Supplementary Materials for

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea Z. Lai, Sean Cory, Hong Zhao, Mathieu Gigoux, Anie Monast, Marie-Christine Guiot, Sidong Huang, Ali Tofigh, Crista Thompson, Monica Naujokas, Victoria A. Marcus, Nicholas Bertos, Bita Sehat, Rushika M. Perera, Emily S. Bell, Brent D. G. Page, Patrick T. Gunning, Lorenzo E. Ferri, Michael Hallett, Morag Park* The PDF file includes: *Corresponding author. morag.park@mcgill.ca Published 22 April 2014, Sci. Signal. 7, ra38 (2014) DOI: /scisignal Fig. S1. Met IHC staining ranges in intensity in gastroesophageal primary tumors and lymph node metastases. Fig. S2. Met inhibitor decreases the number of soft agar colonies. Fig. S3. HGF-induced IEGs decrease upon Met inhibition. Fig. S4. DUSP4 and DUSP6 are induced upon growth factor stimulation. Fig. S5. Late expression of genes after HGF stimulation and inhibition indicates proteins involved in the abrogation of cell proliferation. Fig. S6. FOXO3A expression and downstream genes are differentially regulated upon Met inhibition. Fig. S7. STAT3-targeted genes are differentially expressed in gastric cancer cell lines upon Met inhibition. Fig. S8. Not all MAPK pathways are dependent on Met kinase activity. Fig. S9. E2F1-targeted genes are differentially expressed in gastric cancer cell lines upon Met inhibition. Fig. S10. DUSP loss upon Met inhibition is MEK-dependent, and subsequent ERK reactivation promotes phosphorylation of downstream effectors. Fig. S11. Met inhibitors crizotinib and EMD recapitulate effects on signaling observed with. Fig. S12. Inhibition of STAT3 hinders cell proliferation. Fig. S13. STAT3 phosphorylation is dependent on Met kinase activity. Fig. S14. Met inhibition promotes variable cytotoxicity in gastric cancer cell lines. Table S1. MET amplification in primary gastric tumors.

2 SUPPLEMENTARY MATERIALS Figure S1 - Met IHC staining ranges in intensity in gastroesophageal primary tumors and lymph node metastases. (A) Representative images illustrating strong, medium, and weak Met IHC staining (40x magnification). (B) Quantification of Met positivity in tumors (n=31) illustrating the range of Met staining in each of the three categories. Horizontal bars represent means; error bars show distribution. (C) An example of a Met-negative sample in a signet ring cell carcinoma. (D) Met staining in a normal stomach tissue (10x magnification). (E) Percentage of Ki67 positive cells in tumors scored with high (3), medium (2) or low (1) Met IHC staining as determined by a pathologist. Horizontal bars denote the mean percentage; error bars show distribution. a.u., arbitrary units.

3 A # microscopic colonies * 0 untreated B Okajima MKN45 H 2 O Crizotinib Figure S2 - Met inhibitor decreases the number of soft agar colonies. (A) Quantification of soft agar colonies from 3 independent experiments. Means ± SEM are shown. * P < (B) Representative images of soft agar colonies formed by cells cultured in H 2 O or 0.1 µm Crizotinib.

4 Figure S3 - HGF-induced IEGs decrease upon Met inhibition. EGR1, FOS, FOSL1, IER3 expression upon 0.5 nm HGF stimulation (first column), 0.1µM treatment (second column), and EGF stimulation (third column) are plotted. Dashed lines represent the vehicle control. Log 2 expression values from 132 arrays are plotted. EGF-dependent expression data is re-plotted from (41).

5 Figure S4 - DUSP4 and DUSP6 are induced upon growth factor stimulation. (A) Expression of DUSP4 and DUSP6 upon 0.5 nm HGF (left column) and EGF (right column are plotted as log 2 expression values. EGFdependent expression data is re-plotted from (41). (B) Western blot of T47D 2A cells were stimulated with 0.5 nm HGF. (C) DUSP4 and DUSP6 protein upon HGF stimulation were quantified from 3 independent experiments. Data are means ± SEM from 3 independent experiments.

