Cellometer Image Cytometry for Cell Cycle Analysis
|
|
|
- Christina Henry
- 6 years ago
- Views:
Transcription
1 Cellometer Cytometry for Cell Cycle Analysis
2 Importance of Cell Cycle Research Oncology: Since cancer cells often undergo abnormal cell division and proliferation, it is important to understand the cell cycle of those cells. Pharmacology: Studies involving characterization of pharmacological reagents and their effect on cell cycle regulation Development of drugs to arrest normal cell cycling during chemotherapy treatment to reduce side effects Cell/Molecular Biology: To understand molecular and biological mechanisms, it is essential to examine their role in cell cycle.
3 What is Cell Cycle? Cell cycle is defined as the period between successive divisions of a cell. Standard cell cycle of eukaryotic cells is divided into 4 phases. 1. G1 (G=Gap) phase. Cells are preparing for DNA replica3on. At this stage the cells contain about the same amount of DNA. (diploid (2n)) 2. S (S=Synthesis) phase. Replica3on of nuclear DNA occurs at this stage. During S phase there is a broad distribu3on of DNA content between G1 and G2 phase. The DNA content is doubled by the end of this phase. (2n to 4n) 3. G2 (G=Gap) phase. Replica3on of the DNA is complete, and the cell is growing and preparing for division. At this stage, the cells contain twice the number of chromosomes (4n) that are found in G1. 4. M (M=Mitosis) phase. Cell division.
4 Cell Cycle Detection Methods There are multiple methods and protocols for detecting DNA content during cell cycle: Radioactivity Measurement 3 H-thymidine Radioactive labeling of thymidine. Upon DNA replication, the radiolabled thymidine is incorporated into new DNA. Fluorescence-Based Detection Live cell measurement Hoechst Is cell permeable and therefore do not require cell fixation. Binds to the minor groove of double-stranded DNA. Fixed cell measurement Bromodeoxyuridine (BrdU) A thymidine analog, is incorporated into the genome during the S-phase of the cell cycle. Detected using anti-brdu antibodies. DAPI Binds to the AT rich regions of the DNA. Poor live cell permeability and therefore often used post-fixing. Propidium Iodide (PI) A membrane exclusion dye and an intercalating agent that stains the cellular genome upon cell fixation.
5 Fluorescence-based Cell Cycle Analysis using PI Labeling DNA with propidium iodide (PI) allows for fluorescence- based analysis of cell cycle. 2n 4n This assay generates a cell popula3on histogram (on lel) in respect to PI fluorescence intensity. Amount of PI fluorescence intensity is correlated to the amount of DNA within each cell. Since the amount of DNA doubles (2n à 4n) between G1 and G2 phases, the amount of fluorescence intensity of the cell popula3on also doubles.
6 Cell Cycle Analysis Control Media Nocodazole In this cell cycle experiment, cells were treated with Nocodazole, a compound designed to arrest the cell cycle at the G 2 M Phase. 24 hour Incubation Sample preparation
7 Sample Preparation for PI Cell Cycle Analysis Collect cells (control and treated) Fix for 15 min Stain with PI Cell Cycle Reagent (40 min) Re-suspend in final volume of PBS Analyze using Vision CBA
8 Cellometer Cytometry Procedure Analyze Cells in Just a Few Steps 1. Pipette 20uL of cells into counting chamber 2. Insert chamber 3. Select Assay & enter Sample ID 4. Click count to image and view cell count, concentration, and diameter 5. View bright field and fluorescent cell images 6. With Vision CBA, click export to view data plots
