Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors"

Transcription

1 CORRECTION NOTICE Nat. Med. 22, (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin Hsu, Wan-Chi Lin, Wen-Hsuan Yu, Paul G Leonard, Gilbert R Lee IV, Mei-Kuang Chen, Katsuya Nakai, Ming-Chuan Hsu, Chun-Te Chen, Ye Sun, Yun Wu, Wei-Chao Chang, Wen-Chien Huang, Chien-Liang Liu, Yuan-Ching Chang, Chung-Hsuan Chen, Morag Park, Philip Jones, Gabriel N Hortobagyi & Mien-Chie Hung In the version of this article initially published, the concentrations of H 2 O 2 were incorrectly labeled as micromolar (μm) instead of millimolar (mm) in the legends of Supplementary Figures 3, 8f h, 1g,j and 12c,d. The error has been corrected in this file as of 25 August 216.

2 Supplementary Information Journal: Nature Medicine Article Title: Corresponding Author: Blocking -mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Mien-Chie Hung Supplementary Item & Number Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Title or Caption Correlation between 8-OHdG, TNBC, and non-tnbc subtype in human breast cancer tissues -associated receptor tyrosine kinases identified by an antibody array Correlation between py97- and in human triple-negative breast cancer tissues The levels of 8-OHdG (a marker of oxidative DNA damage) and DCF (an ROS marker) are higher in TNBC. TCGA database analysis of ERBB3, MET, and FLT3 associates with Downregulation of sensitizes cells to PARP inhibitors and reduces ROS Overexpression of increases the resistance of cells to PARP inhibitors is important for PARP inhibitor response is involved in DNA damage response Supplementary Figure 8 mediates phosphorylation of at Y97 contributing PARP inhibitor response. Supplementary Figure 9 Clinical correlation of py97 in human breast cancer tumor tissues Supplementary Figure 1 Synergistic effect of combination treatment of PARP and c- Met inhibitors Supplementary Figure 11 Inhibiting tumor growth and evaluating clinical chemistry or body weight of combination treatment of PARP and inhibitors Supplementary Figure 12 Synergistic effect of the combination treatment of PARP and inhibitors in -expressing breast cancer and NSCLC cells Nature Medicine: doi:1.138/nm

3 Supplementary Table 1. Correlation between 8-OHdG, TNBC, and non-tnbc subtype in human breast cancer tissues. 8-OHdG Low High Total Non-TNBC TNBC Total P =.1 Correlation analysis was performed using the Pearson chi-square test. A P value <.5 was considered statistically significant. Supplementary Table 2. -associated receptor tyrosine kinases identified by an antibody array. Density OD/mm 2 Kinases Sodium Arsenite Control Ratio ErbB HGFR () Flt VEGFR EphB EGFR ErbB ALK DDR Mer TrkC EphA VEGFR EphB DDR InR Tie EphB RYK EphA EphA FGFR M-CSFR c-ret ROR MuSK FGFR2a EphA Nature Medicine: doi:1.138/nm

4 FGFR PDGFRb EphA EphA Axl FGFR ROR Tie EphA Dtk IGF-IR Note: the number in the two middle columns is the intensity of the targeted molecules on the antibody array membrane. The ratio indicates the fold change between the sodium arsenite treatment group and non-treatment group. Supplementary Table 3. Correlation between py97- and in human triplenegative breast cancer tissues. py97- Low High Total Low High Total P =.21 Correlation analysis was performed using the Pearson chi-square test. A P value <.5 was considered statistically significant. Nature Medicine: doi:1.138/nm

5 DIC Non-TNBC DCF DIC TNBC DCF 8-OHdG 8-OHdG 8-OHdG Absorbance of DCF (X 1 4 ) a HCC1937 HCC7 BT2 Basal-like -468 SUM149 HCC38 HCC186 c BT549 Hs578T Mesenchymal LAR TNBC Non- TNBC SKBr3 HER2 ER HER2/ ER KPL4 SUM19 MCF-7 T47D ZR751 BT b Basal-like Mesenchymal LAR HCC1937 HCC7 BT2-468 SUM149 HCC38 HCC186 BT549 Hs578T HER2 ER HER2/ ER AU565 SKBr3 KPL4 SUM19 MCF T47D ZR751 BT Supplementary Figure 1. The levels of 8-OHdG (a marker of oxidative DNA damage) and DCF (an ROS marker) are higher in TNBC. (a) Breast cancer cell lines were stained with 8- OHdG antibody, and immunofluorescence signals were screened using a fluorescence microscope. Fluorescence intensity was measured by AxioVision software. Red fluorescent signals represent 8-OHdG. DAPI, blue. Bar, 2 µm. Images are representative of triplicate experiments. (b) DCF signals and differential interference contrast (DIC) images of breast cancer cell lines. Breast cancer cells were incubated with 1 μm 2',7'-dichlorofluorescin diacetate (DCFDA) for 3 min. Fluorescence signals were screened by a fluorescence microscope. Nature Medicine: doi:1.138/nm

