A Simulation of DNA Mutations and Cancer

Size: px
Start display at page:

Download "A Simulation of DNA Mutations and Cancer"

Transcription

1 Lab 13 A Simulation of DNA Mutations and Cancer PROBLEM How can the changes in DNA that lead to cancer be modeled? BACKGROUND Cancer is the uncontrolled growth of cells that produces tumors. Cancer is almost always caused by mutations in the DNA or by the abnormal activity of genes that control cell growth and cell mitosis. Abnormal genes that cause cancer are called oncogenes. Oncogenes have been discovered for many kinds of cancers. Cell mutations commonly happen within the body, yet only a very small number of mutations ever lead to cancer. The fact that few mutations lead to cancer is due to several factors: Most mutated cells cannot perform the normal cell functions and thus die quickly. Only a few mutated cells that do survive lose their ability to maintain normal cell growth. Potentially cancerous cells are often destroyed by the body s immune system. DNA and its associated repair enzymes have a precise self-checking system that cuts and repairs any abnormal DNA segments before mitosis occurs. How then does cancer occur? The chance of developing cancer is increased when the risk of genetic mutations is increased. Some chemical, physical, or biological agents increase the chance of mutations. These agents are called carcinogens if they produce mutations that cause cancer. Carcinogens include the following. Ionizing radiation, such as ultraviolet rays and X-rays, can break DNA strands and cause an increase in mutations. Chemical substances such as cigarette smoke can cause mutations. Physical irritants, such as foods that cause a continual wearing down of the lining of the small intestine, can cause mutations. Biological agents that can cause cancer include viruses that attack the DNA of normal cells. For example, the AIDS virus has been linked to a type of skin cancer called Kaposi s sarcoma. Therefore, getting HIV increases a person s risk factor for this cancer. Heredity affects mutations. Most cancers require two or more mutations in a gene before cancer can occur. If a person inherits a particular mutation, only one more mutation in the same gene may be needed to cause cancer. Researchers estimate that heredity may be a factor in 5 7 percent of all types of cancer. In this simulation you will act as a DNA sequence checker in a cell. You must find all the mistakes in the DNA or the cell will become cancerous and lead to the death of the organism. Biotechnology Manual 123

2 OBJECTIVES Compare sequences of DNA bases to find mutations. Analyze statistics about cancer occurrence and age. Materials (per group) laboratory recordsheets pencils Safety No extra precautions are needed. Procedure 1. Imagine that you are the DNA sequence checker in a cell. First, estimate do not count the total number of mistakes you expect to find in the following two DNA base sequences. Write your estimate on the first estimate line on your laboratory recordsheet. Then carefully examine the two DNA base sequences. Look for base pairs that have the wrong complementary bases. Circle the base pairs that are wrong. Answer question 1 on your recordsheet. AATTGCGAATCATGCAGCCTGACCGCTAAACCCGATCGCTTAAGGCCTTAACCGTCAGACTA TTAACGGTTAGTACGTCGGACTGGCGATTTGGGCTAGGGAATTCCGGAATTGGCAGTCTGAT CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGACCG GACGGTCTGGCGATTTGGGCTACTACGTCCGACTGGTGCAGCCATGAATTGGCAGTCTTCTGGC 2. Suppose a strand of DNA were removed from the cells lining the lungs of a man who smokes three packs of cigarettes per day. Estimate the number of mistakes you expect to find in the following DNA base sequence from the smoker s lung cells. Write your estimate on the second estimate line on your recordsheet. Then examine the DNA base sequence. Look for base pairs that have the wrong complementary bases. Circle the bases that are mismatched. Answer question 2 on the recordsheet. GAATTGGCAGTCTGATGCAGCCTGACCACGTCGGTAAGGCCTTAATTGCCAATCATGCAGATTGG CTTAAGCGTCAGACTACGTGGGACAGGTGCAGCGATTCCCGAATTAAGGGTTAGTTCGTCTAACC 3. Examine the data in the table. Answer question 3 on the recordsheet. Percentage of People Who Develop Cancers at Certain Ages BIRTH TO TO TO 79 Males 1.68 (1 in 60) 7.51 (1 in 13) (1 in 3) Females 1.91 (1 in 52) 9.29 (1 in 11) (1 in 4) California Cancer Facts and Figures, 1995 by American Cancer Society, California Division, Inc. 124 Biotechnology Manual

3 4. The higher incidence of cancer with age may be caused by a slowing down of the DNA sequence checker. Estimate the number of mistakes you expect to find in the following DNA base sequence. Write your estimate on the third estimate line on your recordsheet. To simulate slower checking, find the number of mistakes in the strand below. Answer question 4 on the recordsheet. CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGAC- CGCCGGAATTCCGGACTGCTA GTCGGACTGGCCATTTGGGCTACTACGACGGACTGGTGCAGCCATGAATTGGCAGACTACTG- GCGGCCTTAAGGCCTGACGAT Biotechnology Manual 125