9 PI Cell Cycle: Jurkat Cells Sample Information Cell type: T lymphocyte Disease: acute T cell luekemia Type: non adherent Untreated control Cell Pop % Gated Sub G 1 0.2% G 0 /G % S 17.1% G 2 /M 15.4% Bright Field Propidium Iodide
10 Nocodazole-Induced Cell Cycle Arrest Control Nocodazole [ µg/ml] Dose Response Cells arrested at G 2 /M Phase G 0 /G 1 G 2 /M Sub G 1 S Phase Control Sub G % G 0 /G % S 15.00% G 2 /M 14.35% Nocodazole (μg/ml) % 12.15% 9.18% 53.69% 10.27% 7.93% 17.26% 17.81% 9.39% 12.35% 41.40% 47.78%
11 Cellometer and Flow Cytometry Correlation % of Cells Arrested at G 2 /M Phase Cellometer Flow Excellent correlation between Cellometer Vision CBA and flow results Phase μg/ml 0.02 μg/ml 0.1 μg/ml G 2 /M 12.35% 41.40% 47.78% G 2 /M 15.25% 39.10% 43.10%
12 PI Cell Cycle: PC-3 Cells Sample Information Organ: prostate Cell Type: epithelial Disease: adenocarcinoma Type: adherent Untreated control Bright Field Propidium Iodide
13 PI Cell Cycle: HeLa Cells Sample Information Organ: cervix Cell Type: epithelial Disease: adenocarcinoma Type: adherent Untreated control Bright Field Propidium Iodide
14 PI Cell Cycle: PANC-1 Cells Sample Information Organ: pancreas Cell Type: epithelial Diseases: epithelioid carcinoma Type:adherent Untreated control Bright Field Propidium Iodide
15 PI Cell Cycle: HT-29 Sample Information Organ: colon Cell Type: epithelial Diseases: colorectal adenocarcinoma Type: adherent Untreated control Bright Field Propidium Iodide
16 DAPI as an Alternative Staining Method for Cell Cycle Sample Information PC3 cells: Untreated control Organ: prostate Cell Type: epithelial Disease: adenocarcinoma Type: adherent Bright Field UV
17 Summary The Cellometer can be utilized to effectively measure and analyze the cell cycle of mammalian cells. There is an excellent correlation between the Cellometer results and flow cytometry results. Cellometer may be used to examine a wide variety of mammalian cells.
Fluorescence Microscopy
Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized
The Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation
Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,
Supplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
High Throughput Screening of Compounds Affecting Distinct Phases of the Cell Cycle Using Mix-and-Read Assays
pplication Note igh Throughput Screening of ompounds ffecting istinct Phases of the ell ycle Using Mix-and-Read ssays Robbie Narang, Zhaoping Liu, Kim Luu Intelliyt orporation Introduction The cell cycle
Annexin V-FITC Apoptosis Detection Kit
ab14085 Annexin V-FITC Apoptosis Detection Kit Instructions for Use For the rapid, sensitive and accurate measurement of Apoptosis in living cells (adherent and suspension). View kit datasheet: www.abcam.com/ab14085
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,
RayBio Annexin V-FITC Apoptosis Detection Kit
RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
For the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE
SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE 45 CLINICAL CASES SERIAL DILUTION MULTIPLE PROTEIN CONCENTRATION QUANTITATIVE ASSAY PRODUCT NUMBER: PM1-001-N SOMAPLEX REVERSE
Intracellular (Total) ROS Activity Assay Kit (Red)
Intracellular (Total) ROS Activity Assay Kit (Red) Catalog Number KA2525 200 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General
PE Annexin V Apoptosis Detection Kit User Manual KT40001
PE Annexin V Apoptosis Detection Kit User Manual KT40001 For research use only. Not intended for diagnostic testing. a WuXi AppTec company www.abgent.com.cn PE Annexin-V Apoptosis Detection Kit Product
Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests
3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.