6 Fluorescence intensity was measured by AxioVision software. Green fluorescent signals represent DCF. Bar, 1 µm. Images are representative of triplicate experiments. (c) Breast cancer cells (4 x 1 3 ) were seeded onto 96-well plates and treated with 1 μm of DCFDA for 3 min. DCF was measured using a plate reader and analyzed with GraphPad Prism software. Quantitation of triplicate experiments is shown. P <.5, t-test. LAR, luminal androgen receptor. Nature Medicine: doi:1.138/nm

7 HCC1937 HCC7 BT2-468 SUM149 HCC38 HCC186 BT549 Hs578T AU565 SKBr3 KPL4 SUM19 MCF T47D ZR751 BT Breast invasive carcinoma TCGA, n = 15 ERBB3 FLT3 MET ERBB2 ESR1 PGR Log transform median-centered ratio ERBB3 FLT3 MET ERBB2 ESR1 PGR a b TCGA, n = Gene c TNBC Basal-like Mesenchymal LAR Ctrl Non-TNBC HER2 ER HER2/ ER Supplementary Figure 2. TCGA database analysis of ERBB3, MET, and FLT3. (a) Cluster analysis of ERBB3, MET, and FLT3 mrna expression from the TCGA breast invasive carcinoma patient cohort (n = 15). Hierarchical clustering analysis of ERBB3, MET and FLT3 distinguished TNBC from other human breast tumors (n = 15). Breast cancer patients were categorized by mrna subtype as non-tnbc patients (n = 819) and TNBC patients (n = 231) according to expression of ERBB2, ESR1, and PGR (encoding HER2, ER, and PR, respectively). The color scale ranges from saturated green for log ratios of 4. and below to saturated red for log ratios of 4. and above. Red represents high gene expression (> 4), and green represents low Nature Medicine: doi:1.138/nm.432 4

8 gene expression (< 4). (b) Box plot generated from original and log2-transformed mrna expression levels of TNBC-related kinases in TNBC patients and non-tnbc patients by ESR1, PGR, and ERBB2 mrna subtyping. (c) Expression of in a panel of breast cancer cell lines. Cell lysates were subjected to Western blot analysis with indicated antibodies. LAR, luminal androgen receptor. P <.5, t-test. Nature Medicine: doi:1.138/nm

9 a b IP: IgG Flag Input H 2 O 2 Flag- WB V5- IgG WB IP: Input V5 IgG H 2 O 2 Flag- V5- IgG c IP IgG WB H 2 O 2 IgG Input - + H 2 O 2 d IP IgG H 2 O 2 WB IgG Input - + H 2 O 2 e IP IgG Flag H 2 O 2 WB Flag IgG Input - + H 2 O 2 Flag g As H 2 O 2 Control h Nucleus Merge Inset Cytoplasmic Ctrl As H 2 O 2 3 Nuclear 1 2 Ctrl As H 2 O 2 Nuclear (%) Lamin B Calregulin Nuclear (%) i Cyto Nuclear f WB IP IgG Flag H 2 O 2 Flag IgG Control Dyn A Dyn B shrna H 2 O 2 Lamin B Calregulin Dynein IC Lamin B Calregulin j Cyto Nuclear Input - + H 2 O 2 Flag Syn6 pcdna-6a Control Syn6 Syn6 shrna H 2 O 2 Lamin B Calregulin Syn 6 Lamin B Calregulin Supplementary Figure 3. associates with. (a,b) HEK293T cells were transfected with V5- and Flag- and then treated with 1 mm H 2 O 2 for 15 min. The association of and was detected by immunoprecipitation (IP)/Western blot. (c) -231 cells were treated with 2 mm H 2 O 2 for 3 min. The association of and was detected by IP/Western blot. (d) HCC1937 cells were treated with 2 mm H 2 O 2 for 3 min. The association of and was detected by IP/Western blot. (e,f) -436 and MCF-7 cells were transfected with Flag- and then treated with 2 mm H 2 O 2 for 3 min. The association of and was detected by IP/Western blot. (g,h) -231 cells were treated with 2 mm H 2 O 2 for 3 min and 5 µm sodium arsenite (As) for 18 h. Cells were Nature Medicine: doi:1.138/nm

10 subjected to confocal imaging assays and the cellular fractionation assay followed by Western blot analysis of the lysates. The percentage of nuclear (intensity based on confocal images is shown on the right. The percentage of nuclear (normalized to loading control, intensity based on Western blot) is shown below. (i) HeLa cells with or shrnas (Dyn A and Dyn B) of dynein intermediate chains (IC) were treated with H 2 O 2. Cells were subjected to cellular fractionation followed by Western blot with indicated antibodies. (j) HeLa cells expressing syntaxin 6 shrna (3 UTR) and re-expression of syntaxin 6 were treated with H 2 O 2, then subjected to cellular fractionation followed by Western blot with indicated antibodies. Syn 6, syntaxin 6. Nature Medicine: doi:1.138/nm

