Flores-Pérez A et al Suppression of cell migration is promoted by mir-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells
|
|
- Milo Grant
- 6 years ago
- Views:
Transcription
1 Author s response to reviews Title: Suppression of cell migration is promoted by mir-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells Authors: Cesar Lopez-Camarillo (genomicas@yahoo.com.mx) Ali Flores-Pérez (qfb_ali@hotmail.com) Laurence Marchat (lmarchat@gmail.com) Sergio Rodríguez-Cuevas (sergiorocue@gmail.com) Verónica Piña Bautista (verobau2002@yahoo.com.mx) Lizeth Fuentes-Mera (lizeth46@hotmail.com) Diana Romero-Zamora (haruko_21@hotmail.com) Anabel Maciel-Dominguez (anabel.macield@gmail.com) Olga Hernández de la Cruz (ediacara79@yahoo.com.mx) Miguel Fonseca-Sánchez (mfonseca_79@hotmail.com) Erika Ruiz-García (betzabe100@yahoo.com.mx) Horacio Astudillo-de la Vega (hastud2@aol.com) Version: 1 Date: 14 Mar 2016 Author s response to reviews: Reply to new reviewer BCAN-D , Review Flores-Pérez A et al Suppression of cell migration is promoted by mir-944 through targeting of SIAH1 and PTP4A1 in breast cancer cells
2 My first impression of this paper is the absence of coordination between the experimental design and the goal to be achieved, namely the role played by mir-944 in the invasion/metastasis phenotype. Let s start with the cell lines. In Fig 1C, we have breast cancer cell lines (MCF-7, T47-D, MDA-MB-453, ZR-75 and MDA-MB-231) and what the authors call Normal tissues. It is not appropriate to compare established breast cancer cell lines and normal tissues taken from tumors. Here there is need for a normal breast cell line like HMEC from ATCC. Reply: We acknowledge for the reviewer comments. As reviewer suggested we performed additional experiments to shown the expression of mir-944 in a normal breast cancer cell line. We performed qrt-pcr for mir-944 using total RNA from non-tumorigenic MCF-10A (ATTC CRL-10317). Results show that mir-944 expression was higher in MCF-10A cells in comparison to panel of breast cancer cell lines (MCF-7, T47-D, MDA-MB-453, ZR-75 and MDA-MB-231). In addition, mir-944 expression data obtained from normal breast tissues was removed in the new figure 1 as the reviewer suggested. In the Results section MiR-944 is suppressed in breast cancer cell lines and clinical tumors, the authors compared the expression of mir-944 in 40 patient tumors (the majority of them are triple negative) and breast cancer cell lines (MCF-7, T47-D, MDA-MB-453, ZR-75 and MDA-MB- 231). The breast cancer cell lines are a mixture of hormone dependent like MCF-7 and hormone independent like MDA-MB-231. The conclusion is the low expression of mir-944 by breast cancer cell lines and breast tumors regardless of their hormonal status. To strengthen their conclusion the authors validated their data by using 776 matched normal/tumor samples from The Cancer Genome Atlas (TCGA) (validation cohort). So we have results obtained from three types of material (breast cancer cell lines, clinical tumors and a TCGA validation cohort) to conclude that mir-944 is poorly expressed. Then the authors candidly stated We did not find significant differences in mir-944 expression when tumors were stratified according to the expression of estrogen, progesterone and HER2 receptors (data not shown). Why the authors didn t see the contradiction in their successive statements. According to the published literature breast cancer cell lines MDA-MB-231 and MDA-MB-453 are metastatic (Ref Cancer Res 1990, 50, ) and MCF-7 and T47-D are not metastatic (Ref Oncology Reports 2011, 25: ) and the reason is their hormonal status.