4 Laboratory Recordsheet 13 A Simulation of DNA Mutations and Cancer Estimate #1: Estimate #2: Estimate #3: ANALYSES AND CONCLUSIONS 1a. How many mistakes did you find? If you found the right number, you have saved the cell from cancer! But you must remain on guard for more mutations to come. If you did not find all the mutations, your cell is now cancerous. b. For each of the mistakes, explain what was wrong. c. Compare your estimate #1 to the actual number of mistakes. Explain any differences between the two numbers. 2a. How many mistakes did you find? 126 Biotechnology Manual

5 b. Compare your estimate #2 to the actual number of mistakes. Explain any differences between the two numbers. 3a. Using the information in the table, describe the relationship between age and cancer. b. Explain what factors you think would contribute to this relationship. c. Cigarette smoke is the number-one cause of cancer in the United States today. About 25 percent of all cancer deaths are due to cigarette smoke. Using your knowledge of cancer, explain why. 4a. How many mistakes did you find? Biotechnology Manual 127

6 b. Compare your estimate #3 to the actual number of mistakes. Explain any differences between the two numbers. c. Would this cell develop into a cancerous cell? Explain your reasoning. 128 Biotechnology Manual

THE CANCER/MITOSIS CONNECTION

THE CANCER/MITOSIS CONNECTION THE CANCER/MITOSIS CONNECTION All cells have a controlled rate of division that is appropriate for their role in the body. Rates of Division ex. The cells of the skin reproduces perfectly so that it does

More information

Cancer arises from the mutation of a normal gene. A factor which brings about a mutation is called a mutagen.

Cancer arises from the mutation of a normal gene. A factor which brings about a mutation is called a mutagen. Cancer Single cells divide by mitosis to form many cells. This cells undergo physical and chemical changes in order to perform specific functions. (we say the cells have Differentiated) in this way we

More information

SNC2D BIOLOGY 3/24/2013. TISSUES, ORGANS & SYSTEMS OF L Cancer Cell Division Gone Wrong (P.32-34) Cancer Cell Division Gone Wrong

SNC2D BIOLOGY 3/24/2013. TISSUES, ORGANS & SYSTEMS OF L Cancer Cell Division Gone Wrong (P.32-34) Cancer Cell Division Gone Wrong SNC2D BIOLOGY TISSUES, ORGANS & SYSTEMS OF L Cancer Cell Division Gone Wrong (P.32-34) Cancer Cell Division Gone Wrong A cell s DNA controls everything that happens in that cell, including cell division.

More information

Unit 4: Reproduction. Traits. Heredity. Nucleus: The Control Center. DNA deoxyribonucleic acid 09/06/2016

Unit 4: Reproduction. Traits. Heredity. Nucleus: The Control Center. DNA deoxyribonucleic acid 09/06/2016 Unit 4: Reproduction Traits Traits: are physical features of an organism. They can vary in size or form from one individual to another. Examples include eye color, height and colour vision. Heredity Heredity:

More information

Unit 9: The Cell Cycle

Unit 9: The Cell Cycle Unit 9: The Cell Cycle Name: Period: Test Date: 1 Table of Contents Title of Page Page Number Teacher Stamp Unit 9 Warm-Ups 3-4 Cell Cycle/Interphase Notes 5-6 DNA Replication Notes 7-8 DNA replication

More information

A factor which brings about a mutation is called a mutagen. Any agent that causes cancer is called a carcinogen and is described as carcinogenic.

A factor which brings about a mutation is called a mutagen. Any agent that causes cancer is called a carcinogen and is described as carcinogenic. Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer

More information

Cell Death and Cancer. SNC 2D Ms. Papaiconomou

Cell Death and Cancer. SNC 2D Ms. Papaiconomou Cell Death and Cancer SNC 2D Ms. Papaiconomou How do cells die? Necrosis Death due to unexpected and accidental cell damage. This is an unregulated cell death. Causes: toxins, radiation, trauma, lack of

More information

Even Small Sins can Cause Cancer or perhaps just bad dumb luck

Even Small Sins can Cause Cancer or perhaps just bad dumb luck Even Small Sins can Cause Cancer or perhaps just bad dumb luck Excessive Environmental risks and heredity get the most blame for cancer, but new research released says that even moderate bad lifestyle

More information

Section 1.1: Causes of Disease - Pathogens

Section 1.1: Causes of Disease - Pathogens Section 1.1: Causes of Disease - Pathogens Health A state of physical and mental well-being, free from disease. Disease An abnormal condition of an organism that impairs bodily functions and is associated