6 Figure S5 - Late expression of genes after HGF stimulation and inhibition indicates proteins involved in the abrogation of cell proliferation. (A) Heat map of genes that significantly change in expression upon HGF (0.5 nm) stimulation for 3 hours in T47D 2A cells is depicted on the left. The corresponding changes in expression of these genes upon (0.1 µm) treatment in the gastric cancer cell lines are shown in the heatmap on the right. h, hours; t, time. (B) Genes that are differentially expressed at 24 hours of HGF stimulation are shown in the left heatmap. As in (A), the corresponding changes in expression of these genes upon Met inhibition are shown in the right heatmap. (C) Of the genes whose expression is positively correlated between HGF and treatment at 24 hours [from (B)], the top 20 pathways enriched with the most genes as determined through Gene Ontology pathway analysis are plotted. (D) Schematic model illustrating the induction of immediate early genes (IEGs, < 1 hour), delayed early genes (DEGs, < 3 hours), and secondary response genes (SRGs, > 3 hours) upon HGF stimulation, and the loss of these in the absence of an activating Met signal.

7 Figure S6 - FOXO3A expression and downstream genes are differentially regulated upon Met inhibition. (A) FOXO3A gene expression increases in cell lines upon Met inhibition. Solid lines, -treated cells; dashed lines, controls. (B) Heat map illustrating differential expression of FOXO3A-regulated genes upon Met inhibition.

8 Figure S7 - STAT3-targeted genes are differentially expressed in gastric cancer cell lines upon Met inhibition. Heatmaps of differentially expressed STAT3 target genes upon Met inhibition in gastric cancer cell lines. Genes are from STAT3-targeted gene expression signatures obtained from (A) GM12878 and (B) HeLa cells in (54).

9 A C Okajima MKN45 pjnk / Jnk (ratio of t=0) Time(h) pmek Time (h) D p-p38 / p38 (ratio of t=0) Mek pmek Mek pmek Mek pmek Mek Time (h) Time(h) pjnk Figure S8 - Not all MAPK pathways are dependent on Met kinase activity. (A) Western blots of phosphorylated MEK (pmek) abundance upon inhibition of Met with 0.1 µm. (B) Western blots of components of other MAPK pathways upon treatment with 0.1µM. (C and D) Amount of (C) phosphorylated JNK (pjnk) at Thr 183 /Tyr 185 or (D) phosphorylated p38 (p-p38) at Thr 180 /Tyr 182 after addition of 0.1 µm. Data are means ± SEM from all 4 cell lines quantified from 3 independent experiments. B MKN45 Okajima Jnk p-p38mapk p38mapk pjnk Jnk p-p38mapk p38mapk pjnk Jnk p-p38mapk p38mapk pjnk Jnk p-p38mapk p38mapk

10 Figure S9 - E2F1-targeted genes are differentially expressed in gastric cancer cell lines upon Met inhibition. Heatmaps of differentially expressed E2F1-target genes upon Met inhibition in gastric cancer cell lines. Genes are from E2F1-targeted gene expression signatures obtained from (A) MCF7 and (B) HeLa cells in (54).