3 Cell Line Hormonal Status Metastatic Potential mir-944 Expression MDA-MB-231 independent Yes Very low MCF-7 dependent No Very low Reply: We apologize if the redaction of results caused confusion. Our data clearly indicate that mir-944 expression was low in a panel of breast cancer cell lines, independent of hormonal receptors status, thus we did not see the contradiction mentioned by the reviewer. We agree with reviewer that breast cell lines tested here for mir-944 expression have different hormonal receptors expression. However, as we found that mir-944 expression is suppressed in all cell lines regardless of their hormonal status, the contribution of hormonal receptors in gene expression of mir-944 was irrelevant in this case, and not discussed. It s important to note that our findings were validated by analyzing a large cohort of clinical breast tumors which also displayed different status of hormonal receptors. Again, the results obtained ware the same as observed in breast cell lines, i.e. the low expression of mir-944 was independent of hormonal receptors expression. Therefore, to avoid confusion in the interpretation of data, in this revised version of manuscript we tuned down our conclusions and only mentioned that mir-944 expression was low in all the samples analyzed (i.e., breast cancer cell lines vs normal cell line; clinical tumors vs normal tissues, and TGCA cohort vs normal tissues). In addition, to avoid confusion and misinterpretation we have remove the statement We did not find significant differences in mir-944 expression when tumors were stratified according to the expression of estrogen, progesterone and HER2 receptors (data not shown) in this revised version of manuscript. We agree with the reviewer comments about the low metastatic potential of MCF-7 cells and other cell lines. The original idea to include MCF-7 cells in our experiments was to compare the mir-944 effects in metastatic (MDA-MB-231) and poor-invasive (MCF-7) cell lines. As expected, we found a deeper effect of mir-944 in cell migration of MD-MB-231 cells in comparison to MCF-7. However, the role of hormonal receptors in migration inhibition by mir- 944 is out of the purposes of this study. In fact, the metastatic potential of cancer cells in vivo is not always influenced by hormonal receptors, but a complex genetic program which is activated and shaped by tumor environment.
4 This is not an exercise of philosophy but an accurate analysis of scientific results. The already available knowledge based on the hormonal status of breast cancer (such a status has implications in therapeutic decisions for patients) the metastatic potential depends on the hormonal status. The new knowledge: the mir-944 status of breast cancer cell lines does not depend on the hormonal status. The mir-944 sequence is located in the intron 4 of p63 gene (Ref Nucl. Acids Res. 2015, 43, ). The p63 inhibits metastasis according to this paper PNAS USA 2012, 109, Therefore the low expression of mir-944 may be due to the deletion of p63 gene or a lack of expression of p63 and perhaps mir-944 (epigenetic modification?). We have no idea about the expression mechanism of mir-944 and I didn t find a reference about the status of p63 in MDA-MB-231 and MCF-7. We don t know how the endocrine system in the body is coordinated with the micro RNA regulation. We are in a new area of knowledge, caution is the rule. Reply We thank the reviewer for his interest in our work. However, we do not understand what is the question?. The new knowledge indicates that epithelial-to-mesenchymal transition (EMT, a well-accepted marker of metastasis) is not always related to metastasis in vivo (Beerling et al. Plasticity between Epithelial and Mesenchymal States Unlinks EMT from Metastasis-Enhancing Stem Cell Capacity. Cell Rep Mar 2). Here we did not found alterations if EMT markers (data not shown) in mir-944 transfected cells suggesting that at least in our in vitro model, EMT is no related to mir-944 suppression of migration and additional mechanism may be responsible of effects on cell migration. As we known, in genetic studies where a mirna or gene is transfected, a fixed state is established and did not reveals all the mechanisms operating in vivo, thus we take caution of our observations and conclusions. We strongly disagree with reviewer comments about the dependence of metastatic potential with hormones receptor status. The mechanism responsible for metastatic potential of breast cancer cells are more complex and not always depends on the hormonal receptors status, but its depends on a transcriptional and epigenetic landscape that is shaped during the invasion progression, where the loss of hormonal receptors is frequent (Grewal et al. Isolated loss of hormonal receptors in leptomeningeal metastasis from estrogen receptor- and progesterone receptorpositive lobular breast cancer. J Clin Oncol. 2010, 1;28(13):e200-2).