More information

CELL AGING. Process of getting older. Losing hair, wrinkled skin Fingernails- the new cells push out the old cells

CELL AGING. Process of getting older. Losing hair, wrinkled skin Fingernails- the new cells push out the old cells CELL AGING & CANCER CELL AGING What is aging? Process of getting older. Losing hair, wrinkled skin Fingernails- the new cells push out the old cells As a person ages, mitosis slows down CELL AGING COMPARISON

More information

5 3 Mutations.notebook April 10, 2017

5 3 Mutations.notebook April 10, 2017 Mutations Lesson 3 Mar 14 4:21 PM How can mutations affect an organism? How is cancer related to mutations and the cell cycle? Mar 14 4:22 PM 1 I. How can mutations affect an organism? A. Some traits are

More information

DR. RAMESH U2 L4 MITOSIS AND CANCER

DR. RAMESH U2 L4 MITOSIS AND CANCER DR. RAMESH U2 L4 MITOSIS AND CANCER Objective! The student will (TSW) identify the relationship between cancer and mitosis. Benchmark/Standard LS-H-B2: Compare mitosis and meiosis Why are we learning this?!

More information

Cellular Reproduction

Cellular Reproduction 9 Cellular Reproduction section 1 Cellular Growth Before You Read Think about the life cycle of a human. On the lines below, write some of the stages that occur in the life cycle of a human. In this section,

More information

The Cell Cycle 1 What controls the life and development of a cell?

The Cell Cycle 1 What controls the life and development of a cell? The Cell Cycle 1 What controls the life and development of a cell? Why? An old piece of poetry says to everything there is a season... a time to be born, a time to die. For cells, the line might say a

More information

Cell plate Carcinogen Oncogenes. Haploid cell Diploid cell Chromosome. Telophase Keywords Mitosis

Cell plate Carcinogen Oncogenes. Haploid cell Diploid cell Chromosome. Telophase Keywords Mitosis Cell Division Cell plate Carcinogen Oncogenes Haploid cell Diploid cell Chromosome Gene Interphase Anaphase Metaphase Telophase Keywords Mitosis Meiosis Centromere Cleavage furrow Middle lamella What is

More information

11/13/2013. Cell Size Limitations. Diffusion limits cell size. Surface area-to-volume ratio

11/13/2013. Cell Size Limitations. Diffusion limits cell size. Surface area-to-volume ratio Cell Size Limitations Section Objectives Sequence the events of the cell cycle. Relate the function of a cell to its organization in tissues, organs, and organ systems. Cells come in a wide variety of

More information

CONTROL OF CELL DIVISION

CONTROL OF CELL DIVISION CONTROL OF CELL DIVISION Regulation of cell division is necessary to determine when and how cells should divide. Types of Regulators: Internal regulators: Cyclins proteins that regulate the timing of the

More information

Acute: Symptoms that start and worsen quickly but do not last over a long period of time.

Acute: Symptoms that start and worsen quickly but do not last over a long period of time. Cancer Glossary Acute: Symptoms that start and worsen quickly but do not last over a long period of time. Adjuvant therapy: Treatment given after the main treatment. It usually refers to chemotherapy,

More information

Camel Milk and Cancer: A Possible Cure?

Camel Milk and Cancer: A Possible Cure? Camel Milk and Cancer: A Possible Cure? You may have heard that camel milk has many amazing therapeutic benefits, but did you know that it also has anti-cancer properties? In 2016 it was estimated that

More information

Cancer and Gene Alterations - 1

Cancer and Gene Alterations - 1 Cancer and Gene Alterations - 1 Cancer and Gene Alteration As we know, cancer is a disease of unregulated cell growth. Although we looked at some of the features of cancer when we discussed mitosis checkpoints,

More information

Childhood Leukemia Causes, Risk Factors, and Prevention

Childhood Leukemia Causes, Risk Factors, and Prevention Childhood Leukemia Causes, Risk Factors, and Prevention Risk Factors A risk factor is anything that affects your chance of getting a disease such as cancer. Learn more about the risk factors for childhood

More information

Chapter 9. Cells Grow and Reproduce

Chapter 9. Cells Grow and Reproduce Chapter 9 Cells Grow and Reproduce DNA Replication DNA polymerase Addition of a nucleotide to the 3 end of a growing strand Use dntps as substrate Release of pyrophosphate Initiation of Replication Replication

More information

Unit 9: The Cell Cycle

Unit 9: The Cell Cycle Unit 9: The Cell Cycle Name: Period: Test Date: 1 Table of Contents Title of Page Page Number Teacher Stamp Unit 9 Warm-Ups 3-4 Cell Cycle/Interphase Notes 5 DNA Replication Video 6 Cancer Notes 15-16