11 Intensity of DCF shmet-c Absorbance (%) HCC1937 Colony number (%) IC 5 (um, AZD2281) Soft agar cell growth Intensity of DCF -231 Normalized viability (%) Colony numbers (%) IC 5 (um, AG14699) Soft agar cell growth Colony numbers (%) IC 5 (um, ABT-888) Soft agar cell growth Normalized viability (%) IC 5 (um, AZD2281) Normalized viability (%) IC 5 (um, AG14699) Cell viability d e h a 1 IC 5 (um, ABT-888)2 AG14699 (μm) b (μm) Cri Ft shmet-a shmet-b Control AZD2281 (μm) AZD2281 (μm) Cri (.1 μm) Ft (.1 μm) DMSO Cri,.1 μm Ft,.1 μm ABT-888 (mm) g f shmet-a shmet-b shmet-a shmet-b shmet-a shmet-b i ABT-888 (μm) AG14699 (μm) plko control shmet-1 shmet c HCC shmet-a shmet-b AG14699 (μm) shmet-a shmet-b ABT-888 (mm) shmet-a shmet-b AG14699 (µm) j μm 1 μm 4 μm Cri Ft Cri Ft HCC k AG14699 (µm) ABT-888 (mm) shmet-c (Wt) (KD) ABT-888 (mm) shmet-c (Wt) (KD) Supplementary Figure 4. Downregulation of sensitizes cells to PARP inhibitors and reduces ROS. (a) -knockdown cells were treated with PARP inhibitor ABT-888 and Nature Medicine: doi:1.138/nm

12 subjected to cell viability assay. Median inhibitory concentration (IC 5 ) of ABT-888 in MDA- MB-231 cells with knockdown by cell viability assay. (b,c) -knockdown cells were treated with PARP inhibitors AZD2281 and AG14699, and subjected to cell viability assay. IC 5 of AZD2281 is shown on the right. Error bars represent s.d. (d) -231 cells were treated with AG14699 and crizotinib or foretinib and subjected to clonogenic cell survival assay. Representative images of three independent experiments are shown. (e) -231 cells were treated with ABT-888 and crizotinib or foretinib and subjected to cell viability assay. Error bars represent s.d. (f h) -knockdown cells were treated with PARP inhibitors ABT-888, AG14699, or AZD2281, and subjected to soft agar colony formation assay to determine anchorage-independent cell growth. Representative images and IC 5 of inhibitors are shown. (i) -knockdown -231 and HCC1937 cells by plko shrnas were incubated with 1 μm of DCFDA for 3 min. DCF level was then measured using a plate reader with spectra of 495EX nm/529em nm. Error bars represent s.d. (j) -231 and HCC1937 cells were pretreated with inhibitor crizotinib or foretinib for 1 h. Cells were then treated with 1 μm of 2,7 -dichlorofluorescin diacetate (DCFDA) for 3 min. DCF level was measured using a plate reader with spectra of 495EX nm/529em nm. (k) -knockdown (3 UTR) -231 cells re-expressing wild-type (Wt) or kinase dead (KD) were treated with ABT-888 or AG14699 and subjected to clonogenic cell survival assay. Representative images are shown. ABT, ABT-888; Cri, crizotinib; Ft, foretinib. Error bars represent s.d. P <.5, ranova. Nature Medicine: doi:1.138/nm

13 Relative absorbance (%) Colony numbers (%) Colony numbers (%) MCF-7 MCF-7 ABT (mm) MCF-7 MCF-7 Normalized viability (%) Normalized viability (%) Normalized viability (%) a d ABT-888 (mm) b e AG14699 (μm) AG14699 (μm) c f AZD2281 (mm) ABT-888 (mm) ABT-888 (mm) AG14699 (μm) ABT-888 (mm) Supplementary Figure 5. Overexpression of increases the resistance of cells to PARP inhibitors. (a c) -overexpressing MCF-7 cells were treated with PARP inhibitor ABT-888, AG14699, or AZD2281 and subjected to cell viability assay. (d) -overexpressing or control MCF-7 cells were treated with ABT-888 or AG14699 and subjected to clonogenic cell survival assay. Representative images are shown. (e,f) -overexpressing or control MCF-7 cells were treated with ABT-888 or AG14699 and subjected to soft agar colony formation assay to determine anchorage independent cell growth. Representative images are shown. AG, AG Error bars represent s.d. P <.5, ranova. Nature Medicine: doi:1.138/nm