5 In addition, change in expression of hormone receptors and HER-2 status and lack of concordance between primary tumour and corresponding local recurrence or distant metastasis has been well documented (Bogina et al. Comparison of hormonal receptor and HER-2 status between breast primary tumours and relapsing tumours: clinical implications of progesterone receptor loss. Virchows Arch Jul;459(1):1-10 and, Ibrahim et al. Hormonal receptor, HER2, and Ki67 discordance between primary breast cancer and paired metastases: clinical impact. Oncology. 2013;84(3):150-7). In particular, in this study we suggested that mir-944 low expression and effects on cell migration may be not influenced by hormonal receptors, as we did not find concordance between receptors status and mir-944 expression. We know that mir-944 gene is located into an intron of p63 gene. However, the role of p63 in cancer is more complex as it exhibits tumor suppressor and oncogene functions. Indeed it has been reported that p63 may have a dual function in metastasis: p63 enhances (PNAS. 2012;109(38): ) or inhibit (Cancer Lett. 2014, 10;353(1):124-32) metastasis of tumors. Whit this knowledge in mind, during the preparation of this study we explored if the p63 and mir-944 expression could be coregulated in breast tumors. However, our data indicate a lack of relationship between the expression of p63 and mir-944, at least in the tissue samples analyzed here (n=10 samples). This may be explained by the fact that mir-944 expression is controlled by an independent and own promoter (Kim et al. ΔNp63 intronic mir-944 is implicated in the ΔNp63-mediated induction of epidermal differentiation. Nucleic Acids Res. 2015;43(15): ), indicating that p63 and mir-944 expression is not always coupled. Therefore, at this point we cannot stablish a relation between the low expression of mir-944 and deletion/low expression of p63 gene. In my opinion this discrepancy between the metastatic potential of both cell lines MDA-MB-231 and MCF-7 in regard of their hormonal status and the mir-944 expression status is the main finding of this paper. Unfortunately it was missed by the authors because of rapid thinking and lack of knowledge in cancer research. As a consequence of this the next Results section MiR- 944 inhibits tumor cell migration and invasion was not done well. The mir-944 ectopic expression in both cell lines showed that in scratch/wound-healing assays cell monolayers restoration was delayed in both cell lines and that in transwell chamber assays the number of migratory cells was significantly (p<0.05) reduced in MDA-MB-231 (4-fold) and MCF-7 (8- fold) cells that ectopically express mir-944 (Fig. 2C and G). Moreover, mir-944 significantly (p<0.05) inhibited the ability of metastatic MDA-MB-231 cells to invade matrigel in vitro (Fig. 2D). The three tests should have been done for both cell lines. What is the consequence of mir- 944 ectopic expression on the metastatic potential of MCF-7? We never know.
6 Reply: We performed the scratch/wound-healing and transwell chambers assays using both MCF-7 and MDA-MB-231 cells, but invasion assays using matrigel in transwell chambers were done only for metastatic MDA-MB-23 cells. It is well known that MCF-7 cells do not traverse the matrigel in invasion assays using transwell chambers coated with extracellular matrix, thus MCF-7 cells were not included in these invasion assays. The effects of mir-944 restoration in cell migration were compared between MCF-7 and MDA-MB-231 cells; in contrast we cannot compare the effects in cell invasion between these cell lines as MCF-7 is poorly invasive and not suitable for invasion assays in matrigel systems. In addition a better test to investigate the effect of ectopic mir-944 expression on the metastatic phenotype should have been done in vivo. There are both MDA-MB-231 and MCF-7 cell lines transfected with luciferase and their growth and metastasis potential assessed by Bioluminescence Imagery (BLI) as it is explained in the this paper: J. Clin. Invest. 2005, 115: Furthermore the scratch/wound-healing assays even it is very widely used, is not very appropriate. Here is why for two reasons. First when you scratch a monolayer you take the cells but not the extracellular matrix which will enhance the growth of cells. Second the invasion in vivo is not done in empty space with only extracellular matrix, cancer cells invade tissue structures containing cells, extracellular matrix which nature depends on the tissue. The in vivo studies are more suited for this paper. Reply We agree with reviewer comments. However, in vivo studies are beyond the aim of this study as it s not possible to perform them in a short time period (editor gave us only 1 month to reply; by march 11). As we known, in vivo analysis is difficult to carried out and the logistic to make these experiments take at least 3 months, as the animal protocols need to be reviewed and approved by the Institutional Ethical committee. A complete in vivo analysis to extend our findings need more time to do, thus we consider that at this point in vivo assays are matter for a new manuscript. We acknowledge to reviewer for these suggestions, and we will take into account for a new upcoming project. In the Results section MiR-944 alters cytoskeleton organization both cell lines MDA-MB-231 and MCF-7 should be explored the same way.