More information

Chapter 10-3 Regulating the Cell Cycle

Chapter 10-3 Regulating the Cell Cycle Chapter 10-3 Regulating the Cell Cycle Vocabulary: Cyclin Cancer Key Concepts: How is the cell cycle regulated? How are cancer cells different from other cells? I. Introduction A. An Interesting Fact About

More information

Cell Size Limitations

Cell Size Limitations Cell Size Limitations Cells come in a wide variety of sizes and shapes. Considering this wide range of cells sizes, why then can t most organisms be just one giant cell? Diffusion limits cell size Although

More information

MITOSIS: Making New Body Cells Making New DNA. The Cell Cycle and Mitosis Notes Page THE CELL CYCLE

MITOSIS: Making New Body Cells Making New DNA. The Cell Cycle and Mitosis Notes Page THE CELL CYCLE Biology is the only subject in which multiplication is the same thing as division The Cell Cycle and Mitosis Notes Page THE CELL CYCLE Series of events that s go through as they grow and divide Consists

More information

CELL DIVISION: MITOSIS 27 FEBRUARY 2013

CELL DIVISION: MITOSIS 27 FEBRUARY 2013 CELL DIVISION: MITOSIS 27 FEBRUARY 2013 Lesson Description In this lesson we: Look at related terminology Discuss the cell cycle Look at the purpose of cell division Consider what is Mitosis Look at the

More information

AllinaHealthSystems 1

AllinaHealthSystems 1 Overview Biology and Introduction to the Genetics of Cancer Denise Jones, MS, CGC Certified Genetic Counselor Virginia Piper Cancer Service Line I. Our understanding of cancer the historical perspective

More information

Cell Growth and Reproduction

Cell Growth and Reproduction Cell Growth and Reproduction Before You Read SC.F.1.4.8 The student knows that cell behavior can be affected by molecules from other parts of the organism or even from other organisms. SC.F.2.4.2 The student

More information

Cell Cycle Notes --PreAP

Cell Cycle Notes --PreAP Cell Cycle Notes --PreAP I. DNA Deoxyribonucleic acid; located in nucleus A. Long and thread-like DNA in a non-dividing cell B. Thick, short, coiled doubled DNA in a dividing cell chromosome 1. chromosome

More information

Mitosis Exploration Pd. Objective: Describe the purpose and process of cellular reproduction. 1. What is a cell?

Mitosis Exploration Pd. Objective: Describe the purpose and process of cellular reproduction. 1. What is a cell? Mitosis Exploration Name Pd Objective: Describe the purpose and process of cellular reproduction. Review: 1. What is a cell? 2. Describe the main differences between a prokaryotic and eukaryotic cell.

More information

Early Embryonic Development

Early Embryonic Development Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal

More information

Diploma in Equine Science

Diploma in Equine Science The process of meiosis is summarised in the diagram below, but it involves the reduction of the genetic material to half. A cell containing the full number of chromosomes (two pairs) is termed diploid,

More information

UNIT 4: DNA, Chromosomes, and Cell Division DAYSHEET 46: Meiosis and Sexual Reproduction

UNIT 4: DNA, Chromosomes, and Cell Division DAYSHEET 46: Meiosis and Sexual Reproduction UNIT 4: DNA, Chromosomes, and Cell Division DAYSHEET 46: Meiosis and Sexual Reproduction Name Biology I Date: Catalyst/Bellringer: Use your reading strategies as you read the article below about cancer.

More information

Biology: Cell Division and Cancer

Biology: Cell Division and Cancer Cancer Cells [Photo by Dr. Cecil Fox via Wikimedia Commons] Biology: Cell Division and Cancer High School 9-12 Corin Malone Auburn Riverside High School, Auburn School District Materials adapted from Not

More information

B.6.E identify and illustrate changes in DNA and evaluate the significance of these changes

B.6.E identify and illustrate changes in DNA and evaluate the significance of these changes B.6.E identify and illustrate changes in DNA and evaluate the significance of these changes One look around a room tells you that each person has slight differences in their physical make up and therefore

More information

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2 For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?

More information

Notes 7.5: Mitosis Gone Wrong

Notes 7.5: Mitosis Gone Wrong Notes 7.5: Mitosis Gone Wrong Central Dogma Review Information to make a protein is stored in a gene Gene: Segment of DNA that codes for a protein Proteins are used for: growth of tissue and organs, energy,

More information

DNA Damage and Repair

DNA Damage and Repair infoaging guides BIOLOGY OF AGING DNA Damage and Repair An introduction to aging science brought to you by the American Federation for Aging Research DNA BASICS DNA stands for deoxyribonucleic acid. The

More information

Cancer Cells. It would take another 20 years and a revolution in the techniques of biological research to answer these questions.

