lanes of the upper blot. Note that in crosslinked lanes RelA and crel are in higher molecular weight complexes than p52, as indicated by bands next to the arrows. (RelB in the unstimulated macrophages is present only at very low levels and was not detected in this experiment.) Since the Rel NF-kB proteins (RelA, RelB, c-rel), which contain transcriptional activation domains (TADs), are of higher molecular weight than the mature forms of nfkb1 (p50) and nfkb2 (p52), which do not contain TADs, this data suggests that p52 is substantially found in homodimers or heterodimers with p50, both of which would be transcriptionally inactive under normal conditions.

11 Figure S11. mirna targeting IKKα affect canonical NF-κB gene induction. Relative Fold Increase A20 mrna-lps Simulated Relative Fold Increase ICAM mrna-lps Simulated Relative Fold Increase CCL4 mrna-lps Simulated Relative Fold Increase IL-10 mrna-lps Simulated Figure S11. mirna targeting IKK affect canonical NF- B gene induction. Macrophages (M ) were transfected with mirnas control mimic or pooled mirna mimics. 24 hours after transfection. cells were challenged or not with LPS (1 g/ml) for another 24 hours, total RNA were isolated and mrnas of A20, ICAM, CCL4 and IL-10 were measured by real time PCR, target mrna levels were normalized to GAPDH mrna, fold increase compare with the untreated cells is shown, data representative of three independent experiments.

12 Figure S12. sirna targeting IKKα or p52 affect noncanonical NF-κB gene expression and induction. a 2.5 ELC mrna Basal b 4 ELC mrna Basal sirna: Lamin A/C NT IKKα Mo 0 sirna: Lamin A/C p52 c sirnas: - NT p52 - p100 - p52 - TRADD - β-actin d 800 ELC mrna Induced e 12.5 A20 mrna Induced Relative Fold Increase NT IKKα Relative Fold Increase NT IKKα Figure S12. sirna targeting IKK or p52 affect noncanonical NF- B gene expression and induction. (a,b,c,d,e) Macrophages (M ) were transfected with Nontargeting (NT) control, lamin A/C, p52/p100 or IKK sirna as indicated. 24 hours after transfection. cells were challenged or not with LPS (1 g/ml) for another 24 hours. For various experiments, total RNA were isolated and mrnas were measured by real time PCR with target mrna levels normalized to GAPDH mrna. (c) Lysates from monocytes (Mo) and sirna-transfected macrophages (M ) were analyzed by immunoblot with indicated antibodies. (d,e) Fold increase compared with the untreated cells is shown instead of relative levels.

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

The NF- B/Rel family

The NF- B/Rel family The NF-κB/Rel family The NF-κB/Rel family A family of signal-responsive transcription factors rapid response som ikke requires proteinsyntese Involved in proinflammatory response: a first line of defense

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Stochastic Expression of the Interferon-b Gene

Stochastic Expression of the Interferon-b Gene Mingwei Zhao 1, Jiangwen Zhang 2., Hemali Phatnani 3., Stefanie Scheu 4, Tom Maniatis 1,3 * 1 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, United States of

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls.

Supplementary figure 2. VCAM1 protein expression in static HCAECs exposed to CSE over 72 hours, with TNFα or TNFα + CSE positive controls. Supplementary data Cigarette smoke extract profoundly suppresses TNFα-mediated proinflammatory gene expression through upregulation of ATF3 in human coronary artery endothelial cells Jack E. Teasdale 1,

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Inventory of Supplemental Data: Supplemental Figures 1-7. Supplemental Tables 1-8. Supplemental References. Supplemental Video:

Inventory of Supplemental Data: Supplemental Figures 1-7. Supplemental Tables 1-8. Supplemental References. Supplemental Video: Inventory of Supplemental Data: Supplemental Figures -7 Supplemental Tables -8 Supplemental References Supplemental Video: Note that the video shows JHU-9 cells transfected with mir-93a antagomir or control

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

CONTRACTING ORGANIZATION: University of North Carolina at Chapel Chapel Hill, NC 27599