7 Reply As reviewer suggested we performed additional experiments to shown the effect of mir-944 in the cytoskeleton of MCF-7 cells. As in MDA-MB-231 cells we examined the organization of cytoskeleton by analyzing the distribution of F-actin labeled with rhodamine-phalloidin using confocal microscopy and the subcellular distribution of a-actinin-1, an actin -crosslinking protein that reinforces focal adhesions. Our data showed that similar changes in actin cytoskeleton organization in MCF-7 cells after transfection of mir-944 precursor, although in less extent in comparison with MDA-MB-23 cells. MCF-7 cells also showed an axial F-actin cytoskeleton organization. In contrast, the ectopic expression of mir-944 produced a dramatic effect on overall cell morphology since spread area was increased. Moreover, F-actin was redistributed in a radial mode towards the periphery of the cell, as well as in the central zone; and the incipient membrane ruffles and filopodia structures were loss. In pre-mir-944 transfected cells, we observed a robust signal of α-actinin-1 and a slight increase in the number of contact points with F-actin in multiple points of cell body, indicative of the reinforcement of focal adhesions. All these data was added to the new version of figure 3. The authors didn t walk the extra mile and therefore they are missing interesting results. When we do research we should be prepared for everything, I mean what we expect to see and also what we do not expect to see. Two of the most important discoveries of all time are in that category: the discovery of Penicillin by Alexandre Fleming and the discovery of radioactivity by Henri Becquerel. I have two other minor remarks. First Ref 14 is PNAS USA 2012, 109, and not PNAS USA 2012, 18, Second: since its first description in 1983 by Tim Mossman (J. of lmmunol. Methods 1983, 65: 55-63) or in 2015 (J. of Cancer Ther. 2015, 6: ) the MTT should be dissolved in PBS at 5mg/ml and not 1mg/ml. The authors should say in what liquid they dissolved the MTT. Reply We apologize for the confusion. We prepare the MTT stock solution at 1mg/ml in DMEM culture media without serum fetal bovine complementation, but working solution was prepared to 0.5 ml/mg. In the above references, the same working solution (MTT 0.5 mg/ml) was used. MTT was dissolved in non-complete medium, as describe several reports ( ). In our hands we did not observed problems in solubility of MTT in culture media. Conclusion: this is an interesting work worthy of publication. If the authors take care of my recommendations the value of this paper will increase.
8 Reply We acknowledged to reviewer for these important observations which clarify specific points and conclusions. We take care of your recommendations. Abdelkrim Alileche MD, PhD. Boise State University University Drive. Biology Department. Boise, ID USA. Phone:
Supplementary information. Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls
Supplementary information Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls angiogenesis in breast cancer Ali Flores-Pérez, Laurence A. Marchat, Sergio Rodríguez-Cuevas, Verónica Bautista-Piña,
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationContents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationCover Letter. Reviewer 1:
Cover Letter Michael Yang, M.D., Ph.D. Managing Editor of Cancer Research Frontiers 1188 Willis Ave, #109, Albertson, NY 11507, USA Phone: +1-917-426-1571 http://cancer-research-frontiers.org/ Dear Dr.
More informationTitle: Persistent tumor cells in bone marrow of early breast cancer patients after primary surgery are associated with inferior outcome
Author's response to reviews Title: Persistent tumor cells in bone marrow of early breast cancer patients after primary surgery are associated with inferior outcome Authors: Kjersti Tjensvoll (ktje@sus.no)
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationMolecular Characterization of Breast Cancer: The Clinical Significance
Molecular Characterization of : The Clinical Significance Shahla Masood, M.D. Professor and Chair Department of Pathology and Laboratory Medicine University of Florida College of Medicine-Jacksonville
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationAward Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.
AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,
More informationClinical Oncology - Science in focus - Editorial. Understanding oestrogen receptor function in breast cancer, and its interaction with the
Clinical Oncology - Science in focus - Editorial TITLE: Understanding oestrogen receptor function in breast cancer, and its interaction with the progesterone receptor. New preclinical findings and their
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
More informationDoes EMT Contribute to Radiation Resistance in Human Breast Cancer?