14 Normalized viability (%) Relative absorbance (%) Relative absorbance (%) Normalized viability (%) Normalized viability (%) Normalized viability (%) IC 5 (ABT-888, µm) IC 5 (AG14699, µm) Normalized viability (%) IC 5 (ABT-888, µm) IC 5 (AG14699, µm) a b shmet-a shmet-b ABT -888 (µm) c d (Wt) (KD) ABT -888 (µm) e BRCA1 BRCA2 Actin f BRCA1 BRCA2 Actin g 12 8 shbrca1-a shbrca1-c shbrca2-b shbrca2-c h BRCA1 i 12 8 shbrca1-a shbrca1-c shbrca2-b shbrca2-c 4 4 n.s. j ABT-888 (mm) shbrca1-a shbrca1-c shbrca2-b shbrca2-c n.s. k BRCA2 shbrca1-a shbrca1-c shbrca2-b shbrca2-c n.s. l AG14699 (μm) shbrca1-a shbrca1-c shbrca2-b shbrca2-c n.s ABT-888 (μm) AG14699 (μm) ABT-888 (mm) Supplementary Figure 6. is important for PARP inhibitor response. (a) HCC1937 cells with knockdown were treated with PARP inhibitor AG14699 and subjected to cell viability assay. IC 5 of AG14699 in -knockdown HCC1937 by cell viability assay is shown. (b) HCC1937 cells with knockdown were treated with PARP inhibitor ABT-888 Nature Medicine: doi:1.138/nm

15 and subjected to cell viability assay. IC 5 of ABT-888 in HCC1937 cells is shown on the right. (c) -436 cells expressing wild-type (Wt), kinase dead (KD), or control vector were treated with AG14699 and subjected to cell viability assay. IC 5 of AG14699 in MDA- MB-436 with ectopic expression by cell viability assay is shown. (d) -436 cells expressing wild-type (Wt), kinase dead (KD), or control vector were treated with ABT-888 and subjected to cell viability assay. IC 5 of ABT-888 in -436 is shown on the right. (e,f) -knockdown -231 and -expressing -436 were subjected to Western blot with indicated antibodies. (g) BRCA1- or BRCA2-knockdown MDA- MB-157 cells were treated with ABT-888 and subjected to cell viability assay. (h) BRCA1 and BRCA2 expression in -231 BRCA1- or BRCA2-knockdown cells. (i l) BRCA1- or BRCA2-knockdown cells were treated with ABT-888 and AG114699, then subjected to cell viability assay or clonogenic cell survival assay. Error bars represent s.d. P <.5, ranova. n.s., not significant. Nature Medicine: doi:1.138/nm

16 DNA in the tail (%) DNA in the tail (%) γ-h2ax/ Nuclei DNA in the tail (%) DNA in the tail (%) a H 2 O 2 min 1 min shmet-a shmet-b d c shmet-a shmet-b 1 -Wt 75 -KD min 1 min e 1 75 b Cri shctrl shmet-a shmet-b Untreat H/A min 3 min 6 min only Recovery time after Hu/ Arac and H 2 O 2 treatment f Control ABT Actin Control H 2 O 2 Control H 2 O 2 Supplementary Figure 7. is involved in DNA damage response. (a) knockdown and control -231 cells were treated with H 2 O 2 for the indicated time and incubated with formanidopyrimidine DNA glycosylase (Fpg). DNA damage was assessed by comet assay. Representative images are shown. Quantification of DNA damage is shown on the right. (b) c- Met knockdown and control -231 cells were treated with H 2 O 2 and DNA repair hydroxyurea/cytosine-β-arabinofuranoside (Hu/AraC) to induce and allow DNA damage to accumulate. Hu/Arac and H 2 O 2 were replaced by fresh media, and cells were incubated for the indicated times. Damaged DNA was assessed by comet assay. Cells were incubated with formanidopyrimidine DNA glycosylase (Fpg) prior to a comet assay to evaluate the damaged DNA. Quantification of the levels of DNA damage is shown. (c) Western blot analysis of wild-type (Wt) and kinase dead (KD) mutant expression. (d) -overexpressing and control MCF-7 cells were treated with H 2 O 2 for the indicated times. Cells were incubated with Fpg prior to a comet assay to evaluate the damaged DNA. Quantitation of the damaged DNA is shown. (e) -overexpressing MCF-7 cells were treated with H 2 O 2 or with H 2 O 2 and pretreatment with Nature Medicine: doi:1.138/nm

17 crizotinib for 1h. Cells were incubated with Fpg prior to a comet assay to evaluate the damaged DNA. Quantification of DNA damage from experiments in triplicate is shown. (f) overexpressing and control MCF-7 cells were treated with PARP inhibitor ABT-888 (5 µm) for 18 h. γ-h2ax was detected by immunofluorescence confocal microscopy. Green fluorescence signals indicate γ-h2ax. Bar, 2 µm. Images are representative of triplicate experiments. H/A, Hu/AraC; Cri, crizotinib. Error bars represent s.d. P <.5, t-test. Nature Medicine: doi:1.138/nm.432 5