11 A D U0126 U h perk Erk Actin Crizotinib (24h) Selumetinib(2h) pmet Met pmek Mek perk Erk DUSP4 DUSP6 Actin B Fluorescence Intensity C Fluorescence Intensity EGFR HER2 EGFR HER2 E perk / Erk (ratio of H 2 O value) Met H 2 O Selumetinib HER3 FGFR1 FGFR3 FGFR4 InsR IGF-1R TrkA TrkB Ron Ret Met Crizotinib Selu / Criz Met HER3 FGFR1 FGFR3 FGFR4 InsR IGF-1R TrkA TrkB Ron Ret F DUSP/Actin (ratio of H 2 O value) ALK PDGFR c-kit FLT3 M-CSFR EphA1 EphA2 EphA3 Met ALK PDGFR c-kit FLT3 M-CSFR EphA1 EphA2 EphA3 H 2 O EphB1 EphB3 EphB4 Tyro-3 DUSP4 DUSP6 DUSP4 DUSP6 Crizotinib Axl Tie2 VEGFR2 EphB1 EphB3 EphB4 Tyro-3 Axl Tie2 VEGFR2 G 24h U0126 Sorafenib Tpl2i S + T U0126 Sorafenib Tpl2i S + T U0126 Sorafenib Tpl2i S + T U0126 Sorafenib Tpl2i S + T 2h p-p90rsk RSK1/2/3 ps6 (short exp) ps6 (long exp) S6 Figure S10 - DUSP loss upon Met inhibition is MEK-dependent, and subsequent ERK reactivation promotes phosphorylation of downstream effectors. (A) Western blot of phosphorylated ERK (perk; Thr 202 /Tyr 204 ) abundance in and cells after short-term treatment with, 20 µm U0126, or 0.1 µm. (B) Abundance of the specified phosphorylated RTKs in cells in the presence of or 0.1 µm -treated for 24 hours as determined with a phospho-rtk array. Images of the arrays are shown in the inset. (C) As described in (B) but with cells. (D) Western blot of components of the Met-ERK signaling pathway upon treatment with 0.1µM Crizotinib for 24h (where specified) followed by or 5 µm Selumetinib (2 hours). (E) Quantification of perk/erk in and cells (normalized to control H 2 O-treated samples) treated as described in (D). (F) Quantification of DUSP4 or DUSP6 abundance in cells treated with 0.1 µm Crizotinib normalized to matched H 2 O control values. Data in (E) and (F) are means ± SEM from 3 independent experiments. (G) Western blot of and cells treated with or 0.1 µm for 24 hours, followed by addition of, 20 µm U0126, 10 µm Sorafenib, 10 µm Tpl2 inhibitor, or a combination of Sorafenib and Tpl2 inhibitor (S + T) for 2 hours. h, hours.

12 Figure S11 Met inhibitors crizotinib and EMD recapitulate effects on signaling observed with. (A) Western blot of cells treated with H 2 O or 0.1µM Crizotinib for 2 or 24 hours (2h or 24h) and immunoblotted for signaling components downstream from Met. (B to D) Quantification of (B) phosphorylated Met (pmet; Tyr 1234/1235 ), (C) pakt (Ser 473 ), and (D) pstat3 (Tyr 705 ) against the corresponding whole protein abundance from Western blots of all 4 cell lines treated with Crizotinib or H 2 O as indicated, each from 3 independent experiments. (E) Ratio of perk (Thr 202 /Tyr 204 ) to ERK abundance in crizotinib (Criz)-treated cells normalized to that in H 2 O-treated cells. Data are means ± SEM from Western blots of all 4 cell lines each from 3 independent experiments. (F) Western blots of cells treated with or 0.1 µm EMD and immunoblotted for signaling proteins downstream from Met. (G to I) Quantification of (G) pmet, (H) pakt, and (I) pstat3 against the corresponding whole protein abundance from Western blots from 3 independent experiments in which cells were treated with or EMD (J) Average perk/erk ratios, normalized to the corresponding value, in cells treated with either or EMD (EMD). Data are means ± SEM from 3 independent experiments. a.u., arbitrary units.