Cancer Cells. It would take another 20 years and a revolution in the techniques of biological research to answer these questions. Cancer Cells Cancer, then, is a disease in which a single normal body cell undergoes a genetic transformation into a cancer cell. This cell and its descendants, proliferating across many years, produce

More information

Cell Cycle. Cell Cycle the cell s life cycle that extends from one division to the next G1 phase, the first gap phase. S phase, synthesis phase

Cell Cycle. Cell Cycle the cell s life cycle that extends from one division to the next G1 phase, the first gap phase. S phase, synthesis phase Cell Cycle the cell s life cycle that extends from one division to the next G1 phase, the first gap phase Cell Cycle interval between cell division and DNA replication accumulates materials needed to replicate

More information

EVOLUTION. Reading. Research in my Lab. Who am I? The Unifying Concept in Biology. Professor Carol Lee. On your Notecards please write the following:

EVOLUTION. Reading. Research in my Lab. Who am I? The Unifying Concept in Biology. Professor Carol Lee. On your Notecards please write the following: Evolution 410 9/5/18 On your Notecards please write the following: EVOLUTION (1) Name (2) Year (3) Major (4) Courses taken in Biology (4) Career goals (5) Email address (6) Why am I taking this class?

More information

Cancer: Questions and Answers

Cancer: Questions and Answers Cancer: Questions and Answers Key Points The survival rate for many types of cancer has improved in recent years; however, cancer is still the second leading cause of death in the United States (see paragraph

More information

Unit 5 Part B Cell Growth, Division and Reproduction

Unit 5 Part B Cell Growth, Division and Reproduction Unit 5 Part B Cell Growth, Division and Reproduction Cell Size Are whale cells the same size as sea stars cells? Yes! Cell Size Limitations Cells that are too big will have difficulty diffusing materials

More information

CELL BIOLOGY - CLUTCH CH CANCER.

CELL BIOLOGY - CLUTCH CH CANCER. !! www.clutchprep.com CONCEPT: OVERVIEW OF CANCER Cancer is a disease which is primarily caused from misregulated cell division, which form There are two types of tumors - Benign tumors remain confined

More information

Causes, Risk Factors, and Prevention of Ewing Tumors

Causes, Risk Factors, and Prevention of Ewing Tumors Causes, Risk Factors, and Prevention of Ewing Tumors Risk Factors A risk factor is anything that affects your chance of getting a disease such as cancer. Learn more about the risk factors for Ewing tumors.

More information

DNA, Genes, and Chromosomes. The instructions for life!!!

DNA, Genes, and Chromosomes. The instructions for life!!! DNA, Genes, and Chromosomes The instructions for life!!! Gene Segment of DNA that has the information (the code) for a protein or RNA. A single molecule of DNA has thousands of genes on the molecule. Remember

More information

Question #1 Controls on cell growth and division turned on and off

Question #1 Controls on cell growth and division turned on and off Lesson Overview 10.3 Regulating the Cell Cycle Question #1 Controls on cell growth and division turned on and off When cells are grown in the laboratory, most cells will divide until they come into contact

More information

Chemotherapy Resistance: The Fault in Our Cells

Chemotherapy Resistance: The Fault in Our Cells Chemotherapy Resistance: The Fault in Our Cells [MUSIC PLAYING] JOHN F. KENNEDY: We choose to go to the moon. We choose to go to the moon in this decade and do the other things, not because they are easy,

More information

Interest Grabber Answers

Interest Grabber Answers Interest Grabber Answers Knowing When to Stop Suppose you had a paper cut on your finger. Although the cut may have bled and stung a little, after a few days, it will have disappeared, and your finger

More information

What is DNA? DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone.

What is DNA? DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone. What is DNA? DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Nearly every cell in a person s body has the same DNA. Most DNA is located in the cell nucleus

More information

GENETICS NOTES. Chapters 12, 13, 14, 15 16

GENETICS NOTES. Chapters 12, 13, 14, 15 16 GENETICS NOTES Chapters 12, 13, 14, 15 16 DNA contains the genetic code for the production of PROTEINS. A gene is a segment of DNA, which consists of enough bases to code for many different proteins. The

More information

- A cancer is an uncontrolled, independent proliferation of robust, healthy cells.

- A cancer is an uncontrolled, independent proliferation of robust, healthy cells. 1 Cancer A. What is it? - A cancer is an uncontrolled, independent proliferation of robust, healthy cells. * In some the rate is fast; in others, slow; but in all cancers the cells never stop dividing.

