Correspondence should be addressed to Aishah Adam; aishah

Size: px
Start display at page:

Download "Correspondence should be addressed to Aishah Adam; aishah"

Transcription

1 BioMed Researh International, Artile ID 53967, 13 pages Researh Artile Apoptosis Indution by Polygonum minus Is Related to Antioxidant Capaity, Alterations in Expression of Apoptoti-Related Genes, and -Phase Cell Cyle Arrest in HepG2 Cell Line Mohd Alfazari Mohd Ghazali, 1,2,3 Ghanya Al-Naqeb, 4 Kesavanarayanan Krishnan elvarajan, 1,2 Mizaton Hazizul Hasan, 1,2 and Aishah Adam 1,2 1 Pharmaology and Toxiology Researh Laboratory, Faulty of Pharmay, University Tehnology MARA (UiTM), 423 Bandar Punak Alam, elangor Darul Ehsan, Malaysia 2 Group on Affinity, Effiay and afety tudies (OAE), Brain and Neurosiene Communities of Researh, University Tehnology MARA (UiTM), 445 hah Alam, elangor Darul Ehsan, Malaysia 3 hool of Pharmaeutial ienes, University iene of Malaysia (UM), 118 Minden, Penang, Malaysia 4 Department of Food ienes and Tehnology, Faulty of Agriulture, University of ana a, ana a, Yemen Correspondene should be addressed to Aishah Adam; aishah adam@punakalam.uitm.edu.my Reeived 27 February 214; Aepted 1 April 214; Published 13 May 214 Aademi Editor: Joohun Ha Copyright 214 Mohd Alfazari Mohd Ghazali et al. This is an open aess artile distributed under the Creative Commons Attribution Liense, whih permits unrestrited use, distribution, and reprodution in any medium, provided the original work is properly ited. Polygonum minus (Polygonaeae) is a mediinal herb distributed throughout eastern Asia. The present study investigated antiproliferative effet of P. minus and its possible mehanisms. Four extrats (petroleum ether, methanol, ethyl aetate, and water) were prepared by old maeration. Extrats were subjeted to phytohemial sreening, antioxidant, and antiproliferative assays; the most bioative was frationated using vauum liquid hromatography into seven frations (F1 F7). Antioxidant ativity was measured via total phenoli ontent (TPC), 2,2-diphenyl-1-pirylhydrazyl (DPPH), and ferri reduing antioxidant power (FRAP) assays. Antiproliferative ativity was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Most ative fration was tested for apoptosis indution and ell yle arrest in HepG2 ells using flow ytometry and onfoal mirosopy. Apoptoti-related gene expression was studied by RT-PCR. Ethyl aetate extrat was bioative in initial assays. Its fration, F7, exhibited highest antioxidant apaity (TPC; ± 6.2 mg GAE/g extrat, DPPH; EC 5 : 3.5 ± 3.2 μg/ml, FRAP; 1169 ± 2.3 μmol Fe (II)/mg extrat) and seletive antiproliferative effet (IC 5 : ± 1.5 μg/ml). F7 indued apoptosis in onentration- and time-dependent manner and aused ell yle arrest at -phase. Upregulation of proapoptoti genes (Bax, p53, and aspase-3) and downregulation of antiapoptoti gene, Bl-2, were observed. In onlusion, F7 was antiproliferative to HepG2 ells by induing apoptosis, ell yle arrest, and via antioxidative effets. 1. Introdution Apoptosis plays an important role in aner development and is a target for enhaning understanding of aner and in development of antianer treatment. Apoptosis is a highly regulated proess haraterized by leavage of proteins and ativation of aspases in viable ells resulting in DNA fragmentation, hromatin ondensation, membrane blebbing, and ell shrinkage [1]. This proess is essential for homeostati mehanism to maintain ellular integrity by removing unwanted, redundant, and damaged ells by noninflammatory ways. However, in many aner ells, apoptosis is dysregulated due to multiple geneti aberrations and ellular stress, onferring resistane to death in these

2 2 BioMed Researh International ells whih then stay longer in irulation. In the last two deades, extensive studies aimed at improving understanding of intrinsi signaling pathways that ontrol exeution of apoptosis in aner ells were undertaken. These inlude the use of antiapoptoti proteins and stimulation of proapoptoti proteins as part of treatment strategy for aner [2]. Carinogenesis is also related to exessive free radial formation. Many studies have shown that reative oxygen speies (RO), reative nitrogen speies (RN), and other metabolism byproduts an ause DNA mutation leading to initiation and progression of aner. Endogenous and exogenous antioxidants an antagonize the promotion phase of arinogenesis in many types of malignanies through detoxiation of these free radials [3]. Antioxidants from plants with apoptosisinduing apabilities have drawn a lot of interest in aner researh due to ost effetiveness as they are abundant in nature and supposedly have fewer side effets than syntheti antioxidants. Muh work has been onduted on herbs with antioxidant and antianer effets [4]. Polygonum minus, family Polygonaeae, is loally known as kesum in Malaysia. It is extensively used in ertain types of Malay dishes suh as laksa or asam pedas. It is used traditionally to treat rheumatism, indigestion, and kidney stones and to ontrol hair dandruff. Researhers have linked the pharmaologial effets of this plant to its high antioxidant apaity. Aqueous, methanoli, and ethanoli extrats of this plant showed high antioxidant ativity whih wasontributedmostlybyitsphenoliompounds[5 9]. Frations from ethanoli and aqueous extrat demonstrated gastroprotetive effet by inhibiting uler lesions in stomah wall of ethanol-indued gastri uler in rats [1, 11]. Antimirobial ativities against several strains of bateria were shown and moderate antiproliferative effet was observed in human ervial arinoma (HeLa) ell line with IC 5 of approximately 3 μg/ml with ethanoli extrat [12]. No ytotoxiity was seen in normal human lung fibroblast ell line (Hs888Lu) that was exposed to aqueous and ethanoli extrats [13]. Determinationofauteandsubauteoraltoxiities of aqueous extrat in Wistar rats at the highest dose gave no signifiant hanges in food and water intake, behavior, blood hemistry, hematology parameters, and neurologial assessment [14]. The present study was undertaken to assess the antiproliferative ativity and antioxidant apaity of P. minus and to examine mehanism(s) of ation of the most ative fration. This involved identifiation of the most bioative rude extrat in terms of high antioxidant ativity and potent antiproliferative ativity. This rude extrat was further subjeted to hromatographi frationation and retested. The fration with smallest IC 5 in antiproliferative assay using HepG2 ells was assessed for apoptosis indution by looking at ell yle arrest and expression of several apoptoti-related genes. 2. Materials 2.1. Chemials. Petroleum ether, methanol, hexane, and ethyl aetate were purhased from Fisher ientifi, UA. ilia gel 6 PF 254 was proured from Merk, Germany. Folin-Cioalteu reagent, 2,2-diphenyl-1-pirylhydrazyl, MTT powder, 2,4,6-tris(2-pyridyl)-s-triazine, sodium arbonate, opper sulfate, sodium hloride, sodium potassium tartrate, phosphate buffered saline ph 7.4 (PB), and galli aid were aquired from igma, UA. Annexin-V and propidium iodide (PI) were obtained from Beton Dikinson, UA. Total RNA Isolation kit and TUNEL assay kit were bought from Promega, UA. All primers were synthesized by Beaon designer, Premier Biosoft International Plant Material. Plant material was proured in eri Kembangan, elangor, Malaysia. Plant was identified by Dr hamsul Khamis, Institute of Biosiene, University Putra Malaysia, and a vouher speimen K 215/12 was deposited at the herbarium of Atta-ur-Rahman Researh Institute of Natural Produts (AURiND UiTM). 3. Methods 3.1. tudy Design. The flow hart of the study is shown in Figure Extration and Frationation. Leaves were manually piked from stems. Fresh leaves of P. minus were dried at room temperature for 24 h and subjeted to 4 Covenfora week to dry ompletely. Dried leaves were hopped finely into powder form using a ommerial grinder for 15 min. Plant powder was soaked in several organi solvents petroleum ether, methanol (MeOH), ethyl aetate (EtOA), and water for 24 up to 72 h in a ratio of 1 : 2 w/v as per methods desribed earlier [15]. The extrat was filtered using filter paper Whatman number 1 before being dried at redued pressure in rotary evaporator (Bühi, witzerland) to give a green olored extrat. Vauum liquid hromatography (VLC) method was employed to separate the most bioative rude extrat. ilia gel 6 PF 254 was paked into the VLC olumn (1 m 1m) and washed with hexane until fully paked. The rude extrat (1 g) was dissolved in ethyl aetate and preabsorbedontosiliagel6.theolumnwastheneluted via gradient elution with a ombination of hexane and ethyl aetate in a ratio 9.5 :.5. The yield was olleted into small bottles and pooled based on thin layer hromatography (TLC) pattern Phytohemial reening. Extrat (2 mg) was dissolved in 1 ml of MeOH and filtered. Filtrate (1 ml) was transferred into two test tubes and a few drops of onentrated HCl were added. To test for flavonoids, the first tube was shaken for 2 min, and a piee of magnesium powder was then added. A positive result was indiated by a hange in olor of the sample to red. The seond tube was shaken for 2 min and a few drops of Mayer s reagent were added. Formation of a yellow-ream preipitate showed presene of alkaloids. To detet presene of saponins in extrat, 5 mg of extrat was mixed with 5 ml distilled water (dh 2 O) in a test tube whih wasthenshakenvigorously.formationofastablefrothforat least 15 min indiated presene of saponins.

3 BioMed Researh International 3 Air dried P. minus leaves Cold maeration h (solvents: pet. ether; methanol; ethyl aetate; water) Pet. ether extrat Methanol extrat Ethyl aetate extrat Water extrat Phytohemial sreening, antiproliferative assay (MTT), and antioxidant assay (TPC, FRAP, and DPPH) Ethyl aetate (bioative extrat) Vauum liquid hromatography even frations F1 F2 F3 F4 F5 F6 F7 MTT, TPC, FRAP, and DPPH F7 (bioative fration) Apoptosis Annexin-VFITC/PI Cell yle analysis Tunnel assay Apoptoti mehanism BCl 2 and Bax P53 Caspase-3 Figure1:Flowhartofstudy Determination of Antioxidant Capaity Total Phenoli Content Assay. Total phenoli ontent (TPC) was measured using proedures desribed earlier [16]. Galli aid was used as standard against whih TPC of every fration was ompared. odium arbonate, opper sulfate, and sodium potassium tartrate in the ratio of 1 : 1 : 1 was mixed well and prepared fresh before experiment. The mixture was pipetted into tubes ontaining test sample or standard and left for 15 min. After this time, a mixture of Folin-Cioalteu reagent and water (1 : 3) was added whilst vortexing. The mixture was allowed to stand at room temperaturefor35mininthedark.absorbanewasread spetrophotometrially at 75 nm DPPH avenging Assay. Priniple of this assay is to detet ability of test sample to redue DPPH free radials. Method of [17] was used. DPPH was dissolved in ethanol5% andmixedwithhepebufferand.9%naclin5mldh 2 O and adjusted to ph 7.4. Test sample was dissolved in MeOH. ample (5 μl) was added to 195 μl of ie old DPPH solution and allowed to stand at room temperature for 3 min. Test sample was then transferred to lear and transparent 96- well plates and was read using a miroplate reader (unrise, Tean, witzerland) at 517 nm. Perent savenging effet was alulated using the formula: % savenging effet = (A As/A) 1, (1) whereaisabsorbaneofontrolandasisabsorbaneof sample Ferri Reduing Antioxidant Power (FRAP) Assay. Antioxidant ativity was measured using a modified FRAP assay method [18]. FRAP values were obtained by omparing theabsorbanehangeat593nmintestreationmixtures with those ontaining ferrous ions in known onentration.