18 Viability (%) Viability (%) Viability %) Viability (%) ΔH (kj/ mol) ΔH (kj/ mol) ΔH (kj/ mol) Heat Rate (µj/ s) Heat Rate (µj/ s) Heat Rate (µj/ s) sh ABT-888 (µm) Activity (%) % of activity Coomassie blue a Wt 97F 986F b c GST- Wt 97F 986F γ-p32 GST μg py97 hot Y97 cold e sh + + H 2 O 2 py97- py1234- Calregulin f Wt Y97F + + H 2 O 2 py97- py1234- Actin d Dapi py97 Merge py peptide g H 2 O 2 S L py97- py1234- h L o g M B T ) Log μm (ABT-888) Wt Wt F E WtW t - H 2O 2 O 22 Wt W t + H 2O 2 O 2 Y97F Y 9 7 F Y97E Y 9 7 E i l j Time (s) 2, 4, Kd = nm 2 4 [ABT-888]/ [-Wt] Actin Time (s) 2, 4, plko sh-3 UTR -Wt -97F -97E shctrl-pgipz shmet-c 12 Kd = nm [ABT-888]/ [-Y97F] k Wt Y97F Y97E Time (s) H 2 O Y97-1, 3, Kd = nm [ABT-888]/ [-Y97E] ABT-888 (mm) shmet-c shmet-c Wt Y97F Y97E ABT-888 (mm) Wt 97F 97E AG14699 (µm) 4 Wt 97F 97E AG14699 (µm) 51 Nature Medicine: doi:1.138/nm.432

19 Supplementary Figure 8. mediates phosphorylation of at Y97 contributing PARP inhibitor response. (a) Coomassie blue staining of GST fusion wild-type and Y97F and Y986F mutants. (b) GST fusion wild-type and Y97F and Y986F mutants were incubated with [γ- 32 P]-ATP and purified. Radiolabeled ATP in was visualized by autoradiography. Total GST was visualized by Western blot. (c) A dot blot assay was used to evaluate the specific antibody against phosphorylated Y97 (py97) of. (d,e) Characterization of anti-py97- antibody in -knockdown MDA- MB-231 cells by confocal microscopy and Western blot analysis. Bar, 2 µm. (f) - knockdown -231 cells re-expressing wild-type or Y97F were treated with 2 mm H 2 O 2 for 3 min and subjected to Western blot analysis with indicated antibodies. (g) knockdown -231 cells were treated with 2 mm H 2 O 2 for 3 min and subjected to Western blot analysis with indicated antibodies. (h) -knockdown -231 cells reexpressing wild-type, Y97F, or Y97E were treated with 2 mm H 2 O 2 for 3 min. Cell lysates were subjected to PARP enzyme activity assay. IC 5 of wild type and Y97- mutants to ABT-888 by PARP enzyme activity assay. (i) In vitro binding ability of wild type and Y97- mutants to ABT-888 was measured by ITC assay. K d values are shown in the plots. (j) Western blot showing the expression of and in cells re-expressing wild-type or mutant with and without -knockdown. (k,l) Cells described in (j) were treated with PARP inhibitor ABT-888 (k) or AG14699 (l) and subjected to cell viability assay. Wt, wild-type. Error bars represent s.d. P <.5, ranova. Nature Medicine: doi:1.138/nm

20 a No peptide Phosphopeptide Non-phospho- Peptide Non-specific phospho-peptide b py97- c py97 8-OHdG Case 1 High Case 1 High Case 2 Low Case 2 Low py97- Low High Total Low High P < OHdG Low High Total py97 Low py97 High p = Supplementary Figure 9. Clinical correlation of py97 in human breast cancer tumor tissues. (a) A peptide competition assay was carried out to characterize py97- antibody by IHC staining of breast cancer patient tumor tissues. (b) Correlation analysis between and py97- in human non-tnbc tissue microarray. P <.1, Pearson chi-square test. (c) Correlation analysis between 8-OHdG and py97- in human TNBC tissue microarray. P =.19, Pearson chi-square test. Representative images of IHC staining for positive and negative cases are shown for (b) and (c). Nature Medicine: doi:1.138/nm