ab Annexin V- mfluor Blue 570 Detection
Version 1 Last updated 26 March 2018 ab219914 Annexin V- mfluor Blue 570 Detection Reagent For the rapid, sensitive and accurate measurement of PS exposure in live cells This product is for research use
ROS Activity Assay Kit
ROS Activity Assay Kit Catalog Number KA3841 200 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
Roadmap Practical 1. Oocytes collection
Roadmap Practical Oocytes collection Roadmap Practical Zebrafish (20 min) 2 groups of 4 trainees. Demonstration of sperm collection and then, retrieval of sperm by the trainees. 2. Demonstration of oocytes
SUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Muse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
The antibodies against 5-bromo-2 -deoxyuridine specifically recognize
Supplementary information for The antibodies against 5-bromo-2 -deoxyuridine specifically recognize trifluridine incorporated into DNA Hiroyuki Kitao *, Yosuke Morodomi, Shinichiro Niimi, Mamoru Kiniwa,
In vitro human regulatory T cell suppression assay
Human CD4 + CD25 + regulatory T cell isolation, in vitro suppression assay and analysis In vitro human regulatory T cell suppression assay Introduction Regulatory T (Treg) cells are a subpopulation of
INTRODUCTION. This material is quoted from below PDF and modified.
INTRODUCTION While drug response profiling of cancer cells in two-dimensional culture has been a mainstay of predictive biomarker discovery and anti-cancer drug development, there are aspects of tumor
ELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS
7 CHAPTER SEVEN ELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS 136 7.1 INTRODUCTION Breast cancer is one of the leading causes of death in women (Stephens et al., 2012). Several chemotherapeutic
Necroptosis-Inducing Rhenium(V) Oxo Complexes
Necroptosis-Inducing Rhenium(V) Oxo Complexes K. SUNTHARALINGAM, S.G. AWUAH, P.M. BRUNO, T.C. JOHNSTONE, F. WANG, W. LIN, Y.- R. ZHENG, J.E. PAGE, M.T. HEMANN, S.J. LIPPARD JACS ASAP 1 Celeste Alverez
Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
Assay Name: Transwell migration using DAPI
Assay Name: Transwell migration using DAPI Assay ID: Celigo_04_0001 Table of Contents Experiment: Identification of cells which have migrated through the membrane of a transwell insert....2 Celigo Setup...2
Annexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
Supporting Information
Supporting Information Vaira et al. 10.1073/pnas.0907676107 0h 24h 48h PTEN pathway Expression 0h 24h 48h Time MAP Kinase Signaling Pathway Expression 0h 24h 48h Time Collagen Expression Fig. S1. Differential
基醫所. The Cell Cycle. Chi-Wu Chiang, Ph.D. IMM, NCKU
基醫所 The Cell Cycle Chi-Wu Chiang, Ph.D. IMM, NCKU 1 1 Introduction to cell cycle and cell cycle checkpoints 2 2 Cell cycle A cell reproduces by performing an orderly sequence of events in which it duplicates
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
HDAC Activity/Inhibition Assay Kit (Fluorometric)
HDAC Activity/Inhibition Assay Kit (Fluorometric) Catalog Number KA0627 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background...
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit
7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit Catalog Number KA1293 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of
A simple and rapid flow cytometry-based assay to identify a competent embryo prior to embryo transfer.
A simple and rapid flow cytometry-based assay to identify a competent embryo prior to embryo transfer. Eva Pallinger 1, Zoltan Bognar 2,5,7, Jozsef Bodis 3,4,7, Timea Csabai 2,5,7, Nelli Farkas 6 Krisztina
ab CytoPainter Golgi/ER Staining Kit
ab139485 CytoPainter Golgi/ER Staining Kit Instructions for Use Designed to detect Golgi bodies and endoplasmic reticulum by microscopy This product is for research use only and is not intended for diagnostic
Annexin V APC Assay Kit
Annexin V APC Assay Kit Item No. 601410 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION 3 Materials
EVALUATION OF THE CHANGES RESULTING FROM TAMOXIFEN ADMINISTRATION. A COMBINED DNA FLOWCYTOMETRIC AND HISTOPATHOLOGICAL STUDY