AD Award Number: W81XWH-10-1-0592 TITLE: Does EMT Contribute to Radiation Resistance in Human Breast Cancer? PRINCIPAL INVESTIGATOR: Anupama Munshi, Ph.D CONTRACTING ORGANIZATION: University of Oklahoma
More informationThe Avatar System TM Yields Biologically Relevant Results
Application Note The Avatar System TM Yields Biologically Relevant Results Liquid biopsies stand to revolutionize the cancer field, enabling early detection and noninvasive monitoring of tumors. In the
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationFAQs for UK Pathology Departments
FAQs for UK Pathology Departments This is an educational piece written for Healthcare Professionals FAQs for UK Pathology Departments If you would like to discuss any of the listed FAQs further, or have
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationCONTRACTING ORGANIZATION: Mount Sinai School of Medicine New York, New York
AD AWARD NUMBER: W81XWH-05-1-0475 TITLE: Restoration of Epithelial Polarity in Metastatic Tumors PRINCIPAL INVESTIGATOR: Sergei Sokol, Ph.D. CONTRACTING ORGANIZATION: Mount Sinai School of Medicine New
More informationTitle: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis
Author's response to reviews Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis Authors: Kensuke Akaogi (kensuke.akaogi@gmail.com) Wakana Ono (wakana315@gmail.com)
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationConsensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018
Consensus statement between CM-Path, CRUK and the PHG Foundation following on from the Liquid Biopsy workshop on the 8th March 2018 Summary: This document follows on from the findings of the CM-Path The
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationTITLE: Hyaluronan-CD44 Interactions Decrease the Metastatic Potential of Breast Cancer Cells
Award Number: W81XWH-06-1-0455 TITLE: Hyaluronan-CD44 Interactions Decrease the Metastatic Potential of Breast Cancer Cells PRINCIPAL INVESTIGATOR: Jose I. Lopez CONTRACTING ORGANIZATION: The University
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationAntithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity
The EMBO Journal Peer Review Process File - EMBO-2014-89574 Manuscript EMBO-2014-89574 Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity Shiv K. Singh,
More informationThe pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas
Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling
More informationCancer Research Techniques
Cancer Research Techniques Identification of Anti-Invasive but Noncytotoxic Chemotherapeutic Agents Using the Tetrazolium Dye MTT to Quantitate Viable Cells in Matrigel BioTechniques 24:1038-1043 (June
More informationTable S2. Expression of PRMT7 in clinical breast carcinoma samples
Table S2. Expression of PRMT7 in clinical breast carcinoma samples (All data were obtained from cancer microarray database Oncomine.) Analysis type* Analysis Class(number sampels) 1 2 3 4 Correlation (up/down)#
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationImmunohistochemical classification of breast tumours
Immunohistochemical classification of breast tumours Workshop in Diagnostic Immunohistochemistry September 19 th - 21 th 2018 Anne-Vibeke Lænkholm Department of Surgical Pathology, Zealand University Hospital,
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
More informationTGFβ/BMP/Smad signaling pathway
TGFβ/BMP/Smad signaling pathway Dr. Jean Jacques Lebrun Professor of Medicine, McGill University Health Center, Cancer Research Program Associate Dean, Graduate & Postdoctoral Studies McGill University
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationCorning BioCoat Matrigel Invasion Chamber
Corning BioCoat Matrigel Invasion Chamber Catalog No. 354480, 354481 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200 (U.S.) CLSTechServ@Corning.com www.corning.com/lifesciences
More informationDr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary
More informationEMT: Epithelial Mesenchimal Transition
EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis
More informationTitle: Cystatin E/M suppresses legumain activity and invasion of human melanoma
Author's response to reviews Title: Cystatin E/M suppresses legumain activity and invasion of human melanoma Authors: Jon J Briggs JJB (jbriggs33@yahoo.com) Mads H Haugen MHH (Mads.Haugen@rr-research.no)
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-04-1-0618 TITLE: Are Breast Tumor Stem Cells Responsible for Metastasis and Angiogenesis PRINCIPAL INVESTIGATOR: Quintin Pan, Ph.D. CONTRACTING ORGANIZATION: University of Michigan
More informationCell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator
Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationRetrospective analysis to determine the use of tissue genomic analysis to predict the risk of recurrence in early stage invasive breast cancer.
Retrospective analysis to determine the use of tissue genomic analysis to predict the risk of recurrence in early stage invasive breast cancer. Goal of the study: 1.To assess whether patients at Truman
More informationTherapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis
Therapeutic targeting neuraminidase-1 in multi-stage of tumorigenesis Myron R. Szewczuk Dept. Biomedical and Molecular Sciences, Queen's University, Kingston, K7L 3N6 Ontario, Canada HIGHLIGHTS. An innovative
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationThe clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
More informationTitle: Dysregulated mir-183 Inhibits Migration in Breast Cancer
Author's response to reviews Title: Dysregulated mir-183 Inhibits Migration in Breast Cancer Authors: Aoife J Lowery (aoife.lowery@gmail.com) Nicola Miller (nicola.miller@nuigalway.ie) Roisin M Dwyer (roisin.dwyer@nuigalway.ie)
More informationSUPPLEMENTAY FIGURES AND TABLES
SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression
More informationHeterogeneidad tumoral. Federico Rojo
Heterogeneidad tumoral Federico Rojo Outline of the presentation Definition and evidences Intertumor heterogeneity Spatial and temporal intratumor heterogeneity Clinical implications of tumor heterogeneity.