More information

Cancer 101 Spring Family Cancer Retreat 4/18/15. Amish Shah, M.D. New Mexico Cancer Center

Cancer 101 Spring Family Cancer Retreat 4/18/15. Amish Shah, M.D. New Mexico Cancer Center Cancer 101 Spring Family Cancer Retreat 4/18/15 Amish Shah, M.D. New Mexico Cancer Center Topics to cover What is Cancer? Screening Diagnosis/Staging Treatment Basics Clinical Trials Surveillance What

More information

Wellness Along the Cancer Journey: Health Habits and Cancer Screening Revised October 20, 2015

Wellness Along the Cancer Journey: Health Habits and Cancer Screening Revised October 20, 2015 Wellness Along the Cancer Journey: Health Habits and Cancer Screening Revised October 20, 2015 Healthy Habits and Cancer Screening Rev. 10.20.15 Page 164 WELLNESS ALONG THE CANCER JOURNEY: HEALTHY HABITS

More information

Immunotherapy Narrative Script:

Immunotherapy Narrative Script: Immunotherapy Narrative Script: In order to understand immunotherapy, there are a few things we need to get straight in our heads first. The first thing we need to get a general understanding of is what

More information

Reproduction is a fundamental property of life. Cells are the fundamental unit of life. Reproduction occurs at the cellular level with one mother

Reproduction is a fundamental property of life. Cells are the fundamental unit of life. Reproduction occurs at the cellular level with one mother Cell Division ision Reproduction is a fundamental property of life. Cells are the fundamental unit of life. Reproduction occurs at the cellular level with one mother cell giving rise to two daughter cells.

More information

Rhabdomyosarcoma Causes, Risk Factors, and Prevention

Rhabdomyosarcoma Causes, Risk Factors, and Prevention Rhabdomyosarcoma Causes, Risk Factors, and Prevention Risk Factors and Causes A risk factor is anything that affects your chance of getting a disease such as cancer. Learn more about the risk factors and

More information

What can lead to aneuploidy?

What can lead to aneuploidy? 11.06.17 What can lead to aneuploidy? A Mitotic checkpoint defects B Cohesion defect C Centrosome amplification D Hyperstabilized kinetochore microtubule interactions IB SL Biology Exam. Deadlines and

More information

Guide to Understanding Lung Cancer

Guide to Understanding Lung Cancer Guide to Understanding Lung Cancer Lung cancer is the second most common cancer overall for men and women in the U.S., with an estimated 222,500 new cases in 2017. However, lung cancer is the most common

More information

Student Exploration: Virus Lytic Cycle

Student Exploration: Virus Lytic Cycle Name: Date: Student Exploration: Virus Lytic Cycle Vocabulary: bacteriophage, capsid, host cell, lyse, lytic cycle, virus Prior Knowledge Questions (Do these BEFORE using the Gizmo.) 1. A computer virus

More information

6.3 DNA Mutations. SBI4U Ms. Ho-Lau

6.3 DNA Mutations. SBI4U Ms. Ho-Lau 6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide

More information

Chapter 5: Cell Growth and Division

Chapter 5: Cell Growth and Division Chapter 5: Cell Growth and Division 1 Background Info Formation of New Cells ~2 trillion cells formed/day in human body ~25 million cells/second Cell division = cell reproduction DNA must be copied before

More information

Understanding Cancer

Understanding Cancer Understanding Cancer Use the resources provided to complete this worksheet. Section 1: Factors Reported to Be Associated with Cancer Read the News Alert items and use the information provided to identify

More information

3. สม ฏฐานว ทยาของมะเร ง (Cancer Etiology)

3. สม ฏฐานว ทยาของมะเร ง (Cancer Etiology) ว ตถ ประสงค 3. สม ฏฐานว ทยาของมะเร ง (Cancer Etiology) สม ฏฐานว ทยา : การศ กษาเก ยวก บสาเหต ของการเก ดโรค สามารถอธ บายว ธ การศ กษา ว ธ การศ กษาสาเหต ของการเก ดมะเร งได สามารถอธ บายสาเหต สาเหต ของการเก

More information

What is the effect of radiation on astronauts? What damage can it do?

What is the effect of radiation on astronauts? What damage can it do? Radiation in depth What is the effect of radiation on astronauts? What damage can it do? One of the biggest challenges in sending astronauts to destinations beyond the International Space Station, which

More information

Cancer. Chapter 31 Lesson 2

Cancer. Chapter 31 Lesson 2 Cancer Chapter 31 Lesson 2 Tumors All cancers are tumors- masses of tissue. Not all tumors are cancers. Some tumors are benign- noncancerous. These tumors are surrounded by membranes that prevent them

More information

Emphysema. Lungs The lungs help us breathe in oxygen and breathe out carbon dioxide. Everyone is born with 2 lungs: a right lung and a left lung.