EVALUATION OF THE CHANGES RESULTING FROM TAMOXIFEN ADMINISTRATION. A COMBINED DNA FLOWCYTOMETRIC AND HISTOPATHOLOGICAL STUDY Tamoxifen Tamoxifen is a non steroidal tiphenylethylene y first synthesized
Part II The Cell Cell Division, Chapter 2 Outline of class notes
Part II The Cell Cell Division, Chapter 2 Outline of class notes 1 Cellular Division Overview Types of Cell Division Chromosomal Number The Cell Cycle Mitoses Cancer Cells In Vitro Fertilization Infertility
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Institut für Medizinische Immunologie, Berliner Hochschulmedizin Charite, Charité Campus Mitte, Berlin, Germany
Flow Cytometric Methods Journal of Biological Regulators and Homeostatic Agents A protocol for combining proliferation, tetramer staining and intracellular cytokine detection for the flow-cytometric analysis
Multi-Parameter Apoptosis Assay Kit
Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
Summary. Introduction. Methods
Osteoarthritis and Cartilage (2001) 9, 664 670 2001 OsteoArthritis Research Society International 1063 4584/01/070664+07 $35.00/0 doi:10.1053/joca.2001.0463, available online at http://www.idealibrary.com
RayBio Annexin V-Cy5 Apoptosis Detection Kit
RayBio Annexin V-Cy5 Apoptosis Detection Kit User Manual Version 1.0 Mar 20, 2014 (Cat#: 68C5-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
BIOTARGET-1 SERUM-FREE MEDIUM
TECHNICAL INFORMATION BIOTARGET-1 SERUM-FREE MEDIUM Cat. No. 05-080-1 Introduction The BIOTARGET-1 formulation has been developed specifically for use with mononuclear cells (lymphocytes and monocytes)
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Applications of Flow Cytometry in Diagnostic Cytology of Body Cavity Fluids
Applications of Flow Cytometry in Diagnostic Cytology of Body Cavity Fluids Awtar Krishan, PhD. Professor, Department of Pathology University of Miami School of Medicine akrishan@med.miami.edu Beckman
CYTOTOXICITY AND APOPTOSIS ACTIVITIES OF WITHANIA SOMNIFERA AND TINOSPORA CORDIFOLIA EXTRACTS
3 CHAPTER THREE CYTOTOXICITY AND APOPTOSIS ACTIVITIES OF WITHANIA SOMNIFERA AND TINOSPORA CORDIFOLIA EXTRACTS 39 3.1 INTRODUCTION Various studies on breast cancer published from India reflect the disease
MB Research Labs. Local Lymph Node Assay using Flow Cytometric Endpoints. An Alternative to the Radioactive LLNA. Experience and Innovation
Local Lymph Node Assay using Flow Cytometric Endpoints Problem: Irritant or Irritating Sensitizer? The local lymph node assay (LLNA) is an alternative to the guinea pig sensitization test used to identify
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/2/12/e1601756/dc1 Supplementary Materials for Syrosingopine sensitizes cancer cells to killing by metformin Don Benjamin, Marco Colombi, Sravanth K. Hindupur, Charles
Computerized semen analysis. Product features. Basic system
AndroVision - more than CASA AndroVision CASA system with Zeiss AxioScope optics and automated ScanStage Computerized semen analysis AndroVision is a highly precise CASA* system for standardised, interactive
XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System
Application Note Normalization XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System Authors Yoonseok Kam Kellie Chadwick Ned Jastromb Brian P. Dranka Agilent Technologies,
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
EpiQuik HDAC Activity/Inhibition Assay Kit (Fluorometric)
EpiQuik HDAC Activity/Inhibition Assay Kit (Fluorometric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik HDAC Activity/Inhibition Assay Kit (Fluorometric) is very suitable for
Citation Acta Medica Nagasakiensia. 1992, 37
NAOSITE: Nagasaki University's Ac Title Author(s) A Study on the Expression of EGFR a Content in the Stomach Cancer Tissu Nakazaki Takayuki Citation Acta Medica Nagasakiensia. 1992 37 Issue Date 1992-12-25
Supplementary Figure 1
Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
Overview of methodology, tools and reagents for evaluating cell proliferation and invasion using multicellular tumor spheroids.
