Transient cold shock enhances zinc-finger nuclease mediated gene disruption
|
|
- Aubrey Howard
- 6 years ago
- Views:
Transcription
1 nature methods Transient cold shock enhances zincfinger nuclease mediated gene disruption Yannick Doyon, Vivian M Choi, Danny Xia, Thuy D Vo, Philip D Gregory & Michael C Holmes Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Table 1 Supplementary Table 2 Effect of the cold shock on activity at various ZFN doses. Long term stability of the cells modified using the cold shock method. Effect of the cold shock on ZFN activity and expression levels in HeLa cells. Effect of the cold shock on ZFN activity and expression levels in K562 cells. Preferential cleavage of the target sequence under cold shock conditions. Summary of cell lines tested for ZFN activity under cold shock conditions. Primers used for the Cel1 assays.
2 Supplementary Figure 1 Effect of the cold shock on activity at various ZFN doses. a TSC2 (K562, day 3) 3 days <1 < <1 < < b RIPK1 (K562, day 3) 3 days <1 < < c KDR (K562, day 3) 3 days * *
3 (a) K562 cells were nucleofected with a GFP expression plasmid () or 0.1, 0.2 and 0.4 µg of driven ZFN expression vector (lanes 24, 911, and 1618) or a β globin introncontaining vector (lanes 57, 1214, and 1921) encoding ZFN targeting TSC2. Immediately after transfection, cells were divided and incubated for 3 days at 37 C (lanes 17), 1 day at 37 C followed by 2 days at C (lanes 814) or 3 days at C (lanes 1521). The frequency of indels was assessed by the Cel1 assay 3 days posttransfection. (b) Same as (a) but using ZFN targeting RIPK1. (c) Same as (a) but using ZFN targeting KDR. Note that the site targeted is different than the one shown in figure 1 and supplementary figures 3 and 4. * Denotes a cleavage product derived from a SNP. Arrows denote the specific Cel1 product.
4 Supplementary Figure 2 Long term stability of the cells modified using the cold shock method. a TSC2 (K562, day 10) 3 days <1 < <1 < < b RIPK1 (K562, day 10) 3 days <1 < < c KDR (K562, day 10) 3 days * * < <
5 (a) K562 cells were nucleofected with a GFP expression plasmid () or 0.1, 0.2 and 0.4 µg of driven ZFN expression vector (lanes 24, 911, and 1618) or a β globin introncontaining vector (lanes 57, 1214, and 1921) encoding ZFN targeting TSC2. Immediately after transfection, cells were divided and incubated for 3 days at 37 C (lanes 17), 1 day at 37 C followed by 2 days at C (lanes 814) or 3 days at C (lanes 1521). The frequency of indels was assessed by the Cel1 assay 10 days posttransfection. (b) Same as (a) but using ZFN targeting RIPK1. (c) Same as (a) but using ZFN targeting KDR. Note that the site targeted is different than the one shown in figure 1 and supplementary figures 3 and 4. * Denotes a cleavage product derived from a SNP. Arrows denote the specific Cel1 product.
6 Supplementary Figure 3 Effect of the cold shock on ZFN activity and expression levels in HeLa cells. a KDR (HeLa, day 3, Cel1) 3 days b KDR (HeLa, day 10, Cel1) 3 days < c KDR (HeLa, day 3, western) 3 days αnfκb p65 αflag
7 (a) HeLa cells were nucleofected with a GFP expression plasmid () or 0.1, 0.2 and 0.4 µg of driven ZFN expression vector (lanes 24, 911, and 1618) or a β globin introncontaining vector (lanes 57, 1214, and 1921) encoding KDR ZFNs. Immediately after transfection, cells were divided and incubated for 3 days at 37 C (lanes 17), 1 day at 37 C followed by 2 days at C (lanes 814) or 3 days at C (lanes 15 21). The frequency of indels was assessed by the Cel1 assay 3 days posttransfection. (b) The frequency of indels was assessed by the Cel1 assay 10 days posttransfection. (c) ZFN expression levels were determined by western blot on total cell extracts prepared 3 days posttransfection. The αnfκb and αflag (ZFN) antibodies were coincubated to facilitate normalization between gels.