4 4 BioMed Researh International odium aetate (3 mm), ph 3.6 in 1 L dh 2 O, 1 mm of 2,4,6-tris(2-pyridyl)-s-triazine (TPTZ) in 1 ml of 4 mm HCL,and2mMferrihloridewereombinedinaratio of 1 : 1 : 1 (v/v/v) fresh prior to experiment. Test samples (1 μl) were mixed with 3 ml of FRAP reagent and allowed to stand at room temperature for 4 min before reading the absorbane spetrophotometrially at 593 nm. The FRAP value was expressed as μmol Fe (II)/mg dry weight of extrat. FeO 4 (2 mm) was used to onstrut a standard urve Antiproliferative Ativity MTT Assay. MTT assay was performed as previously desribed [19]. Crude extrat was dissolved in 1% dimethyl sulfoxide (DMO) and prepared fresh prior to assay. Cells (2 1 4 /well)wereplatedin96-wellplateandinubatedat37 C for 24 h. Next day, ells were treated with the rude extrat in DMO (<.5%) and the plate was inubated for 72 h. Then, MTT solution (5 μl) was added into eah well and inubated for 4 h. upernatant in eah well was then olleted and DMO (1 μl) was used to dissolve the formazan rystal in the well. The plate was read with a miroplate reader at 57 nm Flow Cytometry Analysis. Flow ytometry analysis was arried out to investigate proportion of aner ells undergoing apoptosis using annexin-v onjugated with fluoresein isothioyanate (FITC) detetion kit aording to manufaturer s instrutions. Cells (1 1 6 /well) were seeded onto 24- well plates and inubated at 37 C overnight. Next day, ells were treated with various onentrations of the extrat and inubatedfor24,48,and72h,respetively.afterthis,ells were detahed using trypsin for 5 min. Cells were olleted and entrifuged at 1 rpm for 5 min. Cell pellet was washed with PB and resuspended in 1 μl binding buffer. ubsequently, 2.5 μl annexin V-FITC and 3 μl propidium iodide (PI) were added and kept in the dark at room temperature for 15 min. Annexin V-FITC/PI stained ells were analyzed using flow ytometry (FACCalibur, Beton Dikinson, UA) Cell Cyle Analysis. Cells were treated as desribed in flow ytometry analysis. After treatment and inubation for 24 and 48 h, ells were harvested and fixed with ie-old 7% ethanol (1 ml) at 2 Cfor2h.Ethanolwasthenremoved (1 rpm, 5 min) and the ells were washed twie with old PB. ubsequently, ells were resuspended in 425 μl of PB, 25 μl PI (1 mg/ml), and 5 μl RNaseA (1 mg/ml) and inubated for 3 min at room temperature. Distribution of the ell yle was measured by flow ytometer and data analysis was arried out with ModFitLT software (version 4) [2] TUNEL Assay. TUNEL assay was performed as per proedures desribed in the kit (DeadEnd Fluorometri TUNEL ystem kit, Promega, UA). HepG2 ells ( /well) were plated in fluorometri dish overnight. The next day, ells were treated with F7 and inubated for 48 h. taining protool was arried out aording to manufaturer s instrutions of the kit. peimens were viewed under fluoresene onfoal mirosope (Leia TC PE, Germany) to identify apoptoti ells Gene Expression tudies. HepG2 ells were seeded in T25 flasks and allowed to attain 7 8% onflueny. The next day, ells were treated with F7 for 48 h using three onentrations (12.5, 25, and 37.5 μg/ml). These onentrations were determined from preliminary experiments to determine growth-response urves by MTT assay and verified by flow ytometry. They orrespond to IC 25,IC 5, and IC 75, respetively. Total RNA extration was arried out using the proedures desribed in Total RNA Isolation kit (Promega, UA). Conentration of RNA was alulated using biophotometer (BioRad, UA) and purity of RNA was determined. Mastermix (12.5 μl)ontaining YBR green dye as detetor was added with 1.5 μlofpurerna,.5μlrnase, 1 μl of eah forward and reverse primers, and 8.5 μl of dh 2 Otogiveafinalreationmixtureofapproximately25μL. PCR produt was then subjeted to Corbett thermal yler (Corbett Researh, Australia). Optimized PCR amplifiation omprised an initial denaturation step at 42 C for 3 min, followed by denaturation at 95 Cfor1min,annealingat 95 C for 15 se, extension at 5 C for 3se, and final extension step at 72 Cfor3se.Melturveswereanalysedto hek for absene of mispriming. Possibility of genomi DNA influene on the results was eliminated by use of primers. Eah experiment was performed three times and all samples were run in tripliates. Expression levels for eah gene relative to housekeeping gene, β-atin,were alulated for all samples using Rotor-Gene (version 1.7, Corbett Researh) and Mirosoft Exel. Analysis of gene expression data was arried out by ΔΔCT method of relative quantifiation as desribed in [21]. Ratio in untreated ells (negative ontrol) was assigned as tatistial Analysis. Eah experiment was onduted three times and determinations were in tripliates. Data were analyzed by analysis of variane (ANOVA) and Bonferroni test using P software (version 2). tatistial signifiane was fixed at P <.5. Valuesareshownasmean± standard deviation (.D.). 4. Results and Disussion 4.1. Extration and Frationation. The yield for petroleum ether extrat was 12.9 g (1.32%), 12 g (9.6%) for MeOH extrat, and 9.8 g (7.84%) for ethyl aetate extrat from 125 g of leaf powder. Frationation of the ethyl aetate extrat (1 g) yielded F7 as the highest yield of 2.2 g (22%), F6 of 1.8 g (18%), F5, and F4: 1.2 g (12%) eah, F3, F2, and F1,.88 g (8.8%),.7 g (7%), and 6.8 g (6.8%), respetively Antioxidant Ativity. The antioxidant ativity of rude extratsisshownintable 1 and frations isolated from EtOA rude extrat are shown in Table 2.

5 BioMed Researh International 5 Crude extrat Table 1: Antioxidant ativities of four rude extrats of P. minus. TPC (mg GAE/g extrat) DPPH savenging ativity (EC 5 )(μg/ml) FRAP value (μmol Fe (II)/mg dry weight extrat) Pet. Ether 78.2 ± 3.2 a ± 2.2 a ± 4.9 a MeOH ± 7.8 b 54 ± 1.8 b ± 4.2 b EtOA 227 ± ± ± 28.9 Water ± 1.3 b ± 15.2 b ± 21.3 b Values are mean ±.D (n =3). Values with different alphabets in the same olumn are signifiantly different (P <.5, ANOVA and Bonferroni test). GAE: galli aid equivalents. EtOA frations Table 2: Antioxidant ativities of frations isolated from EtOA rude extrat of P. minus. TPC (mg GAE/g extrat) DPPH savenging ativity (EC 5 )(μg/ml) FRAP value (μmol Fe (II)/mg dry weight extrat) F1 ND >1mg/mL ND F ± 3.5 a 568 ± 8.7 a ± 8.4 a F ± 4.2 a ± 5.7 b ± 1.7 b F ± 3.1 b 2.2 ± ± 26.5 F ± ± 3.2 d ± 17.2 d F6 96 ± 6.7 d 9.2 ± 4.5 e ± 1.9 e F ± 6.2 e 3.5 ± 3.2 f ± 2.3 f Trolox 99 ± 2.4 d ND ND Chlorogeni aid ND ± 2.8 g ND Asorbi aid ND ND ± 51.5 g Values are mean ±.D (n =3). Values with different alphabets in the same olumn are signifiantly different (P <.5, ANOVA and Bonferroni test). GAE: galli aid equivalents. ND: not determined. Table 3: Qualitative analysis of phytohemials of P. minus. Phytohemial test Extrat of P. minus Pet. ether EtOA MeOH Water Flavonoids Alkaloids +++ aponins Remarks: +++: high intensity; ++: moderate intensity; +: less intensity; : absent Phytohemial reening. TPC of the four rude extrats was determined from a linear galli aid standard urve (y =.5x +.132, R 2 =.982)(Table 1). There was a signifiant differene (P <.5) in TPC among the extrats with EtOA extrat exhibiting the highest TPC. This indiates that EtOA was the best solvent to extrat phenoli omponents from this plant. imilar findings were reported by [22 24]. Qualitative analysis of P. minus rude extrats also pointed to high amounts of flavonoids, a polyphenol group, in EtOA extrat (Table 3). ubsequent frationation of EtOA rude extrat yielded 7 frations (Table 2). Of these, F7 had the highest TPC value, higher even than that of Trolox, a vitamin E analogue. Frationation using solvent elution from nonpolar solvent (hexane) to more polar solvent (EtOA) yielded frations with different hemial onstituents. TPC ontent of eah of these frations was signifiantly smaller than that of rude extrat suggesting that the phenoli omponents wereseparatedbasedontheirpolarity.umoftpcofthese frations was larger than that of EtOA rude extrat pointing to possible interations between hemials in rude extrats whih resulted in attenuation of its reduing power whih was themainprinipleofthetpcassay[16]. DPPH assay results were presented as onentration of extrat whih savenged 5% of DPPH radials (EC 5 ). EtOA extrat showed lowest EC 5 of 12.3 ± 2.7 μg/ml in DPPH assay (Table 1). MeOH and water rude extrats showed large EC 5 values while petroleum ether extrat showed the weakest DPPH savenging ativity. Of the frations, EC 5 for DPPH savenging by F7 was the lowest at 3.5 ± 3.2 μg/ml (Table 2). EC 5 for F7 was only 1.5 times that of hlorogeni aid whih had an EC 5 of 2±2.8 μg/ml. Results from DPPH assay showed savenging ativity of the frations in desending order as F7 > F6 > F5 > F4 > F3 >F2 >F1. DPPH assay results orrelated well with TPC (r =.94, P <.1). Purifiation and onentration of polyphenoli ompounds must have ourred with inrease in polarity of extration solvents that were used during the frationation proedures as previously reported [25, 26]. FRAP assay determines the reduing power of test ompounds. The assay depends on redution of ferri tripyridyltriazine omplex (Fe (III)-TPTZ) to ferrous tripyridyltriazine (Fe (II)-TPTZ) by a redutant at low ph. FRAP value for EtOA extrat was the highest amongst the rude extrats at ± 28.9 μmol Fe (II)/mg dry weight extrat (Table 1). After frationation, FRAP values of F1 to F7 were in the range of ± 8.4 to ± 2.3 μmol Fe (II)/mg dry weight extrat (Table 2).umofFRAPvaluesofF1toF7was