Emphysema. Lungs The lungs help us breathe in oxygen and breathe out carbon dioxide. Everyone is born with 2 lungs: a right lung and a left lung. Emphysema Introduction Emphysema is a type of chronic obstructive pulmonary disease, or COPD. COPD affects millions of people worldwide. Emphysema involves damage to the air sacs in the lungs. This makes

More information

Cancer and Cell Differentiation

Cancer and Cell Differentiation Cancer and Cell Differentiation Recall The cell cycle consists of interphase, mitosis, and cytokinesis. Recall During S phase of interphase, the DNA is replicated to prepare for mitosis. Each daughter

More information

Section 9. Junaid Malek, M.D.

Section 9. Junaid Malek, M.D. Section 9 Junaid Malek, M.D. Mutation Objective: Understand how mutations can arise, and how beneficial ones can alter populations Mutation= a randomly produced, heritable change in the nucleotide sequence

More information

Cell Division. Chromosome structure. Made of chromatin (mix of DNA and protein) Only visible during cell division

Cell Division. Chromosome structure. Made of chromatin (mix of DNA and protein) Only visible during cell division Chromosome structure Made of chromatin (mix of DNA and protein) Only visible during cell division Chromosome structure The DNA in a cell is packed into an elaborate, multilevel system of coiling and folding.

More information

Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so:

Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so: Genetics 2 Genetic Diagrams and Mendelian Genetics: Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so: P parent generation

More information

Unit 2: Reproduction and Development. The Cell Cycle

Unit 2: Reproduction and Development. The Cell Cycle PAGE : 1 The Cell Cycle Cell Cycle: A continuous series of cell growth and division for a cell. All cells go through a cell cycle of some sort. The cell cycle consists of two stages. a. Growth Phase Diagram

More information

You might be interested in reading an excerpt from Dimensions

You might be interested in reading an excerpt from Dimensions Take notes (minimum 1 page) on the following reading. Then review using the animation (link at bottom) and answer the quiz questions at the bottom of the webpage. To get credit for this assignment you

More information

Gene Expression and Mutation

Gene Expression and Mutation Gene Expression and Mutation GENE EXPRESSION: There are hormonal and environmental factors that may cause the expression of some genetic information. Some examples are: 1. The two- colour pattern of some

More information

What You Need to Know About Lung Cancer Immunotherapy

What You Need to Know About Lung Cancer Immunotherapy What You Need to Know About Lung Cancer Immunotherapy Lung.org/immunotherapy What is immunotherapy? Immunotherapy for cancer, sometimes called immune-oncology, is a type of medicine that treats cancer

More information

Overview. Chapter 3: Cells and Their Functions. The Cell. Key Terms. Microscopes. Microscopes. Cytology The study of cells

Overview. Chapter 3: Cells and Their Functions. The Cell. Key Terms. Microscopes. Microscopes. Cytology The study of cells Overview Chapter 3: Cells and Their Functions Key Terms The Cell active transport filtration mitochondria cancer gene mitosis carcinogen hemolysis mutation chromosome hypertonic nucleus cytology hypotonic

More information

3. What law of heredity explains that traits, like texture and color, are inherited independently of each other?

3. What law of heredity explains that traits, like texture and color, are inherited independently of each other? Section 2: Genetics Chapter 11 pg. 308-329 Part 1: Refer to the table of pea plant traits on the right. Then complete the table on the left by filling in the missing information for each cross. 6. What

More information

Section 40 1 Infectious Disease (pages )

Section 40 1 Infectious Disease (pages ) Chapter 40 The Immune System and Disease Section 40 1 Infectious Disease (pages 1031 1035) Key Concepts What causes disease? How are infectious diseases transmitted? Introduction (page 1031) 1. Any change,

More information

Section 40 1 Infectious Disease (pages )

Section 40 1 Infectious Disease (pages ) Chapter 40 The Immune System and Disease Section 40 1 Infectious Disease (pages 1031 1035) What causes disease? How are infectious diseases transmitted? Introduction (page 1031) 1 Any change, other than

More information

2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November

2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Class: Date: 2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Multiple Choice 1 point each Identify the choice that best completes the statement

More information

Tuesday 6 June 2017 Afternoon

Tuesday 6 June 2017 Afternoon Oxford Cambridge and RSA Tuesday 6 June 2017 Afternoon AS GCE HUMAN BIOLOGY F222/01/TEST Growth, Development and Disease *6761736299* Candidates answer on the Question Paper. OCR supplied materials: Advance

More information

BIT 120. Copy of Cancer/HIV Lecture

BIT 120. Copy of Cancer/HIV Lecture BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations

More information

REGULATING the CELL CYCLE.