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationBreast cancer: Molecular STAGING classification and testing. Korourian A : AP,CP ; MD,PHD(Molecular medicine)
Breast cancer: Molecular STAGING classification and testing Korourian A : AP,CP ; MD,PHD(Molecular medicine) Breast Cancer Theory: Halsted Operative breast cancer is a local-regional disease The positive
More informationTHE ROLE OF VITAMIN D IN BREAST CANCER:
THE ROLE OF VITAMIN D IN BREAST CANCER: Investigating Potential Inhibition Through Matrix Metalloproteinase 2 Student Author Hyesoo Chae is a professional student in the Purdue University College of Pharmacy.
More informationCD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells
CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction
More informationANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich
ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum
More informationGene Signatures in Breast Cancer: Moving Beyond ER, PR, and HER2? Lisa A. Carey, M.D. University of North Carolina USA
Gene Signatures in Breast Cancer: Moving Beyond ER, PR, and HER2? Lisa A. Carey, M.D. University of North Carolina USA When Are Biomarkers Ready To Use? Same Rules for Gene Expression Panels Key elements
More informationFundamental research on breast cancer in Belgium. Rosita Winkler
Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -
More informationOutline of the presentation
Outline of the presentation Breast cancer subtypes and classification Clinical need in estrogen-positive (ER+) metastatic breast cancer (mbc) Sulforaphane and SFX-01: the preclinical evidence STEM Phase
More informationLncRNA LET function as a tumor suppressor in breast cancer development
European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationExpression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.
More informationRASAL2 activates RAC1 to promote triple-negative breast cancer progression
The Journal of Clinical Investigation Research article RASAL2 activates RAC1 to promote triple-negative breast cancer progression Min Feng, 1 Yi Bao, 1 Zhimei Li, 1 Juntao Li, 2 Min Gong, 1 Stella Lam,
More informationVetenskaplig slutrapport, AFA Försäkring
Institutionen för Strålningsvetenskaper Avdelningen för Onkologi Emma Persson 2016-09-29 Sid 1 (5) Vetenskaplig slutrapport, AFA Försäkring Forskningsprojekt dnr 120338, Projekttitel: Skelettmetastaserande
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationTITLE: Enhancement of Tumor Immunotherapy by Blockade of a Prostate Tumor Derived Immunosuppressive Factor
AD AWARD NUMBER: W81XWH-04-1-0185 TITLE: Enhancement of Tumor Immunotherapy by Blockade of a Prostate Tumor Derived Immunosuppressive Factor PRINCIPAL INVESTIGATOR: Xu Hui, Ph.D. CONTRACTING ORGANIZATION:
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationHippo component YAP promotes focal adhesion and tumour aggressiveness via transcriptionally activating THBS1/FAK signalling in breast cancer
Shen et al. Journal of Experimental & Clinical Cancer Research (2018) 37:175 https://doi.org/10.1186/s13046-018-0850-z RESEARCH Open Access Hippo component YAP promotes focal adhesion and tumour aggressiveness
More informationThomas Jefferson University Annual Progress Report: 2008 Formula Grant
Thomas Jefferson University Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2012 December 31, 2012 Formula Grant Overview The Thomas Jefferson University received $3,455,597 in formula
More informationProtocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
More informationQuantitative Data Analysis Assignment Sample Newessays.co.uk
Absorbance Quantitative Data Analysis Assignment Sample Newessays.co.uk Part A: Results of the Study Is there a difference of curve profile between the MTT assay and the cell number? What do the different
More informationTitle: Survival endpoints in colorectal cancer. The effect of second primary other cancer on disease free survival.