6 6 BioMed Researh International Table 4: IC 5 values of P. minus extrats on different ell lines after 72 h of inubation. Crude extrat HepG2 WRL 68 HeLA HCT 116 MCF-7 Chang IC 5 (μg/ml) Pet. ether >25 a ± ± 3.2 b ± 3.3 d >25 a >25 a EtOA ± 3.72 b ± 2.84 b 63.9 ± ± 5.2 b >25 a ± 59.8 b MeOH >25 a >25 a 25 ± 4.3 d 86.3 ± 3.5 >25 a >25 a Water >25 a >25 a >25 a >25 a >25 a >25 a HepG2 ells (2 1 6 /well) were inubated with rude extrats of P. minus for 72 h at 37 C. Results are mean ±.D (n =3). Values with different alphabets in the same olumn are signifiantly different (P <.5, ANOVA and Bonferroni test) μmol Fe (II)/mg dry weight extrat. This was not muh different from FRAP value of rude EtOA extrat. Eah of frations 1 to 7 possibly ontributed to total antioxidant apaity shown by the rude EtOA extrat. Tripathi et al. showed that antioxidant ompounds in an extrat show synergisti effet in their investigations on effet of rude or total extrat and their frations in inflammation ino signaling asade [27]. FRAP values of P. minus frations were linearly orrelated to TPC (FRAP versus TPC, r =.83, P <.5). ine EtOA typially extrats polyphenoli ompounds [28], F7 most probably ontains polyphenols with high antioxidant apaity sine polyphenols at as eletron donors to stabilize free radials [29]. Plant extrats that ontained high onentrations of phenolis demonstrate high antioxidant effets in vitro [3]. Vitamin E, tootrienols, toopherols, and asorbi aid may also ontribute to antioxidant apaity as well as to the synergisti effet among the ompounds [31]. EtOA rude extrat by qualitative analysis showed presene of high amounts of flavonoids whih would atasredutantsintpcandfrapassaysandassavengers in DPPH assay. ine saponins do not ontribute to FRAP values [32], water extrat of P. minus whih showed high ontentofsaponinsinqualitativeassayhadlowfrapvalue when ompared to EtOA extrat Antiproliferative Ativity. Antiproliferative effets of P. minus rude extrats on seleted aner and normal ell lines were determined (Table 4). Of the 4 rude extrats, EtOA extrat had the lowest IC 5 of ± 3.72 μg/ml towards HepG2 with little ytotoxiity towards normal embryoni liver ells (WRL68) or normal Chang liver ells. IC 5 values of EtOA rude extrat towards these latter two normal liver ell lines were ± 2.84 and ± 59.8 μg/ml, respetively. Colon aner ells (HCT 116) and mammary aner ells (MCF-7) were not muh affeted by EtOA extrat although there were moderate effets against ervialanerellline(hela).meohextratofp. minus also showed moderate antiproliferative effets against HCT 116 although it was ineffetive against the other ell lines. Petroleum ether extrat was ytotoxi in WRL68 with IC 5 of 56.23±3.2 μg/ml but has no antiproliferative effets in aner ell lines. Crude water extrat had no antiproliferative effet on aner ell lines and no ytotoxiity in normal ell lines (IC 5 > 25 μg/ml in all ases). This finding of water extrat being nonytotoxi is important as it provides evidene that the herb is safe when added to ertain Malay foods during their preparation. Table 5: IC 5 values of different frations from EtOA extrat of P. minus on HepG2 ell line. Frations F1 F2 F3 F4 F5 F6 F7 IC 5 (μg/ml) ND ± 2.4 a ± 2.64 b ± 6.1 a ± 2.5 b 42.8 ± 3.22 a ± 1.5 HepG2 ells (2 1 6 /well) were inubated with P. minus frations for 72 h at 37 C. Results are mean ±.D. (n = 3). Values with different alphabets are signifiantly different (P <.5, ANOVA and Bonferroni test). ND: not determined. OurdatashowthatEtOArudeextrathasseletive antiproliferative effet on HepG2 with little ytotoxiity on normal liver ells. This is important as seletivity of extrat towards aner ells without effet on normal ells is ruial to ensure that nontarget ells are not affeted by treatment so as to gain optimal therapeuti effets with minimal adverse effets. imilar views are abundant in the literature [33, 34]. The bioative ompounds in EtOA rude extrat inhibited proliferation of HepG2 ells. This extrat was thus frationated for further biologial investigations on P. minus.frations of EtOA extrat displayed better antiproliferative ativity than the rude extrat (Table 5). F7 exhibited the smallest IC 5 of ± 1.5 μg/ml towards HepG2 ells ompared to the other frations. F7 also showed the highest antioxidant apaity in TPC, FRAP, and DPPH assays. Qualitative analysis of EtOA rude extrat from whih F7 was obtained showed it to be high in flavonoids, alkaloids, and saponins; these groups of ompounds most probably ontributed to antiproliferative effets of F7. In many reports, flavonoids wereshowntoseletivelykillanerellswhihfrequently have higher levels of RO than normal ells [35]. Consistently elevated levels of RO ativate an adaptive stress response whih enables aner ells to survive in high RO ambiene to maintain ellular viability [36]. Flavonoids are known as effetive savengers of RO and are able to modulate proteins that are involved in ell proliferation mainly through regulation of the ell yle [37]. In addition, flavonoids were able to indue apoptoti death in many aner ells and at as antiangiogeni agents [38]. As example, luteolin, a

7 BioMed Researh International 7 Early apoptosis (%) a b b e a a Time (hour) a Early apoptosis (%) a a a a a a b Untreated ontrol 12.5 μg/ml d Time (hour) 25 μg/ml 37.5 μg/ml b e Untreated ontrol 18 μg/ml 32 μg/ml 1 μg/ml Figure 2: Early apoptosis in HepG2 ells exposed to EtOA rude extrat of P. minus. HepG2 ells (1 1 6 /well) were inubated with EtOA rude extrat of P. minus (18 1 μg/ml) for different periods (24, 48, and 72 h) at 37 C. Apoptosis was deteted by flow ytometry using annexin-v and FITC. Results are mean ±.D. (n = 3). Values with different alphabets are signifiantly different (P <.5, ANOVA and Bonferroni test). ommon flavonoid in plants, was found to arrest the ell yle at G 1 phase in human gastri, prostate, and melanoma aner ells and was an apoptoti induer at both intrinsi and extrinsi pathways. Luteolin exhibited antiangiogenesis effet by suppressing vasular endothelial growth fator and matrix metalloproteases and was antimetastasis through inhibition of tumor nerosis fator and interleukin-6 whih regulateell migration andmetastasis [39]. Besides exhibiting similar mehanisms of ation as flavonoids, alkaloids and saponins may also ontribute to antiproliferative effets by induing ell aner autophagy and antimultidrug resistane and antimitotieffet [4]. Existing data on onomitant use of antioxidant ompounds and hemotherapy showed that antioxidant supplementation led to improvement in treatment outomes, inreased survival times, inreased tumor response, and redued toxiity [41]. However, some studies also showed no signifiant improvements in treatment outomesthatouldbeattributedtouseofinsuffiientantioxidant doses [42]. Chemotherapeuti drugs like doxorubiin and vinorelbine work via mehanisms that involve indution of apoptosis in aner ells through RO-mediated oxidative stress [43, 44].Forthesetypesofdrugs,onomitantsupplementation with antioxidants during aner hemotherapy may lead to diminished antianer effets. However, no trials have reported signifiant redutions in treatment effiay with antioxidant supplementation, suggesting no evidene of antioxidants interfering with hemotherapy [41, 45]. 4.5.ApoptosisIndutionbyEtOAExtratandF7ofP.minusin HepG2 Cells. Mode of ell death indued by F7 was examined via detetion of transloation of phosphatidylserine into Figure 3: Perentage of HepG2 ells in early apoptosis upon exposure to F7 of P. minus. HepG2 ells (1 1 6 /well) were inubated with F7 of P. minus ( μg/ml) for different periods (24, 48, and 72 h) at 37 C. Apoptosis was deteted by flow ytometry using annexin V-FITC. Results are mean ±.D (n = 3). Values with different alphabets are signifiantly different (P <.5,ANOVA and Bonferroni test). outer ell membrane. This is a hallmark event for early apoptosis whereby aner ells will emit the signal to surrounding marophages to initiate autophagy [46]. EtOA rude extrat eliited a signifiant inrease in perentage of HepG2 ells in early apoptosis (Figure 2). Lowest onentration of EtOA rude extrat (18 μg/ml) showed time-dependent inrease in perentage of ells undergoing early apoptosis. Exposure to 24 h produed about 2% inrease. After 48 h of exposure, maximal inrease to nearly 3% was seen, but after 72 h, perentage of ells in early apoptosis had dropped signifiantly to less than 2%. A higher onentration (32 μg/ml) of EtOA rude extrat inreased perentage of ells in early apoptosis by between 2 and 25% starting from 24 h of inubation; however no further inrease was seen at longer inubation times. Highest onentration of EtOA rude extrat (1 μg/ml) produed maximal inrease in perentage of ells in early apoptosis by 24 h. By 48 h, the perentage had dropped signifiantly to about 5%. A further signifiant derease in perentage of ells in early apoptosis was seen at 72 h. Treatment of HepG2 ells with F7 also produed similar effets (Figure3). A shorter inubation period of 24 h with F7 ( μg/ml) did not affet the ell population in early apoptosis. At 48 h, a onentrationdependent inrease in perentage of ells in early apoptosis was seen. Highest onentration of F7 (37.5 μg/ml) indued nearly 85% of ells to undergo apoptosis. This effet was inversely dependent on inubation time as perentage of ells undergoing early apoptosis dereased to approximately 5% after 72 h. With a longer period of inubation, HepG2 ells shifted from a situation of having maximum viability to enteringearlyapoptosisandthentolate-stageapoptosisand nerosis (Figure 4). Population of ells undergoing apoptosis uponexposuretof7atitsic 5,at72h,wassmallerthanat

8 8 BioMed Researh International Table 6: Gene name, base pair (b.p) size, and forward and reverse primer sequenes that were used in the real time PCR experiment. Gene name b.p Forward primer Reverse primer NM (Atb) 97 ATGGTGGGTATGGGTCAG CAATGCCGTGTTCAATGG NM (Bl2) 177 CCACCAAGAAAGCAGGAAACC GGCAGGATAGCAGCACAGG NM (Casp3) 159 CTGGACTGTGGCATTGAGAC ACAAAGCGACTGGATGAACC NM (p53) 113 AGAACGAGGAGACGGTAATAGTG CAATGACCTGACTGATGGAACC NM (Bax) 11 CAGATGTGGTCTATAATGC CTAATCAAGTCAAGGTCAC PI 1 2 PI PI PI Annexin V-FITC Control Annexin V-FITC 24 h Annexin V-FITC 48 h Annexin V-FITC 72 h (a) (b) () (d) Figure 4: Histogram of annexin-v and FITC/PI flow ytometry of HepG2 ells exposed to F7. HepG2 ells (1 1 6 /well) were inubated with F7 of P. minus (25 μg/ml, equivalent to IC 5 ) or (a) ontrol for (b) 24, () 48 and (d) 72 h at 37 C. Lower left quadrant in eah panel represents viable ells whih exluded PI and were negative for annexin V-FITC binding. Upper right quadrant ontains nonviable, neroti ells or late stage apoptoti ells, positive for annexin V-FITC/PI uptake. Lower right quadrant ontains early apoptoti ells, annexin V-FITC positive and PI negative. One experiment is representative of three independent experiments. 48 h. Conversely, late apoptoti/neroti ell population was higher at 72 h than at 48 h. These results show that at 72 h, F7 had indued neroti ell death rather than apoptoti ell death. A range of stimuli suh as radiation, hypoxia, heat, and ytotoxi ompounds indue apoptosis at low onentrations but higher onentrations of these stimuli an result in nerosis [47]. Three types of ellular response to plant extrats have been proposed [48]. Mild exposure may ause mild oxidative stress that ignites ellular antioxidant defense systems; exposure to moderate to higher onentrations may gradually overwhelm antioxidant defense systems to indue apoptosis,whileexposuretoevenhigheronentrationsfor long periods may quikly overwhelm antioxidant defenses to stimulate prooxidative effets leading to ellular damage via nerosis. Two fators that transform an ongoing apoptoti proess to a neroti proess are the availability of intraellular ATP and of aspases [49]. Extended exposure of ells to plant extrat may ause loss of mitohondrial membrane potential and may promote release of ytohrome leading to distortion of eletron transport and inhibition of Krebs yle [5].ThiswillfinallyausedepletioninATP and rapid generation of RO whih an both ause ell death without involvement of aspases [51]. Proapoptoti ativity of apoptosome is dependent on availability of ATP; thus redution of energy would ause a greater proportion of ells to undergo nerosis rather than apoptosis [52]. DNA fragmentation during apoptosis of HepG2 ells that were treated with F7 ( μg/ml) for 48 h was visualized via TUNEL assay using fluoresent onfoal mirosopy (Figure 5).Cellsthatwerestainedredwereviablewhile bright green stains indiated apoptoti ell bodies with DNA fragmentation Expression of Genes Related to Apoptosis. Moleular mehanism of apoptosis was investigated using RT-PCR by examining expression of key apoptoti-related genes. Primer sequenes of the genes are shown in Table 6. Bl-2 gene is an antiapoptoti gene; overexpression of this gene would prevent apoptosis while Bax gene is a proapoptoti gene working oppositely. P53 and aspase-3 genes are vital in exeuting the apoptosis proess in ells. Expression of Bax, Bl-2, p53, andaspase-3 genes in HepG2 ells that were treated with F7 ( μg/ml) for 48 h is shown in Figure 6. F7 indued a onentration-dependent inrease in Bax expression. Compared to ontrol untreated ell, mrna expression of Bax was signifiantly elevated by about 3-fold at highest onentration of F7 (37.5 μg/ml). The two lower onentrations of F7 produed about fold inrease in Bax expression. imilar onentration-dependent inrease in expression levels of aspase-3 and p53 genes was seen in F7-treated ells. Lowest onentration of F7 signifiantly inreased aspase-3 expression from ontrol. A signifiantly greaterinreasein aspase-3 expression by about 1.8-fold was eliited by the highest onentration of F7 used. Expression of p53 gene was signifiantly inreased from ontrol by lowest onentration of F7. Maximal inrease in p53 gene expression by about 2-fold was eliited by middle onentration of F7 (25 μg/ml) as no further inrease was seen at 37.5 μg/ml. In ontrast, expression of antiapoptoti gene, Bl-2, was inhibited in onentration-dependent manner by F7. Highest

9 BioMed Researh International 9 Untreated ontrol (a) 12.5 μg/ml (b) 25 μg/ml () 37.5 μg/ml (d) Figure 5: Fluoresene onfoal imaging of TUNEL positive staining in HepG2 ells exposed to F7 at 48 h. HepG2 ells ( /well) were treated with F7 of P. minus ( μg/ml) for 48 h at 37 C. Red stain shows viable, healthy ells while intense green stain indiates apoptoti ell with DNA fragmentation. One experiment is representative of three independent experiments. mrna expression level (fold) b a f f f d d d g g Control Conentration of F7 (μg/ml) h Bax Caspase-3 P53 Bl-2 Figure 6: Effet of F7 on expression levels of apoptoti-related genes in HepG2 ells. HepG2 ells (1 1 6 /well) were inubated with F7 of P. minus ( μg/ml) for 48 h at 37 C. Results are mean ±.D (n =3). Values with different alphabets are signifiantly different (P <.5, ANOVA and Bonferroni test).