13 A Absorbance / SH454 Cell Proliferation BP S Okajima MKN45 Stattic B Okajima MKN45 BP1-102 C D 1.5 plko shrna1 shrna2 shrna3 shrna4 shrna5 E F G plko shrna1 shrna2 shrna3 shrna4 shrna5 pstat3 STAT3 Actin pstat3 STAT3 Actin Normalized to parental (a.u.) Normalized to parental (a.u.) STAT3/Actin STAT3/Actin *** **** pstat3/actin Parental plko shrna1 shrna2 shrna3 shrna4 shrna5 pstat3/actin Parental plko shrna1 shrna2 shrna3 shrna4 shrna5 % Confluence plko shrna1 shrna2 shrna3 shrna4 shrna Time (h) ** *** **** H I J plko shrna1 shrna2 shrna3 shrna4 shrna5 MKN45 pstat3 STAT3 Actin Normalized to parental (a.u.) 1.5 MKN STAT3/Actin pstat3/actin 4 MKN Figure S12 - Inhibition of STAT3 hinders cell proliferation. (A) Proliferation of cells cultured for 5 days in, 20 µm SH454, 30 µm BP-1-102, 200 µm S31-201, 5 µm Stattic, or 0.1 µm. Proliferation was determined with an MTS assay and normalized to the -treated control. (B) Representative images of soft agar colonies formed by cells cultured in or 30 µm BP (C) Western blot of cells stably expressing STAT3 shrna or plko control vector. (D) Quantification of STAT3 and pstat3 amounts from samples from (C). (E) Western blot of cells stably expressing STAT3 shrna or plko control vector. (F) Quantification of whole and phosphorylated (p) STAT3 protein abundance from blots in (E). (G) Cell proliferation of II cells stably expressing one of five different shrna to STAT3 or a control vector (plko). (H to J) Western blots, quantification, and growth curves as described for (E-G) but with MKN45 cells. All plotted data (in A, D, F, G, I, and J) are means ± SEM from 3 biological replicates. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < a.u., arbitrary units. Parental plko shrna1 shrna2 shrna3 shrna4 shrna5 % Confluence plko shrna1 shrna2 shrna3 shrna4 shrna5 Time (h) * ****

14 Figure S13 STAT3 phosphorylation is dependent on Met kinase activity. (A) Western blot of cells treated with 0.1 µm Ruxolitinib (Rux), 0.1 µm or vehicle control for 2 hours. (B) Western blot analysis of cells were treated with 10 µm PP2, 0.1 µm Dasatinib, 4 µm Imatinib, or 0.1 µm for 2 hours. Representative western blots from three independent experiments are shown.

15 Figure S14 - Met inhibition promotes variable cytotoxicity in gastric cancer cell lines (A) Cell viability in gastric cancer cell lines cultured for up to 7 days in vehicle control or 0.1 M, ascertained using the Trypan Blue dye exclusion assay. Data are mean cell viability ± SEM from 3 independent biological replicates. a.u., arbitrary units. (B) Western blot showing the amount of cleaved PARP in gastric cancer cells after treatment with or 0.1 M. (C) Volume of established tumors after treatment with control solvent or Crizotinib (30 mg/kg) for up to 15 days. Data are means ± SEM from 20 tumors for each condition. * P < 0.05, *** P < 0.001, **** P <

16 Table S1. MET amplification in primary gastric tumors Tumors are from patients diagnosed with gastric cancer and treated with chemotherapy prior to surgical resection. Met IHC and FISH scores were determined by pathologists. Shaded area indicates tumors that were not assessed for MET copy number with FISH. Sample Tissue Type Met IHC score (TMA) MET qpcr (fold) MET FISH (copy number) 27 Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor Tumor

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors CORRECTION NOTICE Nat. Med. 22, 194 21 (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF- 02341066 Assay IC 50 nm Selectivity Ratio d Biochemical Activity In Vitro c-met/hgfr enzyme (Ki, nm) a 4 NA Cellular Activity

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

Mechanisms of resistance to JAK inhibitors. L. Knoops

Mechanisms of resistance to JAK inhibitors. L. Knoops Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Supplementary information

Supplementary information Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,

More information

Nature Structural & Molecular Biology: doi: /nsmb.3218

Nature Structural & Molecular Biology: doi: /nsmb.3218 Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted

More information

Leucine Deprivation Reveals a Targetable Liability

Leucine Deprivation Reveals a Targetable Liability Cancer Cell, 19 Supplemental Information Defective Regulation of Autophagy upon Leucine Deprivation Reveals a Targetable Liability of Human Melanoma Cells In Vitro and In Vivo Joon-Ho Sheen, Roberto Zoncu,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental

More information

K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF

K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)

More information

Figure S1 A. MGH092-1 (Biopsy) MGH092-1B (Cell Line)

Figure S1 A. MGH092-1 (Biopsy) MGH092-1B (Cell Line) a/f3 G1del ell viability (% control) a/f3 G1R ell viability (% control) Figure S1 MGH9-1 (iopsy) MGH9-1 (ell Line) G1del LK G1del (c.33_35delggg) Reference MGH9-1 D 5 rizotinib I 5 = 5. nm eritinb I 5

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular

Supplementary material. VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Supplementary material VAMP7 controls T cell activation by regulating recruitment and phosphorylation of vesicular Lat to the TCR activation sites. Paola Larghi, David J Williamson, Jean-Marie Carpier,

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28 A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

WHY TARGETTING SIGNALLING PATHWAYS?