8 Supplementary Figure 4 Effect of the cold shock on ZFN activity and expression levels in K562 cells. a KDR (K562, day 3, Cel1) 3 days <1 <1 3 < b KDR (K562, day 10, Cel1) 3 days <1 <1 2 < c KDR (K562, day 3, western) 3 days αnfκb p65 αflag
9 (a) K562 cells were nucleofected with a GFP expression plasmid () or 0.1, 0.2 and 0.4 µg of driven ZFN expression vector (lanes 24, 911, and 1618) or a β globin introncontaining vector (lanes 57, 1214, and 1921) encoding KDR ZFNs. Immediately after transfection, cells were divided and incubated for 3 days at 37 C (lanes 17), 1 day at 37 C followed by 2 days at C (lanes 814) or 3 days at C (lanes 15 21). The frequency of indels was assessed by the Cel1 assay 3 days posttransfection. (b) The frequency of indels was assessed by the Cel1 assay 10 days posttransfection. (c) ZFN expression levels were determined by western blot on total cell extracts prepared 3 days posttransfection. The αnfκb and αflag (ZFN) antibodies were coincubated to facilitate normalization between gels.
10 Supplementary Figure 5 Preferential cleavage of the target sequence under cold shock conditions. a Obligate heterodimer Wildtype FokI ZFN GR b Obligate heterodimer Wildtype FokI ZFN Trim26 (Intron 1) c Obligate heterodimer Wildtype FokI ZFN Chr. 1 (Intergenic) <1 < <1 <
11 Supplementary Figure 5 Preferential cleavage of the target sequence under cold shock conditions. (a) K562 cells were nucleofected with a GFP expression plasmid () or 80 ng of driven ZFN expression vector (lanes 25, and 710) encoding ZFNs targeting the GR gene. Immediately after transfection, cells were divided and incubated for 3 days at 37 C (lanes 23, and 78), or 3 days at C (lanes 45, and 910). The heterodimeric variants (lanes 25) and the wildtype FokI domain (lanes 710) were compared. The frequency of indels at the GR locus was assessed by the Cel1 assay 3 days posttransfection. (b) The frequency of indels in the intron 1 of Trim26 (offtarget) was assessed by the Cel1 assay 3 days posttransfection. (c) The frequency of indels in an intergenic region of chromosome 1 (offtarget) was assessed by the Cel1 assay 3 days posttransfection.
12 Supplementary Table 1 Summary of cell lines tested for ZFN activity under cold shock conditions a. Species Cell type # genes targeted # unique sites Fold increase FokI domain Delivery method in Cel1 signal Human K b 7 c wt, OH d nucleofection Human HeLa e OH nucleofection Human HEK b 15 wt, OH lipofection nucleofection Mouse Splenocytes wt, OH nucleofection Rat C wt lentivirus Hamster CHOK f 2 b wt, OH nucleofection Pig PK OH nucleofection a In all cases, the cold shock treatment was 3 days at C immediately posttransfection. b These ZFNs produce >15% Cel1 signal at 37 C c Undetectable activity at 37 C (< 1% Cel1 signal) d Obligate heterodimeric FokI domain 12 e Cel1 signal saturated at C f These ZFNs produce >20% Cel1 signal at 37 C
13 Supplementary Table 2 Primers used for the Cel1 assays. AAVS1 KDR (Fig. 1, S3, S4) TP73 MAP3K14 EP0 BTK135 CARM1 GNAI2 TSC2 RIPK1 KDR (Fig. S1,S2) GR TRIM26 Chr. 1 F CCCCTTACCTCTCTAGTCTGTGC R CTCAGGTTCTGGGAGAGGGTAG F AGTATGGGGCCCTGTTGAAT R TCCCACTGACCTTCTATTATGAAA F GGGACAGGACGACTGACTGT R TCAGGGACTAGGGGAACTCA F GAGTATGTGTGGCAGAGGCA R GTGCCCTTGGTAATCACGTC F TTGGAGCACGACTTACCAGA R CCATGGCAGGCTGATTTACT F GAACTCCTGCACTGGTGCTT R GGTGTGGACTCACCCATTTT F GCTAGATGAGGGCTGACTGG R GCCCAAATCTCTGTGAGAGC F AGCTGCATTCCTGGTAGCTC R ACTGGGACCTGCTTCAGAGA F CTGAGAGGGCTGAGGGTGT R AGTGCAGAAACCTGGAAAGC F TGTGGGAAGAGGACCATCTC R GGTAGTTGGCTTCGTCTTGG F GGCTGCGTTGGAAGTTATTT R TGCTAAAAGTCAATGGTATTTTCAA F TCATAACACTGTTCTTCCCCTTCTTTAGCC R TCAAAACACACACTACCTTCCACTGCTC F GGAGTGGTACTGGGCGTGTC R TTCAGGAGGTTTAGAGACCATCAAA F GCAGCAACCTGCCAGCTCTA R CCCATTTGCCAACCAAGAGA
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationreads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationB. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationsupplementary information
DOI: 10.1038/ncb2157 Figure S1 Immobilization of histone pre-mrna to chromatin leads to formation of histone locus body with associated Cajal body. Endogenous histone H2b(e) pre-mrna is processed with
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSupplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationA. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
More informationChapter 3. Expression of α5-megfp in Mouse Cortical Neurons. on the β subunit. Signal sequences in the M3-M4 loop of β nachrs bind protein factors to