10 1 BioMed Researh International 4 32 Untreated ontrol 24 h h: 12.5 μg/ml h: 25 μg/ml h: 37.5 μg/ml Number DNA ontent DNA ontent DNA ontent DNA ontent ubg 1 G /G % ± 2.56% 52.28% ±.88% 3.4% ±.92% 17.67% ±.87% ubg 1 G /G % ± 2.74% 65.11% ± 2.13% 24.8% ± 3.35% 1.8% ± 1.25% ubg 1 G /G % ±.92% 5.48% ± 1.94% 38.77% ± 1.48% 1.77% ± 1.62% ubg 1 G /G % ± 2.55% 35.9% ± 1.69% 38.87% ±.82% 25.23% ± 1.8% (a) Number Untreated ontrol 48 h h: 12.5 μg/ml h: 25 μg/ml h: 37.5 μg/ml DNA ontent DNA ontent DNA ontent DNA ontent ubg 1 G /G 1 3.6% ± 1.4% 61.82% ± 1.85% 22.92% ±.89% 15.27% ±.97% ubg 1 G /G 1 1.1% ± 1.7% 62.44% ± 1.2% 15.16% ± 2.7% 22.41% ± 1.1% ubg 1 G /G % ± 2.36% 38.58% ± 1.1% 34.47% ± 1.2% 26.94% ±.64% ubg 1 G /G % ± 1.2% 3.37% ±.28% 52.59% ±.33% 17.3% ±.49% (b) Figure 7: Effet of F7 of P. minus on ell yle progression in HepG2 ells. Cells (1 1 6 /well) were treated with F7 ( μg/ml) for (top lane)24hor(bottomlane)48hat37 C. Data are representative of three independent experiments. ignifiantly different from untreated ontrol ells (P <.5, ANOVA and Bonferroni test). onentration of F7 eliited maximal inhibition in Bl-2 expression. Ratio of Bax/Bl-2 is ruial at determining suseptibility of ells to death signals [53]. Our results showed F7 indued apoptosis via upregulation of Bax, p53, and aspase-3 genes and downregulation of Bl-2 gene. Ativation of p53 stimulates release of ytohrome- from mitohondria [54]. Consequently, apoptosome omplex is formed to further initiate effetor aspases, inluding aspase- 3, to exeute the apoptosis proess. Release of mitohondria apoptogeni fators is ontrolled by Bax and Bl-2 genes whih either indued or suppress permeabilization of outer mitohondrial membrane [55]. imilar observations were reported in determination of antiproliferative effet of Juglan regia L. by assessment of apoptoti related genes [56] Cell Cyle Arrest by F7. Treatment of HepG2 ells with F7 (12.5, 25, and 37.5 μg/ml) for 24 and 48 h resulted in signifiant aumulation of ells at -phase as ompared to ontrol untreated ells (Figure 7). The effet was onentrationand time-dependent. After 24 h of inubation with 25 or 37.5 μg/ml F7, ell population at -phase was inreased ompared to ontrol while ell population was inreased by the highest onentration of F7. This showed that F7 delayed ell progression through -phase, earlier than phase, thus restriting ells from entering G /G 1 phase. ub-g 1 ell population after treatment with F7 at 24 h was not altered. Following 48 h of inubation, highest onentration of F7 inreased ub-g 1 and -phase populations to approximately ± 1.2% and52.59 ±.33%, respetively, while phase was dereased to 17.3 ±.49%. ub-g 1 phase is a hallmark of apoptosis [57]; therefore these findings are onsistent with flow ytometry measurements of apoptosis in HepG2 ells treated with F7. p53 also plays an important role in exeuting ell yle arrest [58]. During -phase, ellular DNA is repliated preisely and aurately to prevent geneti abnormalitieswhihouldleadtomutationsorelldeath[59] and p53 is responsible for regulation of ertain proteins whih are related to ell yle hekpoint. 5. Conlusion In summary, P. minus as ethyl aetate rude extrat or its fration, F7, showed high antioxidant apaity and seletive antiproliferative ativity against HepG2 ells. The high

11 BioMed Researh International 11 antioxidant apaity of this herb is probably attributed to its polyphenoli ontent. Antiproliferative effet of F7 was diretly orrelated to its antioxidant apaity. Flow ytometry analyses and gene expression studies in F7-exposed HepG2 ells provided evidene that F7 indued apoptosis in timeand onentration-dependent manner through upregulation of proapoptoti genes and downregulation of antiapoptoti gene. F7 was antiproliferative towards HepG2 ells via inhibition of the ell yle at -phase. Continuing work to identify the ompounds in F7 that are responsible for these ativities is in progress in our laboratory. We are also looking at effets of F7 on a aner model in vivo. Conflit of Interests The authors delare that there is no onflit of interests. Aknowledgments This work was supported by MOTI 1-IRDC/BIOTEK 16/6/2(6/26) through a researh Grant held by Universiti Teknologi MARA. Mohd Alfazari Mohd Ghazali is supported by a fellowship from UM. The authors wish to thank Faulty of Pharmay, UiTM, for support and failities. Referenes [1] J. M. Brown and L. D. Attardi, The role of apoptosis in aner development and treatment response, Nature Reviews Caner, vol. 5, no. 3, pp , 25. [2] V. Jendrossek, The intrinsi apoptosis pathways as a target in antianer therapy, Current Pharmaeutial Biotehnology, vol. 13, no. 8, pp , 212. [3] G. Waris and H. Ahsan, Reative oxygen speies: role in the development of aner and various hroni onditions, Journal of Carinogenesis,vol.5,artile14,26. [4] U. Gawlik-Dziki, M. wiea, M. ulkowski, D. Dziki, B. Baraniak, and J. Czyz, Antioxidant and antianer ativities of Chenopodium quinoa leaves extrats in vitro study, Food and Chemial Toxiology,vol.57,pp ,213. [5] M.Maizura,A.Aminah,andW.M.W.Aida, Totalphenoli ontent and antioxidant ativity of kesum (Polygonum minus), ginger (Zingiber offiinale) and turmeri (Curuma longa) extrat, International Food Researh Journal, vol. 18, no. 2, p. 529, 211. [6] A. A. Azlim Almey, C. Ahmed Jalal Khan, I. yed Zahir, K. Mustapha uleiman, M. R. Aisyah, and K. Kamarul Rahim, Total phenoli ontent and primary antioxidant ativity of methanoli and ethanoli extrats of aromati plants leaves, International Food Researh Journal,vol.17,no.4,pp , 21. [7] Y. umazian, A. yahida, M. Hakiman, and M. Maziah, Antioxidant ativities, flavonoids, asorbi aid and phenoli ontents of Malaysian vegetables, Journal of Mediinal Plant Researh, vol.4,no.1,pp ,21. [8] N.Huda-Faujan,A.Noriham,A..Norrakiah,andA..Babji, Antioxidant ativity of plants methanoli extrats ontaining phenoli ompounds, Afrian Journal of Biotehnology, vol. 8, no. 3, pp , 29. [9] N.Huda-Faujan,A.Noriham,A..Norrakiah,andA..Babji, Antioxidative ativities of water extrats of some Malaysian herbs, AEAN Food Journal, vol. 14, no. 1, pp , 27. [1]. W. Qader, M. A. Abdulla, L.. Chua, H. M. irat, and. Hamdan, Pharmaologial mehanisms underlying gastroprotetive ativities of the frations obtained from Polygonum minus in sprague dawley rats, International Journal of Moleular ienes,vol.13,no.2,pp ,212. [11]. Q. Wasman, A. A. Mahmood, H. alehhuddin, A. A. Zahra, and I. almah, Cytoprotetive ativities of Polygonum minus aqueous leaf extrat on ethanol-indued gastri uler in rats, Journal of Mediinal Plant Researh, vol.4,no.24,pp , 21. [12] M. M. Makeen, A. M. Ali,. H. El-harkawy et al., Antimirobial and ytotoxi properties of some Malaysian traditional vegetables (ULAM), Pharmaeutial Biology,vol.35,no.3,pp , [13]. W. Qader, M. A. Abdulla, L.. Chua, N. Najim, M. M. Zain, and. Hamdan, Antioxidant, total phenoli ontent and ytotoxiity evaluation of seleted Malaysian plants, Moleules, vol. 16, no. 4, pp , 211. [14]Y.K.Ming,N.B.T.Zulkawi,C.VandanaKotak,andY.K. Choudhary, Aute and sub-aute oral toxiity of Polygonum minus aqueous extrat (biotropis PM11) in wistar rats, International Journal of Pharmay and Pharmaeutial ienes, vol. 5, no. 2, pp , 213. [15] Z.A.Zakaria,A.M.Mohamed,N..M.Jamiletal., In vitro ytotoxi and antioxidant properties of the aqueous, hloroform and methanol extrats of diranopteris linearis leaves, Afrian Journal of Biotehnology,vol.1,no.2,pp ,211. [16] M. H. Johnson and E. Gonzalez de Mejia, Comparison of hemial omposition and antioxidant apaity of ommerially available blueberry and blakberry wines in Illinois, Journal of Food iene,vol.77,no.1,pp.c141 C148,212. [17]. Gorinstein, O. Martin-Belloso, E. Katrih et al., Comparison of the ontents of the main biohemial ompounds and the antioxidant ativity of some panish olive oils as determined by four different radial savenging tests, Journal of Nutritional Biohemistry,vol.14,no.3,pp ,23. [18] O. Erel, A novel automated diret measurement method for total antioxidant apaity using a new generation, more stable ABT radial ation, Clinial Biohemistry, vol.37,no.4,pp , 24. [19] M. Carvalho, G. Hawksworth, N. Milhazes et al., Role of metabolites in MDMA (estasy)-indued nephrotoxiity: an in vitro study using rat and human renal proximal tubular ells, Arhives of Toxiology, vol. 76, no. 1, pp , 22. [2] N. Armania, L.. Yazan,. N. Musa et al., Dillenia suffrutiosa exhibited antioxidant and ytotoxi ativity through indution of apoptosis and G2/M ell yle arrest, Journal of Ethnopharmaology,vol.146,no.2,pp ,213. [21] J.Nestorov,G.Mati,I.Elakovi,andN.Tani, Geneexpression studies: How to obtain aurate and reliable data by quantitative real-time RT PCR, Journal of Medial Biohemistry,vol. 32,no.4,pp ,213. [22] K.. im, A. M. ri Nurestri, and A. W. Norhanom, Phenoli ontent and antioxidant ativity of Pereskia grandifolia Haw. (Cataeae) extrats, Pharmaognosy Magazine, vol. 6, no. 23, pp , 21. [23] F. Al-Juhaimi, C. aglam, and M. M. Ozan, Antioxidant properties and total phenoli ontent of two solvent extration