21 Combination index (CI) Combination index (CI) / 6.25/ /.5 25/ 1 5/ 2 Absorbance (%) CI =.55 CI =.2 CI =.52 CI =.34 Combination index (CI) AG/ Cri Combination Index (CI) Cri AG Ctrl a 2. b AG (μm) c AG (μm) d HCC MDA- 1937MB Cri (μm) Cri (μm) e g MCF-1A AG-Cri MCF-1A ABT-Ft Fraction affected (Fa) ABT (μm) Ft (μm) 6.25/ 12.5/ 25/ 5/ ABT Ft Combination Index (CI) py97- py1234- h / 15/ 3/ 6/ AG/ Cri Combination Index (CI) A134 AG-Cri A134 ABT-Ft ABT (μm) Fraction affected (Fa) i Ft (μm) 3.75/ 7.5/ 15/ 3/ AG/ Cri Combination Index (CI) ABT/ Ft (μm) A1471 ABT-Ft A1471AG-Cri Fraction affected (Fa) f j Fraction affected (Fa) A134 BT549 AG-Cri BT549 ABT-Ft A1471 py97- py1234- Supplementary Figure 1. Synergistic effect of combination treatment of PARP and inhibitors. (a) MCF-1A cells were treated with combinations of PARP inhibitors (AG14699, ABT-888) and inhibitors (crizotinib, foretinib). (b,c) The synergistic effect of inhibitor crizotinib and PARP inhibitor AG14699 was measured by clonogenic cell survival assay following an 8-day treatment in -231 cells (b) and HCC1937 cells (c). Representative images of three independent experiments are shown. (d) The synergistic effect of crizotinib and AG14699 was measured by soft agar assay in -231 cells and HCC1937 cells. Representative images of three independent experiments are shown (e) MDA-B231 cells were treated with foretinib and ABT-888. The synergistic effect of foretinib and ABT-888 was Nature Medicine: doi:1.138/nm

22 measured by the clonogenic cell survival assay. Representative images and quantitation are shown. (f) BT549 cells were treated with PARP and inhibitors, and the synergistic effect of the combination treatment was measured by cell viability assay. (g) BT549 cells were treated with 2 mm H 2 O 2 for 3 min or with H 2 O 2 plus 2 µm crizotinib pre-treatment for 1 h, and cell lysates were subjected to Western blot analysis with the indicated antibodies. (h,i) Mouse breast cancer cells, A134 and A1471, were treated with PARP and inhibitors, and the synergistic effect of the combination treatment was measured by cell viability assay. (j) Mouse breast cancer cells, A134 and A1471, were treated with 2 mm H 2 O 2 for 3 min or with H 2 O 2 plus 2 µm crizotinib pre-treatment for 1 h, and cell lysates were subjected to Western blot analysis with the indicated antibodies. The synergistic effect was determined by calculating the combination index (CI) based on the Chou Talalay method. AG, AG14699; Cri, crizotinib; ABT, ABT-888; Ft, foretinib. Error bars represent s.d. Nature Medicine: doi:1.138/nm

23 Body weight (g) Blood Urea Nitrogen (BUN, mg/ dl) ALT (SGPT, U/ L) Body weight (g) γ-h2ax/ Nuclei Body weight (g) Blood Urea Nitrogen (BUN, mg/ dl) ALT (SGPT, U/ L) Control AG Cri AG/Cri ref Control AG Cri AG/Cri ref Control AG Cri AG/Cri ref Control AG Cri AG/Cri ref Blood Urea Nitrogen (BUN, mg/ dl) Creatinine (mg/ dl) AST (SGOT, U/ L) ALT (SGPT, U/ L) Day 15 Day 5 Tumor size (mm 3 ) Tumor size (mm 3 ) Day 21 Day 21 Day 7 Day 7 a Control AG Cri AG/ Cri 6 b Control ABT Ft ABT/ Ft (X1 4 ) (X1 4 ) e c Control AG Cri AG/ Cri Control AG f (X1 4 ).4 3, 2,4 1,8 1,2 6 Vehicle AG Cri AG-Cri Days after inoculation g 2 d Vehicle AG Cri AG/Cri Days after inoculation 12 Ki67/ Nuclei Tunel/ Nuclei Cri Control Cri Control AG/ Cri AG AG/ Cri AG h Before treatment 21 days after treatment Kidney function i Liver function Cri AG/ Cri j 4 Before treatment 16 days after treatment 3 k Kidney function l Liver function 3 Before treatment 12 days after treatment Kidney function Liver function 56 Nature Medicine: doi:1.138/nm.432