22 Chapter 3 Expression of α5-megfp in Mouse Cortical Neurons Subcellular localization of the neuronal nachr subtypes α4β2 and α4β4 depends on the β subunit. Signal sequences in the M3-M4 loop of β nachrs
More informationFig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
More informationJoint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSupplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2018 Supplementary Information Spying on Protein Interactions in Living Cells with Reconstituted Scarlet
More informationSupplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationHuman hematopoietic stem/progenitor cells modified by zinc finger nucleases targeted
Supporting Online Material for: Human hematopoietic stem/progenitor cells modified by zinc finger nucleases targeted to CCR5 control HIV-1 in vivo Nathalia Holt 1, Jianbin Wang 2, Kenneth Kim 2, Geoffrey
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationIdentified proteins interacting with TMBIM1 by mass spectrometry
Supplementary Information Journal: Nature Medicine Article Title: Corresponding Author: A novel multivesicular body regulator TMBIM1 protects against non-alcoholic fatty liver disease in mice and monkeys
More informationSilencing neurotransmission with membrane-tethered toxins
nature methods Silencing neurotransmission with membrane-tethered toxins Sebastian Auer, Annika S Stürzebecher, René Jüttner, Julio Santos-Torres, Christina Hanack, Silke Frahm, Beate Liehl & Inés Ibañez-Tallon
More informationFigure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
More informationSupplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit
Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico
More informationSupplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow
Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationTargeted genomic rearrangements using CRISPR/Cas technology
Targeted genomic rearrangements using CRISPR/Cas technology The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Choi, Peter
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationCRISPR/Cas9 cleavage of viral DNA efficiently suppresses hepatitis B virus
0 0 CRISPR/Cas cleavage of viral DNA efficiently suppresses hepatitis B virus Authors: Vyas Ramanan,, Amir Shlomai,, David B.T. Cox,,,, Robert E. Schwartz,,, Eleftherios Michailidis, Ankit Bhatta, David
More informationSupplementary Figure 1
Supp. Fig. NL43R Metabolic labelling Cytoplasmic grn (% of control) 4 2 8 6 4 2 grn translation (% of control) 4 2 8 6 4 2 Methionine incorporation (% of control) 2 8 6 4 2 C pcirenilla D Renilla luciferase
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationnature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
More informationProtein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More informationFIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10353 Supplementary Figure 1. Mutations of UBQLN2 in patients with ALS and ALS/dementia. (a) A mutation, c.1489c>t (p.p497s), was identified in F#9975. The pedigree is shown on the left
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationGenome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
More informationSupplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationSupplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationWDR62 is associated with the spindle pole and mutated in human microcephaly
WDR62 is associated with the spindle pole and mutated in human microcephaly Adeline K. Nicholas, Maryam Khurshid, Julie Désir, Ofélia P. Carvalho, James J. Cox, Gemma Thornton, Rizwana Kausar, Muhammad
More informationSupplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationLoss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis
SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSUPPLEMENTARY MATERIAL
SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.
More informationSupplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
More informationSplicing-coupled 3 0 end formation requires a terminal splice acceptor site, but not intron excision
Published online 8 May Nucleic Acids Research,, Vol. 4, No. 4 7 74 doi:.9/nar/gkt446 Splicing-coupled end formation requires a terminal splice acceptor site, but not intron excision Lee Davidson and Steven
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationContribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion
Contribution of the intronic mir-338-3p and its Hosting Gene AATK to Compensatory β-cell Mass Expansion Cécile Jacovetti 1, Veronica Jimenez 2, Eduard Ayuso 2#, Ross Laybutt 3, Marie-Line Peyot 4, Marc
More information