REGULATING the CELL CYCLE. REGULATING the CELL CYCLE http://www.travel-net.com/~andrews/images/animations/traffic.gif CELL DIVISION GENES Some cells divide frequently (some human skin cells divide once/hour) Some cells divide occasionally

More information

Cell Growth and Division

Cell Growth and Division Name Class Date 10 Cell Growth and Division Big idea Growth, Development, and Reproduction Q: How does a cell produce a new cell? WHAT I KNOW WHAT I LEARNED 10.1 Why do cells divide? 10.2 How do cells

More information

GENE EXPRESSION. Amoeba Sisters video 3pk9YVo. Individuality & Mutations

GENE EXPRESSION. Amoeba Sisters video   3pk9YVo. Individuality & Mutations Amoeba Sisters video https://www.youtube.com/watch?v=giez 3pk9YVo GENE EXPRESSION Individuality & Mutations Complete video handout http://www.amoebasisters.com/uploads/ 2/1/9/0/21902384/video_recap_of_muta

More information

Viruses Tomasz Kordula, Ph.D.

Viruses Tomasz Kordula, Ph.D. Viruses Tomasz Kordula, Ph.D. Resources: Alberts et al., Molecular Biology of the Cell, pp. 295, 1330, 1431 1433; Lehninger CD Movie A0002201. Learning Objectives: 1. Understand parasitic life cycle of

More information

Part II The Cell Cell Division, Chapter 2 Outline of class notes

Part II The Cell Cell Division, Chapter 2 Outline of class notes Part II The Cell Cell Division, Chapter 2 Outline of class notes 1 Cellular Division Overview Types of Cell Division Chromosomal Number The Cell Cycle Mitoses Cancer Cells In Vitro Fertilization Infertility

More information

Doctor office visit checklist

Doctor office visit checklist Doctor office visit checklist Before the visit Gather your questions Identify symptoms Check your loved one s file Call to confirm appointment Take a list of any medicines the patient is currently taking

More information

Genes and Proteins. Key points: The DNA must be copied and then divided exactly so that each cell gets an identical copy.

Genes and Proteins. Key points: The DNA must be copied and then divided exactly so that each cell gets an identical copy. Mitosis Genes and Proteins Proteins do the work of the cell: growth, maintenance, response to the environment, reproduction, etc. Proteins are chains of amino acids. The sequence of amino acids in each

More information

The Cell Cycle. Materials 2 pipe cleaners of one color and 2 of another color Drawing paper

The Cell Cycle. Materials 2 pipe cleaners of one color and 2 of another color Drawing paper The Cell Cycle Introduction When the cell has reached its growth potential it will begin to divide. Additionally, if a cell has become damaged or worn out it can be replaced by surrounding cells through

More information

Chromosomal Mutations

Chromosomal Mutations Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens

More information

Introduction to Basic Oncology

Introduction to Basic Oncology Introduction to Basic Oncology Cancer Cell AHS 102 Med Term Dr. Susie Turner 1/3/13 General Oncology Study of Tumors Neoplasms/Tumors Abnormal growth of new tissue Are either; Benign or Malignant Onc/o

More information

Biology is the only subject in which multiplication is the same thing as division

Biology is the only subject in which multiplication is the same thing as division The Cell Cycle Biology is the only subject in which multiplication is the same thing as division Why do cells divide? For reproduction asexual reproduction For growth one-celled organisms from fertilized

More information

Histones- protein molecules that are used to fold and package DNA into chromosomes.

Histones- protein molecules that are used to fold and package DNA into chromosomes. Chromosome- a portion of the DNA in a cell, a chromosome is created when the DNA segment coils around histones then twists further to create a long twisted mass. Histones- protein molecules that are used

More information

The Immune System and Disease

The Immune System and Disease Chapter 40 The Immune System and Disease Section 40 1 Infectious Disease (pages 1029 1033) This section describes the causes of disease and explains how infectious diseases are transmitted Introduction

More information

Chapter 18- Oncogenes, tumor suppressors & Cancer

Chapter 18- Oncogenes, tumor suppressors & Cancer Chapter 18- Oncogenes, tumor suppressors & Cancer - Previously we have talked about cancer which is an uncontrolled cell proliferation and we have discussed about the definition of benign, malignant, metastasis

More information

Non-communicable diseases

Non-communicable diseases Non-communicable diseases Hodder & Stoughton 2015 learning outcomes Define health and describe factors that can affect improve it Define a non-communicable disease (NCD) and give examples Describe the

More information

Bacteria and Viruses

Bacteria and Viruses CHAPTER 13 LESSON 3 Bacteria and Viruses What are viruses? Key Concepts What are viruses? How do viruses affect human health? What do you think? Read the two statements below and decide whether you agree

More information

Mutations. A2 Biology For WJEC

Mutations. A2 Biology For WJEC 12. Mutation is a change in the amount, arrangement or structure in the DNA of an organism. 13. There are two types of mutations, chromosome mutations and gene mutations. Mutations A2 Biology For WJEC

More information