24 Supplementary Figure 11. Inhibiting tumor growth and evaluating clinical chemistry or body weight of combination treatment of PARP and inhibitors. (a,b) Representative IVIS imaging of nude mice bearing -231 tumors after AG14699/crizotinib and ABT- 888/foretinib treatment at the indicated days. (c) A134 cells were injected into the mammary fat pad of FVB mice on day. When the tumor volume reached ~5 mm 3, mice were orally administered crizotinib (5 mg/kg), AG14699 (5 mg/kg), or the combination 5 times per week for 28 days. Representative IVIS imaging of FVB mice bearing A134 tumors on days 7 and 21 after treatment. Tumor volume was measured at the indicated time points. (d) HCC1937 cells were injected into the mammary fat pad of nude mice on day. When the tumor volume reached ~5 mm 3, mice were orally administered crizotinib (5 mg/kg), AG14699 (5 mg/kg), or the combination 5 time per week for 18 days. Tumor volume was measured at the indicated time points. (e) TUNEL, Ki67 and γ-h2ax staining of -231 xenograft tumor tissues treated with crizotinib and AG Representative images of staining results are shown. Bar, 1 μm. (f,g) The effects of AG14699 and/or crizotinib treatment on kidney and liver functions in nude mice with -231 xenografts after treatment for 21 days. (h) The body weight of nude mice before and after 21 days of AG14699 and/or crizotinib treatment. (i) The effects of ABT- 888 and/or foretinib treatment on kidney and liver functions in nude mice with -231 xenografts after treatment for 16 days. (j) The body weight of nude mice before and after 16 days of ABT-888 and/or foretinib treatment. (k) The effects of AG14699 and/or crizotinib treatment on kidney and functions in FVB mice with A134 syngeneic grafts after 12 days treatment. (l) The body weight of FVB mice before and after 12 days of AG14699 and/or crizotinib treatment. AST, aspartate aminotransferase. ALT, alanine transaminase. AG, AG14699; Cri, crizotinib; Nature Medicine: doi:1.138/nm

25 ABT, ABT-888; Ft, foretinib; AST, aspartate aminotransferase; ALT, alanine transaminase. Error bars represent s.d. P <.5, t-test. Nature Medicine: doi:1.138/nm

26 a Combination index (CI) b Combination index (CI) AG-Cri Wt AG-Cri KD AG-Cri Fraction affected (Fa) H1993 ABT-Ft H1993 AG-Cri A549 ABT-Ft A549 AG-Cri Fraction affected (Fa) c d Control Control H1993 H 2 O 2 H 2 O 2 Cri/ H 2 O 2 Cri/ H 2 O 2 Control py97- py1234- A549 H 2 O 2 Cri/ H 2 O 2 e py97- py1234- ROS PARP inhibitor P p- DNA repair Supplementary Figure 12. Synergistic effect of the combination treatment of PARP and inhibitors in -expressing breast cancer and non-small cell lung cancer cells. (a) MCF-7 cells with ectopic expression of vector, wild-type (Wt), or kinase dead (KD) were treated with the combination of AG14699 and crizotinib. The synergistic effect of the combination treatment was measured by cell viability assay. (b) Lung cancer cells H1993 and A549 were treated with PARP inhibitors (AG14699, ABT-888) and inhibitors (crizotinib, foretinib), and the synergistic effect of the combination treatment was measured by cell viability assay. (c) MCF-7/ cells were treated with 2 mm H 2 O 2 for 3 min or H 2 O 2 with 2 µm crizotinib pre-treatment for 1 h, and cell lysates were subjected to Western blot with the indicated antibodies. (d) H1993 and A549 cells were treated with 2 mm H 2 O 2 for 3 min or with H 2 O 2 plus 2 µm crizotinib pre-treatment for 1 h, and cell lysates were subjected to Western Nature Medicine: doi:1.138/nm

27 blot analysis with the indicated antibodies. (e) Proposed model. ROS-activated phosphorylates at Y97. Phosphorylated (p-) enhances DNA repair activity, thereby contributing to PARP inhibitor resistance. The synergistic effect was determined by calculating the combination index (CI) based on the Chou Talalay method. AG, AG14699; Cri, crizotinib; ABT, ABT-888; Ft, foretinib. Nature Medicine: doi:1.138/nm.432 6

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN! Yuan et al., Supplemental Figure 1, related to Figure 1! EY2 modulates the transcriptional activity of ERb, but not ERa!! B! -DPN! +DPN! * ERb GPDH MCF7 MD-MB-231 Primary BC - KD - KD #1 #2 #3 Relative

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,

More information

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half:

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half: a d h ΔSH2 Δ(SH3SH2) Myr SH3 SH2 Kinase domain 85 5 249 55 5 csrc ΔSH3 FlagHK HAcSrc HAcSrcΔSH2 HAcSrcΔSH3 HAcSrcΔ(SH3SH2) WB: FlagHK HAcSrc HAcSrcKD HAcSrcY529F WB: HisHK2HK2 Input GSTcSrc GST : : GST

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/2/43/43ra55/dc1 Supplementary Materials for Pathway-Based Identification of Biomarkers for Targeted Therapeutics: Personalized Oncology with PI3K Pathway

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Supplementary table 1

Supplementary table 1 Supplementary table 1 S. pombe strain list Fig. 1A JX38 h + ade6-m216 nda3-km311 PX476 PW775 PX545 PX546 h- ade6-m216 sgo2::ura4 + nda3-km311 h 9 mad2::ura4 + nda3-km311 h + ade6-m21 nda3-km311 rad21 +

More information

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai,

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity independently of the LKB1 AMPK pathway Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Wen-Pin Su, Helen