12 12 BioMed Researh International extrats of some plants belong to labiatae family, Asian Journal of Chemistry,vol.25,no.6,pp ,213. [24] W. Kusirisin,. rihairatanakool, P. Lerttrakarnnon et al., Antioxidative ativity, polyphenoli ontent and anti-glyation effet of some Thai mediinal plants traditionally used in diabeti patients, Mediinal Chemistry,vol.5,no.2,pp , 29. [25]. annigrahi, U. K. Mazuder, D. K. Pal,. Parida, and. Jain, Antioxidant potential of rude extrat and different frations of Enhydra flutuans Lour, Iranian Journal of Pharmaeutial Researh,vol.9,no.1,pp.75 82,21. [26] N. Gruji, Z. Lepojevi, B. rdjenovi, J. Vladi, and J. udji, Effets of different extration methods and onditions on the phenoli omposition of mate tea extrats, Moleules, vol. 17, no. 3, pp , 212. [27] Y.B.Tripathi,A.P.Chaturvedi,andN.Pandey, EffetofNigella sativa seeds extrats on ino through antioxidant potential only: rude/total extrat as moleular therapy drug, Indian Journal of Experimental Biology, vol. 5, no. 6, pp , 212. [28] C.-Y. Liu, Y.-C. Lin, J.-. Deng, J.-C. Liao, W.-H. Peng, and G.- J. Huang, Antioxidant, anti-inflammatory, and antiproliferative ativities of Taxillus suthuenensis, Amerian Journal of Chinese Mediine,vol.4,no.2,pp ,212. [29] K.N.Prasad,L.Y.Chew,H.E.Khoo,K.W.Kong,A.Azlan, and A. Ismail, Antioxidant apaities of peel, pulp, and seed frations of Canarium odontophyllum Miq. fruit, Journal of Biomediine and Biotehnology, vol.21,artileid871379,8 pages, 21. [3].hukla,A.Mehta,P.Mehta,andV.K.Bajpai, Antioxidant ability and total phenoli ontent of aqueous leaf extrat of tevia rebaudiana Bert, Experimental and Toxiologi Pathology, vol. 64, no. 7-8, pp , 212. [31]N.Babbar,H..Oberoi,D..Uppal,andR.T.Patil, Total phenoli ontent and antioxidant apaity of extrats obtained from six important fruit residues, Food Researh International, vol. 44, no. 1, pp , 211. [32] B. B. Misra and. Dey, Comparative phytohemial analysis and antibaterial effiay of in vitro and in vivo extrats from East Indian sandalwood tree (antalum album L.), Letters in Applied Mirobiology,vol.55,no.6,pp ,212. [33] R. Hafidh, A. Abdulamir, F. Bakar, F. Jalilian, F. Abas, and Z. ekawi, Novel moleular, ytotoxial, and immunologial study on promising and seletive antianer ativity of Mung bean sprouts, BMC Complementary and Alternative Mediine, vol. 12, artile 28, 212. [34] M. Paydar, Y. L. Wong, B. A. Moharam, W. F. Wong, and C. Y. Looi, In vitro anti-oxidant and anti-aner ativity of methanoli extrat from anhezia speiosa leaves, Pakistan Journal of Biologial ienes, vol. 16, no. 2, pp , 213. [35] T. P. zatrowski and C. F. Nathan, Prodution of large amounts of hydrogen peroxide by human tumor ells, Caner Researh, vol. 51, no. 3, pp , [36] L. Gibellini, M. Pinti, M. Nasi et al., Interfering with RO metabolism in aner ells: the potential role of queretin, Caners, vol. 2, no. 2, pp , 21. [37] K.Bishayee,.Ghosh,A.Mukherjee,R.adhukhan,J.Mondal, and A. R. Khuda-Bukhsh, Queretin indues ytohrome- release and RO aumulation to promote apoptosis and arrest the ell yle in G2/M, in ervial arinoma: signal asade and drug-dna interation, Cell Proliferation,vol.46,no.2,pp , 213. [38] H. Luo, G. O. Rankin, L. Liu, M. K. Daddysman, B.-H. Jiang, and Y. C. Chen, Kaempferol inhibits angiogenesis and VEGF expression through both HIF dependent and independent pathways in human ovarian aner ells, Nutrition and Caner, vol. 61, no. 4, pp , 29. [39] Y. Lin, R. hi, X. Wang, and H.-M. hen, Luteolin, a flavonoid with potential for aner prevention and therapy, Current Caner Drug Targets,vol.8,no.7,pp ,28. [4] C. V. Rao, C. D. Kurkjian, and H. Y. Yamada, Mitosis-targeting natural produts for aner prevention and therapy, Current Drug Targets,vol.13,no.14,pp ,212. [41] C. B. imone II, N. L. imone, V. imone, and C. B. imone, Antioxidants and other nutrients do not interfere with hemotherapy or radiation therapy and an inrease kill and inrease survival, part 1, Alternative Therapies in Health and Mediine,vol.13,no.1,pp.22 28,27. [42] A. K. Pathak, M. Bhutani, R. Guleria et al., Chemotherapy alone vs. hemotherapy plus high dose multiple antioxidants in patients with advaned non small ell lung aner, Journal of the Amerian College of Nutrition,vol.24,no.1,pp.16 21,25. [43] W.-H. Chiu,.-J. Luo, C.-L. Chen et al., Vina alkaloids ause aberrant RO-mediated JNK ativation, Ml-1 downregulation, DNA damage, mitohondrial dysfuntion, and apoptosis in lung adenoarinoma ells, Biohemial Pharmaology,vol.83, no. 9, pp , 212. [44] A.Rogalska,A.Gajek,M.zwed,Z.Jóźwiak, and A. Marzak, The role of reative oxygen speies in WP 631-indued death of human ovarian aner ells: a omparison with the effet of doxorubiin, Toxiology in Vitro, vol. 25, no. 8, pp , 211. [45] K. I. Blok, A. C. Koh, M. N. Mead, P. K. Tothy, R. A. Newman, and C. Gyllenhaal, Impat of antioxidant supplementation on hemotherapeuti effiay: a systemati review of the evidene from randomized ontrolled trials, Caner Treatment Reviews, vol.33,no.5,pp ,27. [46] K. Balasubramanian, B. Mirnikjoo, and A. J. hroit, Regulated externalization of phosphatidylserine at the ell surfae: impliations for apoptosis, TheJournalofBiologialChemistry, vol. 282, no. 25, pp , 27. [47]. Elmore, Apoptosis: a review of programmed ell death, Toxiologi Pathology,vol.35,no.4,pp ,27. [48] H. Babih, A. G. huk, J. H. Weisburg, and H. L. Zukerbraun, Researh strategies in the study of the pro-oxidant nature of polyphenol nutraeutials, Journal of Toxiology, vol. 211, Artile ID 46735, 12 pages, 211. [49] M. Leist, B. ingle, A. F. Castoldi,. Kühnle, and P. Niotera, Intraellular adenosine triphosphate (ATP) onentration: a swith in the deision between apoptosis and nerosis, The Journal of Experimental Mediine,vol.185,no.8,pp , [5] J.-L. Vayssière, P. X. Petit, Y. Risler, and B. Mignotte, Commitment to apoptosis is assoiated with hanges in mitohondrial biogenesis and ativity in ell lines onditionally immortalized with simian virus 4, Proeedings of the National Aademy of ienes of the United tates of Ameria,vol.91,no.24,pp , [51] C. J. Zeiss, The apoptosis-nerosis ontinuum: insights from genetially altered mie, Veterinary Pathology,vol.4,no.5,pp , 23. [52] Y. Eguhi, A. rinivasan, K. J. Tomaselli,. himizu, and Y. Tsujimoto, ATP-dependent steps in apoptoti signal transdution, Caner Researh,vol.59,no.9,pp ,1999.

13 BioMed Researh International 13 [53] I. Marzo and J. Naval, Bl-2 family members as moleular targets in aner therapy, Biohemial Pharmaology, vol. 76, no. 8, pp , 28. [54] V. Gogvadze,. Orrenius, and B. Zhivotovsky, Multiple pathways of ytohrome release from mitohondria in apoptosis, Biohimia et Biophysia Ata Bioenergetis,vol.1757,no.5-6, pp , 26. [55] M. huler and D. R. Green, Mehanisms of p53-dependent apoptosis, Biohemial oiety Transations, vol. 29, no. 6, pp , 21. [56]A.A.Alshatwi,T.N.Hasan,G.hafietal., Validationof the antiproliferative effets of organi extrats from the green husk of Juglans regia L. on PC-3 human prostate aner ells by assessment of apoptosis-related genes, Evidene-Based Complementary and Alternative Mediine, vol.212,artileid 1326, 8 pages, 212. [57]W.K.Ng,L..Yazan,andM.Ismail, Thymoquinonefrom Nigella sativa was more potent than isplatin in eliminating of iha ells via apoptosis with down-regulation of Bl-2 protein, Toxiology in Vitro,vol.25,no.7,pp ,211. [58] L.Ding,Y.Huang,Q.Duetal., TGEVnuleoapsidprotein indues ell yle arrest and apoptosis through ativation of p53 signaling, Biohemial and Biophysial Researh Communiations,vol.445,no.2,pp ,214. [59] D.Y.TakedaandA.Dutta, DNArepliationandprogression through phase, Onogene,vol.24,no.17,pp ,25.

14 Journal of Tropial Mediine The ientifi World Journal ientifia Autoimmune Diseases International Journal of Antibiotis Journal of Anesthesiology Researh and Pratie Toxins ubmit your manusripts at Advanes in Pharmaologial ienes Journal of Toxiology MEDIATOR of INFLAMMATION Emergeny Mediine International Pain Researh and Treatment troke Researh and Treatment Journal of Addition Journal of Vaines BioMed Researh International Journal of Journal of International Journal of Pharmaeutis Drug Delivery Mediinal Chemistry

Retraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury

Retraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury Hindawi BioMed Researh International Volume 217, Artile ID 8234878, 1 page https://doi.org/1.1155/217/8234878 Retration Retrated: Study of Effet of Salvianoli Aid B on Motor Funtion Reovery in Rats with

More information

Study of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice

Study of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,

More information

EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT. Abstract

EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT. Abstract Bang. J. Anim. Si. 2009, 38(1&2) : 86 91 ISSN 0003-3588 EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT S. Bin. Faisal, S. Akhter 1 and M. M. Hossain Abstrat The study

More information

describing DNA reassociation* (renaturation/nucleation inhibition/single strand ends)

describing DNA reassociation* (renaturation/nucleation inhibition/single strand ends) Pro. Nat. Aad. Si. USA Vol. 73, No. 2, pp. 415-419, February 1976 Biohemistry Studies on nulei aid reassoiation kinetis: Empirial equations desribing DNA reassoiation* (renaturation/nuleation inhibition/single

More information

Unit 02 - The Inside Story about Nutrition and Health. True / False

Unit 02 - The Inside Story about Nutrition and Health. True / False True / False 1. Geneti traits exert the strongest overall influene on health and longevity. False 2. The bodies of modern humans adapted to exist on a diet of wild game, fish, fruits, nuts, seeds, roots,

More information

JFS M: Food Microbiology and Safety. M: Food Microbiology & Safety

JFS M: Food Microbiology and Safety. M: Food Microbiology & Safety JFS and Safety Antioxidant Capaity, Phenoli Content, and Polysaharide Content of Lentinus edodes Grown in Whey Permeate-Based Submerged Culture X.J. WU ANDC. HANSEN ABSTRACT: Total antioxidant apaity (TAC),

More information

Comparative in Vitro Cytotoxicity Study of Silver Nanoparticle on Two Mammalian Cell Lines

Comparative in Vitro Cytotoxicity Study of Silver Nanoparticle on Two Mammalian Cell Lines Dublin Institute of Tehnology ARROW@DIT Artiles Shool of Physis 28 Comparative in Vitro Cytotoxiity Study of Silver Nanopartile on Two Mammalian Cell Lines Gordon Chambers Dublin Institute of Tehnology,

More information

Evaluation of a prototype for a reference platelet

Evaluation of a prototype for a reference platelet 932 Royal Postgraduate Medial Shool, Duane Road, London W12 ONN S M Lewis Western Infirmary, Glasgow R M Rowan Toa Medial Eletronis, Kobe, Japan F Kubota Correspondene to: Dr S M Lewis Aepted for publiation

More information

Effect of Curing Conditions on Hydration Reaction and Compressive Strength Development of Fly Ash-Cement Pastes

Effect of Curing Conditions on Hydration Reaction and Compressive Strength Development of Fly Ash-Cement Pastes Effet of Curing Conditions on Hydration Reation and Development of Fly Ash-Cement Pastes Warangkana Saengsoy Candidate for the degree of Dotor of Philosophy Supervisor: Prof. Dr. Toyoharu Nawa Division

More information

Systematic Review of Trends in Fish Tissue Mercury Concentrations

Systematic Review of Trends in Fish Tissue Mercury Concentrations Systemati Review of Trends in Fish Tissue Merury Conentrations Tom Grieb 1, Roxanne Karimi 2, Niholas Fisher 2, Leonard Levin 3 (1) Tetra Teh, In., Lafayette, CA, USA; (2) State University of New York,

More information

Urbanization and childhood leukaemia in Taiwan

Urbanization and childhood leukaemia in Taiwan C International Epidemlologial Assoiation 1998 Printed in Great Britain International Journal of Epidemiology 199827:587-591 Urbanization and hildhood leukaemia in Taiwan Chung-Yi Li, a Ruey S Iin b and

More information

Research Article Bioactive Flavonoids, Antioxidant Behaviour, and Cytoprotective Effects of Dried Grapefruit Peels (Citrus paradisi Macf.