Author's response to reviews Title: Survival endpoints in colorectal cancer. The effect of second primary other cancer on disease free survival. Authors: Helgi Birgisson (helgi.birgisson@surgsci.uu.se)
More informationThe splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer
The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department
More informationTitle: Comparative actions of progesterone, medroxyprogesterone acetate, drospirenone and nestorone on breast cancer cell migration and invasion
Author's response to reviews Title: Comparative actions of progesterone, medroxyprogesterone acetate, drospirenone and nestorone on breast cancer cell migration and invasion Authors: Fu Xiao-Dong (fuxiaodong27@hotmail.com)
More informationDiscrete domains of gene expression in germinal layers distinguish the development of gyrencephaly
Manuscript EMBO-2015-91176 Discrete domains of gene expression in germinal layers distinguish the development of gyrencephaly Camino De Juan Romero, Carl Bruder, Ugo Tomasello, Jose Miguel Sanz-Anquela
More informationIdentifying genomic signatures in circulating breast tumour cells
Identifying genomic signatures in circulating breast tumour cells 9 th ISMRC 2013, Paris, France September 25th, 2013 NISHA KANWAR PhD Candidate Department of Laboratory Medicine and Pathobiology University
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationTITLE: Role of ADAM15 in Tumor/Endothelial Interactions Prostate Cancer Regression
AD Award Number: W81XWH-07-1-0030 TITLE: Role of ADAM15 in Tumor/Endothelial Interactions Prostate Cancer Regression PRINCIPAL INVESTIGATOR: Mark L. Day CONTRACTING ORGANIZATION: University of Michigan
More informationCytoSelect Tumor- Endothelium Adhesion Assay
Product Manual CytoSelect Tumor- Endothelium Adhesion Assay Catalog Number CBA- 215 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cancer metastasis comprises several
More informationLiquid Biopsy: Implications for Cancer Staging & Therapy
Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate
More informationCanAssist-Breast: New test for prediction of risk of recurrence in ER+/Her2- early stage breast cancer patients Manjiri Bakre, Ph.D.
CanAssist-Breast: New test for prediction of risk of recurrence in ER+/Her2- early stage breast cancer patients Manjiri Bakre, Ph.D. Founder and CEO OncoStem Diagnostics Pvt. Ltd. Treatment Decision: HR+/HER2-
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University
More informationImpact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
More informationScientific Editing Report
Acknowledge editing support International publication guidelines such as ICMJE guidelines state that all non-author contributions, including editing, should be acknowledged. If you are satisfied with the
More informationNewly diagnosed with metatastic disease: where do we go from here? Rick Michaelson Saint Barnabas Medical Center
Newly diagnosed with metatastic disease: where do we go from here? Rick Michaelson Saint Barnabas Medical Center A Diagnosis of Advanced Breast Cancer Leads To Many Immediate Questions How am I supposed
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-1-1-176 TITLE: Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer PRINCIPAL INVESTIGATOR: Hsieh, Jer-Tsong CONTRACTING ORGANIZATION: University of Texas Southwestern
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationTitle: Peritumoral Vascular Invasion and NHERF1 expression define an immunophenotype of grade 2 invasive breast cancer associated with poor prognosis
Author's response to reviews Title: Peritumoral Vascular Invasion and NHERF1 expression define an immunophenotype of grade 2 invasive breast cancer associated with poor prognosis Authors: Andrea Malfettone
More informationTitle: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles
Author's response to reviews Title: Human breast cancer associated fibroblasts exhibit subtype specific gene expression profiles Authors: Julia Tchou (julia.tchou@uphs.upenn.edu) Andrew V Kossenkov (akossenkov@wistar.org)
More informationDynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer
Article Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Jiyeon Yun,, Sang-Hyun Song, Hwang-Phill Kim, Sae-Won Han,, Eugene C Yi & Tae-You Kim,,, Abstract
More informationThe Role of MicroRNAs in Breast Cancer Migration, Invasion and Metastasis
Int. J. Mol. Sci. 2012, 13, 13414-13437; doi:10.3390/ijms131013414 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms The Role of MicroRNAs in Breast
More informationFoxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.
Manuscript EMBO-2012-82682 Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. David Balli, Vladimir Ustiyan, Yufang Zhang, I-Ching Wang, Alex J. Masino,
More informationTITLE: Induction of Ephs/Ephrins-Mediated Tumor Cells-Endothelial Cells Repulsion as an Anti-Cancer Therapeutic Approach
AD Award Number: W81XWH-04-1-0661 TITLE: Induction of Ephs/Ephrins-Mediated Tumor Cells-Endothelial Cells Repulsion as an Anti-Cancer Therapeutic Approach PRINCIPAL INVESTIGATOR: Gerald Batist, M.D. CONTRACTING
More information