WHY TARGETTING SIGNALLING PATHWAYS? WHY TARGETTING SIGNALLING PATHWAYS? Cancer cells are particularly sensitive to stress therefore sensitive to inhibition of their hyper activated signaling proteins the re instatement of lost tumor suppressors.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Nature Medicine: doi: /nm.4078

Nature Medicine: doi: /nm.4078 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000 Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.

More information

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

I. Diagnosis of the cancer type in CUP

I. Diagnosis of the cancer type in CUP Latest Research: USA I. Diagnosis of the cancer type in CUP II. Outcomes of site-specific therapy of the cancer type in CUP a. Prospective clinical trial b. Retrospective clinical trials 1 Latest Research:

More information

* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells

* * * * Supplementary Figure 1. DS Lv CK HSA CK HSA. CK Col-3. CK Col-3. See overleaf for figure legend. Cancer cells Supplementary Figure 1 Cancer cells Desmoplastic stroma Hepatocytes Pre-existing sinusoidal blood vessel New blood vessel a Normal liver b Desmoplastic HGP c Pushing HGP d Replacement HGP e f g h i DS

More information

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

MAPK Pathway

MAPK Pathway MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer

Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Kevin Staveley-O Carroll, PhD, MD, FACS Professor and Chair, Department of Surgery Director of the Ellis Fischel Cancer

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk

Figure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells. Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Kaul 1. Kaul et al _Inventory of Supplemental Materials. Supplemental Figures and Figure Legends. Figure S1, related to Figure 1

Kaul 1. Kaul et al _Inventory of Supplemental Materials. Supplemental Figures and Figure Legends. Figure S1, related to Figure 1 Kaul 1 Kaul et al _Inventory of Supplemental Materials Supplemental Figures and Figure Legends Figure S1, related to Figure 1 Figure S2, related to Figure 2 Figure S3, related to Figure 3 Figure S4, related

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Information S3 TAM- family small molecule kinase inhibitors in development Compound Indication(s) Target Profile Develop Primary Target MERTK TYRO3 Other targets ment Phase Refs Cabozantinib

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection

More information

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20% Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Combined γ- Tocotrienol and Met Inhibitor Treatment Suppresses Mammary Cancer Cell Prolifera;on, Epithelial- to- Mesenchymal Transi;on, and Migra;on

Combined γ- Tocotrienol and Met Inhibitor Treatment Suppresses Mammary Cancer Cell Prolifera;on, Epithelial- to- Mesenchymal Transi;on, and Migra;on Combined γ Tocotrienol and Met Inhibitor Treatment Suppresses Mammary Cancer Cell Prolifera;on, Epithelial to Mesenchymal Transi;on, and Migra;on Paul W. Sylvester, Ph.D. Pfizer Endowed Professor of Pharmacy

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Expanded View Figures

Expanded View Figures Molecular Systems iology Immediate late genes decode ERK signal duration Florian Uhlitz et al Expanded View Figures Figure EV. cquired samples from HEK9ΔRF:ER cells. Microarrays - Untreated I +U6-5 6 7

More information

Bio-Plex Pro Cell Signaling Assays

Bio-Plex Pro Cell Signaling Assays Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

NIH Public Access Author Manuscript Clin Cancer Res. Author manuscript; available in PMC 2015 December 01.

NIH Public Access Author Manuscript Clin Cancer Res. Author manuscript; available in PMC 2015 December 01. NIH Public Access Author Manuscript Published in final edited form as: Clin Cancer Res. 2014 December 1; 20(23): 5866 5868. doi:10.1158/1078-0432.ccr-14-1543. p38 MAPK in Pancreatic Cancer: Finding a Protective

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,

More information

Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.

Supplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice. Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1 a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells

Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Author's response to reviews Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Authors: Ingvild J Brusevold (i.j.brusevold@medisin.uio.no) Ingun H Tveteraas

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information