Research Article Bioactive Flavonoids, Antioxidant Behaviour, and Cytoprotective Effects of Dried Grapefruit Peels (Citrus paradisi Macf. Oxidative Mediine and Cellular Longevity Volume 216, Artile ID 8915729, 12 pages http://dx.doi.org/1.1155/216/8915729 Researh Artile Bioative Flavonoids, Antioxidant Behaviour, and Cytoprotetive Effets

More information

Reversal of ammonia coma in rats by L-dopa: a peripheral effect

Reversal of ammonia coma in rats by L-dopa: a peripheral effect Gut, 1979, 2, 28-32 Reversal of ammonia oma in rats by L-dopa: a peripheral effet L. ZV1, W. M. DOZAK, AND R. F. DRR From the Department of Mediine, Hennepin ounty Medial enter and Minneapolis Veterans

More information

polymorphonuclear neutrophil release of granular

polymorphonuclear neutrophil release of granular Br. J. Pharma. (1985), 86, 533-537 Phorbol myristate aetate enhanes human polymorphonulear neutrophil release of granular enzymes but inhibits hemokinesis J.R.S. Hoult & Sussan Nourshargh Department of

More information

phosphatidylcholine by high performance liquid chromatography: a partial resolution of molecular species

phosphatidylcholine by high performance liquid chromatography: a partial resolution of molecular species A large-sale purifiation of phosphatidylethanolamine, lysophosphatidylethanolamine, and phosphatidylholine by high performane liquid hromatography: a partial resolution of moleular speies R. S. Fager,

More information

Effect of embelin on lithium-induced nephrogenic diabetes insipidus in albino rats

Effect of embelin on lithium-induced nephrogenic diabetes insipidus in albino rats Asian Paifi Journal of Tropial Disease (23)S729-S733 S729 Contents lists available at SieneDiret Asian Paifi Journal of Tropial Disease journal homepage:www.elsevier.om/loate/apjtd Doument heading Effet

More information

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1

A novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1 A novel approah to regulate ell membrane permeability for ATP and NADH formations in Saharomyes erevisiae indued by air old plasma 1 Xiaoyu DONG ( 董晓宇 ), Tingting LIU ( 刘婷婷 ), Yuqin XIONG ( 熊玉琴 ) Shool

More information

EXCRETION RATE ON PLASMA NICOTINE DURING

EXCRETION RATE ON PLASMA NICOTINE DURING Br. J. lin. Pharma. (1978), 5, 293-297 EFFECT OF URINARYpH AND NICOTINE EXCRETION RATE ON PLASMA NICOTINE DURING CIGARETTE SMOKING AND CHEWING NICOTINE GUM C. FEYERABEND & 1M.A.H. RUSSELL Poisons Unit,

More information

Correspondence should be addressed to Ali Mobasheri,

Correspondence should be addressed to Ali Mobasheri, Evidene-Based Complementary and Alternative ediine Volume 2012, Artile ID 509383, 16 pages doi:10.1155/2012/509383 Researh Artile Botanial Extrats from Rosehip (Rosaanina), Willow Bark (Salix alba), and

More information

Antioxidant and Nitrite-Scavenging Capacities of Phenolic Compounds from Sugarcane (Saccharum officinarum L.) Tops

Antioxidant and Nitrite-Scavenging Capacities of Phenolic Compounds from Sugarcane (Saccharum officinarum L.) Tops Moleules 2014, 19, 13147-13160; doi:10.3390/moleules190913147 OPEN ACCESS moleules ISSN 1420-3049 www.mdpi.om/journal/moleules Artile Antioxidant and Nitrite-Savenging Capaities of Phenoli Compounds from

More information

Measurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1

Measurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1 Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,

More information

Identification of an adipose tissue-like lipoprotein lipase in perfusates of chicken liver

Identification of an adipose tissue-like lipoprotein lipase in perfusates of chicken liver Identifiation of an adipose tissue-like lipoprotein lipase in perfusates of hiken liver Andre Bensadoun and Tung Liu Koh Division of Nutritional Sienes and Division of Biologial Sienes, Cornel1 University,

More information

The burden of smoking-related ill health in the United Kingdom

The burden of smoking-related ill health in the United Kingdom The burden of smoking-related ill health in the United Kingdom S Allender, R Balakrishnan, P Sarborough, P Webster, M Rayner Researh paper Department of Publi Health, University of Oxford, Oxford, UK Correspondene

More information

Molecular basis for the immunosuppressive action of

Molecular basis for the immunosuppressive action of Immunology 199 7 379-384 Moleular basis for the immunosuppressive ation of steari aid on T ells P. W. TEBBEY & T. M. BUTTKE Department of Mirobiology and Immunology, East Carolina University Shool of Mediine,

More information

The comparison of psychological evaluation between military aircraft noise and civil aircraft noise

The comparison of psychological evaluation between military aircraft noise and civil aircraft noise The omparison of psyhologial evaluation between military airraft noise and ivil airraft noise Makoto MORINAGA ; Ippei YAMAMOTO ; Hidebumi TSUKIOKA ; Koihi MAKINO 2, Sonoko KUWANO 3, Mitsuo MATSUMOTO 4

More information

a-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury

a-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury British Journal of Pharmaology (27) 152, 915 929 & 27 Nature Publishing Group All rights reserved 7 1188/7 $3. www.brjpharmaol.org RESEARCH PAPER a-4/b-1 and a-l/b-2 integrins mediate ytokine indued lung

More information

Interrelationships of Chloride, Bicarbonate, Sodium, and Hydrogen Transport in the Human Ileum

Interrelationships of Chloride, Bicarbonate, Sodium, and Hydrogen Transport in the Human Ileum Interrelationships of Chloride, Biarbonate, Sodium, and Hydrogen Transport in the Human Ileum LEsLE A. TURNBERG, FREDERICK A. BIEBERDORF, STEPHEN G. MORAWSKI, and JOHN S. FORDTRAN From the Department of

More information

Centratherum anthelminticum seeds reverse the carbon tetrachloride-induced hepatotoxicity in rats

Centratherum anthelminticum seeds reverse the carbon tetrachloride-induced hepatotoxicity in rats Vol. 10(26), pp. 533-539, 15 July, 2016 DOI: 10.5897/AJPP2016.4569 Artile Number: B5B4A9959524 ISSN 1996-0816 Copyright 2016 Author(s) retain the opyright of this artile http://www.aademijournals.org/ajpp

More information

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype

Chemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu

More information

Chapter III. Efficacy of promising agents/combinations in preventing vaginal/cervical inflammation caused by infection with T. vaginalis Introduction

Chapter III. Efficacy of promising agents/combinations in preventing vaginal/cervical inflammation caused by infection with T. vaginalis Introduction Chapter III Effiay of promising agents/ombinatio in preventing vaginal/ervial inflammation aused by infetion with T. vaginalis Introdution A ontraeptive mirobiide is supposed to be in ontat with the erviovaginal

More information

Effect of Dietary Astaxanthin and Background Color on Pigmentation and Growth of Red Cher r y Shr imp, Neocaridina heteropoda

Effect of Dietary Astaxanthin and Background Color on Pigmentation and Growth of Red Cher r y Shr imp, Neocaridina heteropoda KASETSART UNIVERSITY FISHERIES RESEARCH BULLETIN 04, VOLUME 38 () Effet of Dietary and Color on Pigmentation and Growth of Red Cher r y Shr imp, Neoaridina heteropoda Nongnuh Laohavisuti * and Usharee

More information

clinical conditions using a tape recorder system

clinical conditions using a tape recorder system Thorax (1964), 19, 125 Objetive assessment of ough suppressants under linial onditions using a tape reorder system C. R. WOOLF AND A. ROSENBERG From the Respiratory Unit, Sunnybrook Hospital (Department

More information

between normal children and children with primary

between normal children and children with primary Arhives of Disease in Childhood, 1989, 64, 224-228 odium transport in erythroytes: differenes between normal hildren and hildren with primary and seondary hypertension M UCHIYAMA, V HAH, C E DAMAN WILLEM,

More information

Role of the actin cytoskeleton on epithelial Na

Role of the actin cytoskeleton on epithelial Na Kidney International, Vol. 48 (1995), pp. 970 984 Role of the atin ytoskeleton on epithelial Na hannel regulation Hoiio F. ANTIELLO Renal Unit, Massahusetts General Hospital and Department of Mediine,

More information

Learned spatiotemporal sequence recognition and prediction in primary visual cortex

Learned spatiotemporal sequence recognition and prediction in primary visual cortex Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning

More information

Leukotriene B4-like material in scale of psoriatic skin lesions

Leukotriene B4-like material in scale of psoriatic skin lesions Br. J. Pharma. (1984), 83,313-317 Leukotriene B4-like material in sale of psoriati skin lesions S.D. Brain1, R.D.R. Camp, F.M. Cunningham, P.M. Dowd, M.W. Greaves & A. Kobza Blak Wellome Laboratories for

More information

Haemophilus influenzae

Haemophilus influenzae INFCTION AND IMMUNITY, June 1993, p. 2419-2424 19-9567/93/62419-6$2./ Copyright X 1993, Amerian Soiety for Mirobiology Vol. 61, No. 6 Inhibition of Human Neutrophil Migration In Vitro by Low- Moleular-Mass

More information

M E Guicciardi, G J Gores

M E Guicciardi, G J Gores 1024 RECENT ADVANCES IN BASIC SCIENCE APOPTOSIS: A MECHANISM OF ACUTE AND CHRONIC LIVER INJURY See end of artile for authors affiliations Correspondene to: Dr G J Gores, Mayo Clini College of Mediine,

More information

Supplementary Information Computational Methods

Supplementary Information Computational Methods Supplementary Information Computational Methods Data preproessing In this setion we desribe the preproessing steps taken to establish the data matrix of hepatoyte single ell gene expression data (Table

More information

rabbits were paired and both strains were used for For the estimation of mediators in the grafts, rabbits

rabbits were paired and both strains were used for For the estimation of mediators in the grafts, rabbits Br. J. Pharma. (1978), 64, 123-128. HANGES N BLOOD FLOW AND MEDATOR ONTENT OF RABBT SKN GRAFTS G.P. LEWS & BEVERLEY A. MANGHAM Department of Pharmaology, Royal ollege of Surgeons, Linoln's nn Fields, London