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supporting Information

Supporting Information Supporting Information Toward High-Efficient Red Emissive Carbon Dots: Facile Preparation, Unique Properties, and Applications as Multifunctional Theranostic Agents Shan Sun,, Ling Zhang, Kai Jiang, Aiguo

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Phenylketonuria (PKU) is an autosomal recessive genetic disorder that causes an accumulation of toxic metabolites in

More information

RXDX-101 & RXDX-102. Justin Gainor, MD February 20 th, 2014

RXDX-101 & RXDX-102. Justin Gainor, MD February 20 th, 2014 RXDX-101 & RXDX-102 Justin Gainor, MD February 20 th, 2014 Background Chromosomal fusions are important oncogenic drivers in NSCLC - ALK Rearrangements (4-6%) - ROS1 Rearrangements (1-2%) - RET Rearrangements

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

* This work was funded by the Breast Cancer Research Trust (New Zealand), The Dick Roberts Trust (New Zealand), Cancer Science Institute (Singapore),

* This work was funded by the Breast Cancer Research Trust (New Zealand), The Dick Roberts Trust (New Zealand), Cancer Science Institute (Singapore), THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 51, pp. 42502 42515, December 14, 2012 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Artemin Stimulates

More information

Hunk is required for HER2/neu-induced mammary tumorigenesis

Hunk is required for HER2/neu-induced mammary tumorigenesis Research article Hunk is required for HER2/neu-induced mammary tumorigenesis Elizabeth S. Yeh, 1 Thomas W. Yang, 1 Jason J. Jung, 1 Heather P. Gardner, 1 Robert D. Cardiff, 2 and Lewis A. Chodosh 1 1 Department

More information

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples

Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Supplementary Table 1. Classification of pathogenic BRCA1 mutations in prophylactic mastectomy samples Patient ID Age (yrs) BIC classification * HGVS classification # 1 2 BRCA1 del exon BRCA1g.71598-?_71681+?del

More information

Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells

Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells ORIGINAL ARTICLE Cell Research (2017) 27:764-783. www.nature.com/cr Self-inflicted DNA double-strand breaks sustain tumorigenicity and stemness of cancer cells Xinjian Liu 1, Fang Li 1, Qian Huang 2, Zhengxiang

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental

More information

Enterprise Interest I am employee and shareholder of Agendia, a company that markets gene expression signatures in oncology

Enterprise Interest I am employee and shareholder of Agendia, a company that markets gene expression signatures in oncology Enterprise Interest I am employee and shareholder of Agendia, a company that markets gene expression signatures in oncology Next generation pathology molecular diagnostics: Combining DNA and RNA analysis

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

SUPPLEMENTAY FIGURES AND TABLES

SUPPLEMENTAY FIGURES AND TABLES SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression

More information

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results

Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,

More information

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan Aims To identify genes controlling tumor

More information

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids,

More information

WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05

WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05 IL1 (ng/ml) (1 x 1 3 cells) DMSO LFMA13 R46 IL1 (ng/ml) Control shrna TNFa (ng/ml) Alum Nigericin ATP IL1 (ng/ml) IL1 (ng/ml) IL1 (ng/ml) a c f 3 2 1 1 8 6 4 2 Sup 1 8 6 4 DMSO Alum/DMSO Alum/LFMA13 ***

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury

Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Cathepsin S inhibition combines control of systemic and peripheral pathomechanisms of autoimmune tissue injury Maia Tato, Santhosh V. Kumar, Yajuan Liu, Shrikant R. Mulay, Solange Moll, Bastian Popper,

More information

MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer

MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer The Journal of Clinical Investigation Research article MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer Mick D. Edmonds, 1 Kelli L. Boyd, 1 Tamara Moyo, 2 Ramkrishna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB El Azzouzi et al., http ://www.jcb.org /cgi /content /full /jcb.201510043 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Acquisition of -phluorin correlates negatively with podosome

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary CellSensor DBE-bla MDA-MB-468 Cell Line Cat. no. K1814 Pathway Description The phosphatidylinositol-3-kinase (PI3K) signaling cascade is essential for cell growth

More information

Src-dependent autophagic degradation of Ret in FAKsignaling defective cancer cells

Src-dependent autophagic degradation of Ret in FAKsignaling defective cancer cells Manuscript EMBOR-2011-35678 Src-dependent autophagic degradation of Ret in FAKsignaling defective cancer cells Emma Sandilands, Bryan Serrels, Simon Wilkinson and Margaret C Frame Corresponding author:

More information

Chapter 4. Estrogen receptor expression in human macrophages

Chapter 4. Estrogen receptor expression in human macrophages Chapter 4 Estrogen receptor expression in human macrophages 4.1. Introduction Macrophages respond to estrogen present in their microenvironment and hence should express functional estrogen receptors unless

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information