CONTRACTING ORGANIZATION: University of North Carolina at Chapel Chapel Hill, NC 27599 AD (Leave blank) Award Number: W81XWH-8-1-378 TITLE: Targeting IKK in Basal-Like Breast Tumors as a Therapeutic Approach PRINCIPAL INVESTIGATOR: Albert S. Baldwin, Ph.D. CONTRACTING ORGANIZATION: University

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Relevant Disclosures

Relevant Disclosures 6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,

More information

Identification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection

Identification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection Boston University OpenBU http://open.bu.edu Graduate Research Symposium Graduate Research Symposium 216 216-4-1 Identification of mirna differentially expressed in macrophages exposed to Porphyromonas

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Host cell activation

Host cell activation Dept. of Internal Medicine/Infectious and Respiratory Diseases Stefan Hippenstiel Epigenetics as regulator of inflammation Host cell activation LPS TLR NOD2 MDP TRAF IKK NF-κB IL-x, TNFα,... Chromatin

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Aditi Gupta 1, Wei Cao 2 and Meenakshi A Chellaiah 1*

Aditi Gupta 1, Wei Cao 2 and Meenakshi A Chellaiah 1* Gupta et al. Molecular Cancer 2012, 11:66 RESEARCH Open Access Integrin αvβ3 and CD44 pathways in metastatic prostate cancer cells support osteoclastogenesis via a Runx2/Smad 5/receptor activator of NF-κB

More information

Role of Innate Immunity in Control of Adaptive Immunity

Role of Innate Immunity in Control of Adaptive Immunity Role of Innate Immunity in Control of Adaptive Immunity Innate Immunity The burden of pathogen sensing is placed on the innate immune system Danger hypothesis Missing Self Based on the detection of molecular

More information

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors

The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans

SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

3 The abbreviations used are: DC, dendritic cell; TLR, Toll-like receptor; ICAM,

3 The abbreviations used are: DC, dendritic cell; TLR, Toll-like receptor; ICAM, THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 17, pp. 13731 13742, April 20, 2012 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Activated Apoptotic

More information

Transcriptional and Epigenetic Mechanisms of Addiction

Transcriptional and Epigenetic Mechanisms of Addiction Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find

More information

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth

Tumor-secreted mir-214 induces regulatory T cells: a major link between immune evasion and tumor growth ORIGINAL ARTICLE Cell Research (2014) 24:1164-1180. 2014 IBCB, SIBS, CAS All rights reserved 1001-0602/14 www.nature.com/cr npg Tumor-secreted mir-214 induces regulatory T cells: a major link between immune

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary CellSensor HSE-bla HeLa Cell Line Cat. no. K Pathway Description Activation of the heat shock response/unfolded protein response (HSR/UPR) occurs in response to a

More information

Hepatitis C Virus and Cytokine Responses

Hepatitis C Virus and Cytokine Responses Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea

More information

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast

More information

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,

More information

NIH Public Access Author Manuscript Cell Mol Life Sci. Author manuscript; available in PMC 2010 November 9.

NIH Public Access Author Manuscript Cell Mol Life Sci. Author manuscript; available in PMC 2010 November 9. NIH Public Access Author Manuscript Published in final edited form as: Cell Mol Life Sci. 2008 November ; 65(22): 3564 3591. doi:10.1007/s00018-008-8222-z. Cell penetrating peptide inhibitors of Nuclear

More information

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.

More information

Can we classify cancer using cell signaling?

Can we classify cancer using cell signaling? Can we classify cancer using cell signaling? Central hypotheses (big ideas) Alterations to signaling genes would cause leukemic cells to react in an inappropriate or sensitized manner to environmental

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

THP-1-derived macrophages render lung epithelial cells hypo-responsive to Legionella pneumophila a systems biology study

THP-1-derived macrophages render lung epithelial cells hypo-responsive to Legionella pneumophila a systems biology study www.nature.com/scientificreports Received: 3 March 2017 Accepted: 4 September 2017 Published: xx xx xxxx OPEN THP-1-derived macrophages render lung epithelial cells hypo-responsive to Legionella pneumophila

More information

ab NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit

ab NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit ab176663 NFĸB p65 (ps536) + Total NFĸB p65 SimpleStep ELISA Kit Instructions for Use For the semi-quantitative measurement of NFĸB p65 (ps536) and NFĸB p65 (Total) in Human and mouse cell lysates. This