More information

DEPOSITION AND CLEARANCE OF FINE PARTICLES IN THE HUMAN RESPIRATORY TRACT

DEPOSITION AND CLEARANCE OF FINE PARTICLES IN THE HUMAN RESPIRATORY TRACT PII: S0003^t878(96)00171-8 Ann. oup. Hyg., Vol. 41, Supplement 1, pp. 503-508, 1997 1997 British Oupational Hygiene Soiety Published by Elsevier Siene Ltd. All rights reserved Printed in Great Britain

More information

Effect of elemental sulphur on uptake of cadmium, zinc, and sulphur by oilseed rape growing in soil contaminated with zinc and cadmium

Effect of elemental sulphur on uptake of cadmium, zinc, and sulphur by oilseed rape growing in soil contaminated with zinc and cadmium Effet of elemental sulphur on uptake of admium, zin, and sulphur by oilseed rape growing in soil ontaminated with zin and admium Cui, Y. S., Wang, Q. R., & Christie, P. (2004). Effet of elemental sulphur

More information

THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER

THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER J. Cell Si. 30, 117-128 (1978) Printed in Great Britain Company of Biologists Limited igys THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER STUART HODSON

More information

Role of Rosemary Leaf Extract Against Various Doses of Gamma Radiation

Role of Rosemary Leaf Extract Against Various Doses of Gamma Radiation Trees for Life Journal a forum on benefiial trees and plants Open aess, freely available online Researh Artiles Role of Rosemary Leaf Extrat Against Various Doses of Gamma Radiation Garima Sanheti and

More information

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence

Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2

More information

METHODS JULIO A. PANZA, MD, ARSHED A. QUYYUMI, MD, JEAN G. DIODATI, MD, TIMOTHY S. CALLAHAN, MS, STEPHEN E. EPSTEIN, MD, FACC

METHODS JULIO A. PANZA, MD, ARSHED A. QUYYUMI, MD, JEAN G. DIODATI, MD, TIMOTHY S. CALLAHAN, MS, STEPHEN E. EPSTEIN, MD, FACC JACC Vol. 17. No.3 Marh 1. 1991 :657-63 657 METHODS Predition of the Frequeny and Duration of Ambulatory Myoardial Ishemia in Patients With Stable Coronary Artery Disease by Determination of the Ishemi

More information

collagen-induced arthritis

collagen-induced arthritis Pro. Natl. Aad. Si. USA Vol. 92, pp. 517-521, January 1995 Medial Sienes Leukotriene B4 plays a ritial role in the progression of ollagen-indued arthritis R. J. GRIFFITHS*, E. R. PETrIPHER, K. KOCH, C.

More information

incorporation in hepatoma 7288CTC perfused in situ

incorporation in hepatoma 7288CTC perfused in situ Br. J. Caner (I 992), 66, 297 33 '." Mamillan Press Ltd., 1992 Br. J. Caner (1992), 66, 297-33 Mamillan Press The effet of omega-6 and omega-3 fatty aids on 3H-thymidine inorporation in hepatoma 7288CTC

More information

Defective neutrophil function in low-birth-weight,

Defective neutrophil function in low-birth-weight, J Clin Pathol 1981 ;34:366-37 Defetive neutrophil funtion in low-birth-weight, premature infants H AL-HADITHY, IE ADDISON, AH GOLDSTONE, JC CAWLEY, AND JC SHAW From the Departments of Haematology and Paediatris,

More information

Ubiquitin-dependent degradation of TGF-β-activated Smad2

Ubiquitin-dependent degradation of TGF-β-activated Smad2 Ubiquitin-dependent degradation of -ativated Roger S. Lo* and Joan Massagué* *Cell Biology Program, Howard Hughes Medial Institute, Memorial Sloan-Kettering Caner Center, New York, New York 10021, USA

More information

What causes the spacing effect? Some effects ofrepetition, duration, and spacing on memory for pictures

What causes the spacing effect? Some effects ofrepetition, duration, and spacing on memory for pictures Memory & Cognition 1975, Vol. 3 (3), 287 294 What auses the spaing effet? Some effets ofrepetition, duration, and spaing on memory for pitures DOUGLAS 1. HNTZMAN, JEFFERY J. SUMMERS, and RCHARD A. BLOCK

More information

Sodium-Potassium-Activated Adenosine Triphosphatase

Sodium-Potassium-Activated Adenosine Triphosphatase Sodium-Potassium-Ativated Adenosine Triphosphatase of Brain Mirosomes: Modifiation of Sodium Inhibition by Diphenylhydantoins GORG J. SIGL and BVRLY B. GOODWIN From the Departments of Neurology and Physiology,

More information

Antimicrobial Susceptibility of Euphorbia tirucalli Extracts and the Effect of Latex on Growth and Viability of Mouse Breast Cancer Cells EMT-6

Antimicrobial Susceptibility of Euphorbia tirucalli Extracts and the Effect of Latex on Growth and Viability of Mouse Breast Cancer Cells EMT-6 IOSR Journal of Dental and Medial Sienes (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861.Volume 13, Issue 3 Ver. VI. (Mar. 2014), PP 59-63 Antimirobial Suseptibility of Euphorbia tirualli Extrats and

More information

Coupled feedback loops maintain synaptic long-term. potentiation: A computational model of PKMzeta

Coupled feedback loops maintain synaptic long-term. potentiation: A computational model of PKMzeta 1 Draft version 28, 2018-04-30. This paper has not been peer reviewed. Please do not opy or ite without author's permission. Coupled feedbak loops maintain synapti long-term potentiation: omputational

More information

International Journal of Biological & Medical Research

International Journal of Biological & Medical Research Int J Biol Med Res. 2010; 1(4): 144-148 Int J Biol Med Res Volume 3, Issue 4, Sep 2010 www.biomedsidiret.om ISSN: 0976:6685 BioMedSiDiret Publiations Contents lists available at BioMedSiDiret Publiations

More information

COMMUN. SOIL SCI. PLANT ANAL., 29(11-14), (1998)

COMMUN. SOIL SCI. PLANT ANAL., 29(11-14), (1998) OMMUN. SOIL SI. PLANT ANAL., 9(-4), 89-896 (998) FATORS AFFETING AVAILALE MIRONUTRIENT ONENTRATIONS IN SOILS USING OA-OLA AS EXTRATANT Ewald Shnug, Juergen Flekenstein, and Silvia Haneklaus Institute of

More information

Funding: MPIC/Agrochemical Industry USDA/ARS

Funding: MPIC/Agrochemical Industry USDA/ARS Evaluation and omparison of iofungiides and fungiides for the ontrol of post harvest potato tuer diseases. E. Gahango, W. W. Kirk, P. S. Wharton, R. Shafer and P. Tumalam. Department of Plant Pathology,

More information

Lipid oxidation, color changes and volatiles production in irradiated pork sausage with di erent fat content and packaging during storage $

Lipid oxidation, color changes and volatiles production in irradiated pork sausage with di erent fat content and packaging during storage $ Meat Siene 51 (1999) 355±361 Lipid oxidation, olor hanges and volatiles prodution in irradiated pork sausage with di erent fat ontent and pakaging during storage $ Abstrat C. Jo, J.I. Lee, D.U. Ahn* Department

More information

Induction of Interleukin 18 Expression from Human Peripheral Blood Monocyte-derived Macrophages by 9-Hydroxyoctadecadienoic Acid*

Induction of Interleukin 18 Expression from Human Peripheral Blood Monocyte-derived Macrophages by 9-Hydroxyoctadecadienoic Acid* THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The Amerian Soiety for Biohemistry and Moleular Biology, In. Vol. 267, No. 20, Issue of July 15, pp. 14183-14188,1992 Printed in U. S.A. Indution of Interleukin

More information

Are piglet prices rational hog price forecasts?

Are piglet prices rational hog price forecasts? AGRICULTURAL ECONOMICS ELSEVIER Agriultural Eonomis 13 (1995) 119-123 Are piglet pries rational hog prie foreasts? Ole GjQ)lberg * Department of Eonomis and Soial Sienes, The Agriultural University of

More information

Antidiabetic activity of the methanol and acetone extracts of twigs of Combretum molle in dexamathasone induced-insulin resistance in rats

Antidiabetic activity of the methanol and acetone extracts of twigs of Combretum molle in dexamathasone induced-insulin resistance in rats World Journal of Pharmaeutial Sienes ISSN (Print): 232-33; ISSN (Online): 232-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original Artile

More information

Effects of Hemodialysis and of Glucose-Insulin Administration on Plasma Potassium and on the Electrocardiogram

Effects of Hemodialysis and of Glucose-Insulin Administration on Plasma Potassium and on the Electrocardiogram ffets of Hemodialysis and of Gluose-Insulin Administration on Plasma Potassium and on the letroardiogram By Borys Surawiz, M.D., Arthur S. Kunin, M.D., and than A. H. Sims, M.D. With the tehnial assistane

More information

Subchronic Effects of Dieldrin and Phenobarbital on Hepatic DNA Synthesis in Mice and Rats

Subchronic Effects of Dieldrin and Phenobarbital on Hepatic DNA Synthesis in Mice and Rats FUNDAMENTAL AND APPLIED TOXICOLOGY 29, 2 1 9-2 2 8 (1996) ARTICLE NO 00 Subhroni Effets of Dieldrin and Phenobarbital on Hepati DNA Synthesis in Mie and KYLE L. KOLAJA,* DONALD E. STEVENSON,! JASON T.

More information

Mineral Oil Application Experiments: Reducing Current Season PVY

Mineral Oil Application Experiments: Reducing Current Season PVY Mineral Oil Appliation Experiments: Reduing Current Season PVY Prinipal Investigator(s). Russell L. Groves, Assistant Professor and Entomology Extension Speialist, Department of Entomology, 537 Russell

More information

PIG3 promotes NSCLC cell mitotic progression and is associated with poor prognosis of NSCLC patients

PIG3 promotes NSCLC cell mitotic progression and is associated with poor prognosis of NSCLC patients Li et al. Journal of Experimental & Clinial Caner Researh (2017) 36:39 DOI 10.1186/s13046-017-0508-2 RESEARCH Open Aess PIG3 promotes NSCLC ell mitoti progression and is assoiated with poor prognosis of

More information

Reading a Textbook Chapter

Reading a Textbook Chapter HENR.546x.APPBpp001-013 7/21/04 9:37 AM Page 1 APPENDIX B Reading a Textbook Chapter Copyright 2005 Pearson Eduation, In. 1 2 Read the following hapter from the ollege textbook Total Fitness: Exerise,

More information

Proliferation of Legionella pneumophila as an Intracellular Parasite

Proliferation of Legionella pneumophila as an Intracellular Parasite APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1984, p. 467-471 0099-2240/84/030467-05$02.00/0 Copyright C) 1984, Amerian Soiety for Mirobiology Vol. 47, No. 3 Proliferation of Legionella pneumophila as

More information

Prognostic value of tissue-type plasminogen activator (tpa) and its complex with the type-1 inhibitor (PAI-1) in breast cancer

Prognostic value of tissue-type plasminogen activator (tpa) and its complex with the type-1 inhibitor (PAI-1) in breast cancer British Journal of Caner (999) 80(/2), 286 294 999 Caner Researh Campaign Artile no. bjo.998.0353 Prognosti value of tissue-type plasminogen ativator (tpa) and its omplex with the type- inhibitor (PAI-)

More information

Stefan D Anker, Stephan von Haehling

Stefan D Anker, Stephan von Haehling 464 See end of artile for authors affiliations Correspondene to: Dr Stefan D Anker, National Heart and Lung Institute, Department of Clinial Cardiology, Dovehouse Street, London SW3 6LY, UK; s.anker@imperial.a.uk

More information

EFFECT OF IONIZING RADIATION ON CELL-CYCLE PROGRESSION AND CYCLIN B1 EXPRESSION IN HUMAN MELANOMA CELLS

EFFECT OF IONIZING RADIATION ON CELL-CYCLE PROGRESSION AND CYCLIN B1 EXPRESSION IN HUMAN MELANOMA CELLS Int. J. Caner: 66,104-109 (1996) 0 1996 Wiley-Liss, In. i Publiation of the International Union Against Caner Publiation de I'Union lnternationale Contre 18 Canel EFFECT OF IONIZING RADIATION ON CELL-CYCLE

More information

Keywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION:

Keywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION: International Journal of Medial Siene and Eduation An offiial Publiation of Assoiation for Sientifi and Medial Eduation (ASME) Original Researh Artile ASSOCIATION BETWEEN QUALITY OF LIFE AND ANXIETY, DEPRESSION,

More information

Cyclic Fluctuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cycle

Cyclic Fluctuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cycle Cyli Flutuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cyle Ruth L. Goodland, M.S., and W. T. Pommerenke, Ph.D., M.D. THE SHORT spa~ of funtional life of the unfertilized human

More information

Isolation andphytochemical Characterization ofbioactive CompoundfromtheRhizomes ofcyperusrotundus.l

Isolation andphytochemical Characterization ofbioactive CompoundfromtheRhizomes ofcyperusrotundus.l Global Journal of Siene Frontier Researh: C Biologial Siene Volume Issue Version.0 Year 0 Type : Double Blind Peer Reviewed International Researh Journal Publisher: Global Journals In. (USA) Online ISSN:

More information

PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics.

PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics. PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT Mohammad Haeri, Yashar Sarbaz and Shahriar Gharibzadeh Advaned Control System Lab, Eletrial Engineering Department, Sharif University

More information

previously (Leff & Harper, 1989) this provides an experimental test for the operation of conditions under which erroneous

previously (Leff & Harper, 1989) this provides an experimental test for the operation of conditions under which erroneous Br. J. Pharmaol. (199), 11, 55-6 If--" MamiUan Press Ltd, 199 Pharmaologial estimation of agonist affinity: detetion of errors that may be aused by the operation of reeptor isomerisation or ternary omplex

More information

A review of novel biological tools used in screening for the early detection of lung cancer

A review of novel biological tools used in screening for the early detection of lung cancer 1 Respiratory Unit, Prine Philip Hospital, Hywel Dda NHS Trust, Llanelli, Wales, UK; 2 Shool of Mediine, University of Swansea, Singleton Park, Swansea, West Glamorgan, Wales, UK Correspondene to: Dr R

More information

Moclobemide excretion in human breast milk

Moclobemide excretion in human breast milk Br. J. lin. Pharma. (199), 29, 27-31 Molobemide exretion in human breast milk G. PONS', M. P. SCHORLIN2, Y. K. TAM3, C. MORAN', J. P. PFFN2, Ch. FRANCOUAL4, A. M. PDARRIOSS5, J. CHAVINI4 & G. OLIV' Departement

More information

Mass spectra of liquid crystals. V.Cyclohexyl and phenyl esters of cyclohexanecarboxylic and benzoic acids

Mass spectra of liquid crystals. V.Cyclohexyl and phenyl esters of cyclohexanecarboxylic and benzoic acids Mass spetra of liquid rystals. V.Cylohexyl and phenyl esters of ylohexanearboxyli and benzoi aids Citation for published version (APA): Lelerq, P. A., & Bogaert, van den, H. M. (). Mass spetra of liquid

More information

Rate of processing and judgment of response speed: Comparing the effects of alcohol and practice

Rate of processing and judgment of response speed: Comparing the effects of alcohol and practice Pereption & Psyhophysis 1989, 45 (4), 431-438 Rate of proessing and judgment of response speed: Comparing the effets of alohol and pratie E. A. MAYLOR, P. M. A. RABBITT, and S. A. V. CONNOLLY University

More information

Toxicity and uptake of heavy metals by human spermatozoa*

Toxicity and uptake of heavy metals by human spermatozoa* FRTILITY AND STRlUTY Copyright 1982 The Amerian Fertility Soiety Printed in U.SA. r I Toxiity and uptake of heavy metals by human spermatozoa* Sharon Battersby, Ph.D. John A. Chandler, Ph.D. t Mihael S.

More information

The effect of enalapril on the renal response to tilting in humans

The effect of enalapril on the renal response to tilting in humans Br. J. lin. Pharma. (1989), 27, 191197 The effet of enalapril on the renal response to tilting in humans N. P. LWS & D. R. FRGUSON Department of Pharmaology, University of ambridge, Hills Road, ambridge

More information

lysates of strain PML15 cells treated with mitomycin C by described by Hoshino and Kageyama (4). The preparation of

lysates of strain PML15 cells treated with mitomycin C by described by Hoshino and Kageyama (4). The preparation of JOURNAL OF BACTRIOLOGY, Feb. 1984, p. 632-636 21-9193/84/2632-5$2./ Copyright 1984, Amerian Soiety for Mirobiology Vol. 157, No. 2 Pyoin Ri Inhibits Ative Transport in Pseudomonas aeruginosa and Depolarizes

More information

A 90-Day Chloroform Inhalation Study in F-344 Rats: Profile of Toxicity and Relevance to Cancer Studies

A 90-Day Chloroform Inhalation Study in F-344 Rats: Profile of Toxicity and Relevance to Cancer Studies FUNDAMENTAL AND APPLIED TOXICOLOGY 32, 109-125 (1996) ARTICLE NO. 0113 A 90-Day Chloroform Inhalation Study in F-344 Rats: Profile of Toxiity and Relevane to Caner Studies MICHAEL V. TEMPLIN, JEFFREY L.

More information

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E

Methylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E Diabetologia () 5:9 95 DOI.7/s5--8-8 ARTICLE Methylglyoxal impairs insulin signalling and insulin ation on gluose-indued insulin seretion in the panreati beta ell line INS-E F. Fiory & A. Lombardi & C.

More information

Wise, 1974), and this was shown to be associated with an increase in the rate of 45Ca. Denmark (Received 18 August 1978) by tetracaine (104 M).

Wise, 1974), and this was shown to be associated with an increase in the rate of 45Ca. Denmark (Received 18 August 1978) by tetracaine (104 M). J. Physiol. (1979), 292, pp. 55-526 55 With 11 text-ftgurew Printed in Great Britain THE EFFECT OF HYPEROSMOLARITY AND INSULIN ON RESTING TENSION AND CALCIUM FLUXES IN RAT SOLEUS MUSCLE BY T. CLAUSEN,

More information

The effects of question order and response-choice on self-rated health status in the English Longitudinal Study of Ageing (ELSA)

The effects of question order and response-choice on self-rated health status in the English Longitudinal Study of Ageing (ELSA) The effets of question order and response-hoie on self-rated health status in the English Longitudinal Study of Ageing (ELSA) A Bowling, J Windsor Theory and methods Department of Primary Care and Population

More information

Chemically bound water as measure of degree of hydration: method and potential errors

Chemically bound water as measure of degree of hydration: method and potential errors Chemially bound ater as measure of degree of hydration: method and potential errors Fagerlund, Göran Published: 29-1-1 Link to publiation Citation for published version (APA): Fagerlund, G. (29). Chemially

More information

Southwest Fisheries Science Center National Marine Fisheries Service 8604 La Jolla Shores Dr. La Jolla, California 92037

Southwest Fisheries Science Center National Marine Fisheries Service 8604 La Jolla Shores Dr. La Jolla, California 92037 233 Abstrat We estimated the total number of pantropial spotted dolphin (Stenella attenuata) mothers killed without their alves ( alf defiit ) in all tuna purse-seine sets from 1973 90 and 1996 2000 in

More information

peristaltic activity in the colon. surface-acting agents such as bisacodyl and oxyphenisatin (Hardcastle and Mann, 1968).

peristaltic activity in the colon. surface-acting agents such as bisacodyl and oxyphenisatin (Hardcastle and Mann, 1968). Gut, 1970, 11, 41-46 Physial fators in the stimulation of oloni peristalsis J. D. HRDSTLE ND. V. MNN From St Mark's Hospital, London, and The London Hospital SUMMRY The effet of oloni distension and hanges

More information

MicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer

MicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer Zhang et al. Moleular Caner (8) 7: DOI.86/s94-7-75- RESEARCH Open Aess MiroRNA-494 promotes aner progression and targets adenomatous polyposis oli in oloretal aner Ying Zhang, Lu Guo,, Yuhuan Li,, Gui-Hai

More information

Journal of Chemical and Pharmaceutical Research, 2017, 9(10): Research Article

Journal of Chemical and Pharmaceutical Research, 2017, 9(10): Research Article Available online www.jopr.om Journal of Chemial and Pharmaeutial Researh, 2017, 9(10):95-105 Researh Artile ISSN : 0975-7384 CODEN(USA) : JCPRC5 Antidiarrhoeal, Antibaterial Ativities and Growth Stimulatory

More information

The effects of bilingualism on stuttering during late childhood

The effects of bilingualism on stuttering during late childhood Additional information is published online only at http:// ad.bmj.om/ontent/vol93/ issue11 1 Division of Psyhology and Language Sienes, University College London, London, UK; 2 Department of Language and

More information

Enhancing lipid productivity of Chlorella vulgaris using oxidative stress by TiO 2 nanoparticles

Enhancing lipid productivity of Chlorella vulgaris using oxidative stress by TiO 2 nanoparticles Korean J. Chem. Eng., 31(5), 861-867 (2014) DOI: 10.1007/s11814-013-0258-6 INVITED REVIEW PAPER INVITED REVIEW PAPER pissn: 0256-1115 eissn: 1975-7220 Enhaning lipid produtivity of Chlorella vulgaris using

More information

NEPHROCHECK Calibration Verification Kit Package Insert

NEPHROCHECK Calibration Verification Kit Package Insert NEPHROCHECK Verifiation Kit Pakage Insert Manufatured for Astute Medial, In. 3550 General Atomis Ct. Building 2 San Diego, CA 92121 USA Intended Use The NEPHROCHECK Verifiation (Cal Vers) Materials are

More information

In vivo covalent cross-linking of photon-converted rare-earth nanostructures for tumour localization and theranostics

In vivo covalent cross-linking of photon-converted rare-earth nanostructures for tumour localization and theranostics Reeived 27 May 2015 Aepted 7 De 2016 Published 20 Jan 2016 DOI: 10.1038/nomms10432 OPE In vivo ovalent ross-linking of photon-onverted rare-earth nanostrutures for tumour loalization and theranostis Xiangzhao

More information

A Hospital Based Clinical Study on Corneal Blindness in a Tertiary Eye Care Centre in North Telangana

A Hospital Based Clinical Study on Corneal Blindness in a Tertiary Eye Care Centre in North Telangana ISSN 2231-4261 ORIGINAL ARTICLE A Hospital Based Clinial Study on Corneal Blindness in a Tertiary Eye Care Centre in North Telangana 1* 1 1 1 1 Raghu Veladanda, Sindhu Sulekha Ch, Laxmipriya Pallapolu,

More information

Impaired acetaldehyde oxidation in alcoholics*

Impaired acetaldehyde oxidation in alcoholics* Impaired aetaldehyde oxidation in aloholis* K R PALMR and W J JNKINSt From the Aademi Department of Mediine, Royal Free Hospital, London Gut, 1982, 23, 729-733 SUMMARY High blood aetaldehyde levels in

More information

OPTIMIZATION OF MICROWAVE-ASSISTED EXTRACTION OF BIOACTIVE COMPOUNDS FROM LEAVES AND STEMS OF THAI WATER SPINACH (Ipomoea aquatic var.

OPTIMIZATION OF MICROWAVE-ASSISTED EXTRACTION OF BIOACTIVE COMPOUNDS FROM LEAVES AND STEMS OF THAI WATER SPINACH (Ipomoea aquatic var. OPTIMIZATION OF MICROWAVE-ASSISTED EXTRACTION OF BIOACTIVE COMPOUNDS FROM LEAVES AND STEMS OF THAI WATER SPINACH (Ipomoea aquatic var. aquatica) Boonnet Koonchanok 1, Thadsaneeya Cheunchob 1, Nisakorn

More information

Sequence Analysis using Logic Regression

Sequence Analysis using Logic Regression Geneti Epidemiology (Suppl ): S66 S6 (00) Sequene Analysis using Logi Regression Charles Kooperberg Ingo Ruzinski, Mihael L. LeBlan, and Li Hsu Division of Publi Health Sienes, Fred Huthinson Caner Researh

More information