The Next Step in the Evolution of 3D Culture: Utilizing Extracellular Matrix to Enhance Multicellular Tumor Spheroid Models for Proliferation and Invasion Overview of methodology, tools and reagents for
RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
Concentration Estimation from Flow Cytometry Exosome Data Protocol
Concentration Estimation from Flow Cytometry Exosome Data Protocol 1. STANDARD CURVE Create a standard curve for the target exosome by plotting the mean fluorescence (y axis) against the protein concentration
Cancer preventive effects of lactic acid bacteria
TALAB Symposium 2007. 11. 9. National Taiwan Univ. Cancer preventive effects of lactic acid bacteria Hyong Joo Lee Seoul National University 1 Total deaths from cancer and heart disease J. Natl. Cancer
Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Cell Damage. Standardized and automatic determination of DNA double strand breaks using immunofluorescence
Standardized and automatic determination of DNA double strand breaks using immunofluorescence Patents: CN 2702421, EP 2208068, TR 201308237, 200880115751 The Platform Motorized, inverse fluorescence microscope
ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
International Conference on Biomedical and Biological Engineering (BBE 2016)
International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai
ANDROVISION - MORE THAN CASA
ANDROVISION - MORE THAN CASA AndroVision CASA system with Zeiss AxioScope optics and automated ScanStage Computerized semen analysis AndroVision is a highly precise CASA* system for standardised, interactive
ab Lysosome/Cytotoxicity Dual Staining Kit
ab133078 Lysosome/Cytotoxicity Dual Staining Kit Instructions for Use For studying lysosome function at the cellular level. This product is for research use only and is not intended for diagnostic use.
Supplementary tables and figure legends
Supplementary tables and figure legends Suzuki et al., Mitotic Reprogramming of Sperm, Supplementary Information, 5/7/16, page 1 Supplementary Figure 1 Characteristics of mouse preimplantation development
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines
In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology
Discovery And Development Of A Monoclonal Antibody Against A Novel Target For The Treatment Of Colorectal Cancer
1 Discovery And Development Of A Monoclonal Antibody Against A Novel Target For The Treatment Of Colorectal Cancer Philip M. Arlen, MD 16th Drug Discovery Summit and 3rd Discovery Chemistry & Drug Design
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Plate-Based Assay Methods for the Assessment of Cellular Health
Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule
Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
[Abstract] Objective: Investigate the effect of KLT on the expression of Fas/Apo-1, FasL and PCNA genes in renal carcinoma cell line (GRC-1).
![[Abstract] Objective: Investigate the effect of KLT on the expression of Fas/Apo-1, FasL and PCNA genes in renal carcinoma cell line (GRC-1).](/thumbs/90/104150076.jpg "[Abstract] Objective: Investigate the effect of KLT on the expression of Fas/Apo-1, FasL and PCNA genes in renal carcinoma cell line (GRC-1).")
Study on Effect of Kanglaite Injection(KLT) on the Expression of Fas/Apo-1, FasL and PCNA in Renal Carcinoma Cell Lines Wang Junjie, Sun Xinchen, Sheng Wenjiang, Yu Lizhang [Abstract] Objective: Investigate
BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
Annexin V-Cy3 Apoptosis Detection Reagent
ab14143 Annexin V-Cy3 Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples This product is for research use only and is not
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment
Supplementary Data for Kang et al. (Title) Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells by Regulating the Interaction of Tumor with its Immune Microenvironment Tae-Wook Kang 1,3,,
EPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Rapid antigen-specific T cell enrichment (Rapid ARTE)
Direct ex vivo characterization of human antigen-specific CD154+CD4+ T cell Rapid antigen-specific T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central role
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Annexin V-FITC Apoptosis Detection Kit with SYTOX
ab14086 Annexin V-FITC Apoptosis Detection Kit with SYTOX Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in living cells. This product is for research use only and
SUPPORTING INFORMATION
SUPPORTING INFORMATION SUPPLEMENTARY FIGURE LEGENDS Fig. S1. Separation of non-dissolved nanoparticles. Tests were conducted on the separation of non-dissolved nanoparticles added in excess to BEGM (A)
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'