More information

Downregulation of the NLRP3 inflammasome by adiponectin rescues Duchenne muscular dystrophy

Downregulation of the NLRP3 inflammasome by adiponectin rescues Duchenne muscular dystrophy Boursereau et al. BMC Biology (2018) 16:33 https://doi.org/10.1186/s12915-018-0501-z RESEARCH ARTICLE Open Access Downregulation of the NLRP3 inflammasome by adiponectin rescues Duchenne muscular dystrophy

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Tonic CAR signaling in T cells:

Tonic CAR signaling in T cells: Tonic CAR signaling in T cells: toxicities and ways to manage Max Mamonkin, PhD CAR-TCR Summit 9/6/217 Boston, MA CAR signaling Antige n Target cell CAR Signal 2 T cell Signal 1 Clustering Signaling Tonic

More information

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)

he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science

More information

Supplementary Material. Contents include:

Supplementary Material. Contents include: Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Combined transfection of Bcl-2 sirna and mir-15a oligonucleotides enhanced methotrexate-induced apoptosis in Raji cells

Combined transfection of Bcl-2 sirna and mir-15a oligonucleotides enhanced methotrexate-induced apoptosis in Raji cells Cancer Biol Med 2013;10:16-21. doi: 10.7497/j.issn.2095-3941.2013.01.003 ORIGINAL ARTICLE Combined transfection of Bcl-2 sirna and mir-15a oligonucleotides enhanced methotrexate-induced apoptosis in Raji

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION Yao et al. Journal of Neuroinflammation 2013, 10:23 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal

More information

Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7

Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7 The Open Breast Cancer Journal, 2011, 3, 1-5 1 Open Access Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7 Nier Cha 1,2, Xinyue Gu 1, Fengyun

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

FEEDBACK INHIBITION OF IL-17 RECEPTOR SIGNAL TRANSDUCTION. Abhishek Garg. Bachelor of Engineering in Biotechnology,

FEEDBACK INHIBITION OF IL-17 RECEPTOR SIGNAL TRANSDUCTION. Abhishek Garg. Bachelor of Engineering in Biotechnology, FEEDBACK INHIBITION OF IL-17 RECEPTOR SIGNAL TRANSDUCTION by Abhishek Garg Bachelor of Engineering in Biotechnology, University Institute of Engineering and Technology, Panjab University, 2009 Submitted

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Effect of NF-κB signaling pathway mediated by mir-711 on the apoptosis of H9c2 cardiomyocytes in myocardial ischemia reperfusion

Effect of NF-κB signaling pathway mediated by mir-711 on the apoptosis of H9c2 cardiomyocytes in myocardial ischemia reperfusion European Review for Medical and Pharmacological Sciences 2017; 21: 5781-5788 Effect of NF-κB signaling pathway mediated by mir-711 on the apoptosis of H9c2 cardiomyocytes in myocardial ischemia reperfusion

More information

USP10 inhibits genotoxic NF-κB activation by MCPIP1- facilitated deubiquitination of NEMO

USP10 inhibits genotoxic NF-κB activation by MCPIP1- facilitated deubiquitination of NEMO Manuscript EMBO-2013-84573 USP10 inhibits genotoxic NF-κB activation by MCPIP1- facilitated deubiquitination of NEMO Jixiao Niu, Yuling Shi, Jingyan Xue, Ruidong Miao, Shengping Huang, Tianyi Wang, Jiong

More information

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity

More information

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Received 1 Feb 215 Accepted 15 Oct 215 Published 24 Nov 215 DOI: 1.138/ncomms9917 SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Lan Shao

More information

Insulin/IGF1-IRS-PI-3 kinase-mtor signaling pathway

Insulin/IGF1-IRS-PI-3 kinase-mtor signaling pathway Insulin/IGF1-IRS-PI-3 kinase-mtor signaling pathway Nutrients RAPAMYCIN (FKBP12) mtor/rictor complex phosphorylates Akt at the S473 activating site in a Rheb-independent fashion TSC1 or TSC2-null MEFs

More information