HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
|
|
- Jemima Welch
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1 (BRCA1 5382insC) and transfected with an empty pcdna3 vector [23]. HCC1937+BRCA1 is stably transfected with the BRCA1 cdna in pcdna3. EUFA423 is a BRCA2 mutant cell line derived from a Fanconi anemia (FA) brain tumor from a FANCD1 patient. This line has truncating BRCA2 mutations in exon 15 (7691 insat) of one BRCA2 allele and in exon 27 (9900 insa) of the other allele [24-28]. EUFA423+BRCA2 is stably transfected with BRCA2-HA in pcdna3. Human cell lines were maintained in 1:1 MEGM (Lonza): DMEM (Invitrogen) supplemented with 10% FBS and MEGM SingleQuots (Lonza). Cells transfected with BRCA plasmid were routinely supplemented with G418 and transferred to drug-free medium before use. Colony forming assay Cells were seeded in triplicate in 6-well plates. The following day cells were treated with drugs for 48 h (mesc) or 6 days (CHO cells). After treatment, medium was replaced with drug-free medium until colonies formed. Cells were fixed with 3:1 methanol/acetic acid, stained with 5% Giemsa stain and counted. Cell survival was calculated relative to untreated vehicle controls. Results are the mean ± standard deviation of triplicate experiments. IC 50 values were calculated from a log([drug]) versus normalized response curve fit using GraphPad Prism version 5.00 for Windows (GraphPad Software). MTT cell proliferation assay 1
2 Cells were seeded into 96-well plates and, 24 h, later treated with indicated drug concentrations or vehicle control. At 72 h-post drug addition, a tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich) was added and the resuspended formazan crystals assayed. The percentage of cell growth inhibition in triplicate experiments was expressed as [1-(A/B)]*100, where A was absorbance value for experimental wells and B for control wells. The IC 50 values were calculated as in the previous section. Cell death analysis Determination of cell death was performed with the Annexin V-FITC/Propidium Iodide (PI) staining kit (BD Pharmingen). Briefly, 72 h post-treatment, cells were collected, washed, resuspended in 1X Annexin V binding buffer and incubated (15 min, in the dark) with Annexin V-FITC and PI and 50,000 events were counted using a Cyan Flow Cytometer (Dako, USA). Image analysis was performed using Summit 4.3 software (Dako, USA). Annexin V /PI cells are viable, Annexin V+/PI are early apoptotic cells and Annexin V+/PI+ are late apoptotic and necrotic cells. The percentage of apoptotic cells was determined by adding both Annexin V+ quadrants. Western blots Cells were lysed with complete protease inhibitors cocktail (Roche Diagnostic Corporation). After centrifugation at rpm for 10 min in a microcentrifuge, supernatant was collected and protein concentrations determined using Coomassie Brilliant Blue staining (BioRad). Equal amounts of protein were separated using 4 15% Tris-HCl SDS-polyacrylamide gels, transferred onto either PVDF (BioRad) or nitrocellulose membranes (Li-Cor), and blocked using Odyssey blocking buffer (Li-Cor). Blocked membranes were incubated with the appropriate primary antibody (Anti-actin [Sigma or Cell Signaling], anti-parp [Cell Signaling], anti-caspase 3 [Cell Signaling], or anti-ercc1 [Cell Signaling]) under the recommended conditions. After washes in 1X Tris buffered saline with 0.1% Tween (TBS-T), bound primary antibodies were detected with the following secondary antibodies: AlexaFluor 680 or 800 conjugated goat anti-mouse or anti- 2
3 rabbit antibodies (Li-Cor Biosciences). After three washes in TBS-T, proteins were detected using an Odyssey IR Imaging System (Li-Cor Biosciences). PARP Activity Two separate experiments in duplicate or triplicate were used to determine PARP activity. Cells were grown in 10 cm cell culture dishes until they reached confluence, then washed with 0.9% NaCl, and harvested by trypsination. Cell pellets were lysed in PARP buffer. Insoluble materials were removed by centrifugation (10,000 g for 10 min at 4 o C) and proteins in the supernatant retained. Protein concentrations were determined, then proteins were flash frozen and stored at -80 o C. The assay was performed according to the recommended protocol with chemiluminescent detection performed using a Fluoroskan Ascent luminometer (Thermo Electron Corporation). A PARP linear standard curve was used to determine PARP activity for each sample. Intracellular NADPH levels 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST- 8), a water-soluble tetrazolium salt, is reduced to a yellow formazan dye by dehydrogenases, such as NADPH, in cells, allowing measurement of the amount of NADPH. Cells were plated in quintuplicate into wells of a 96- well plate and incubated 4 h at 37 o C, 5% CO 2 to allow cell attachment. Cell Counting Kit-8 solution with WST- 8 (Dojindo Molecular Technology) was added to the wells, and after incubation (4 h) absorbance (OD 450 nm) was measured. The average absorbance of the control wells was subtracted from that of the experimental wells and the relative levels of NADPH were determined. 3
4 Supplementary Table S1. IC 50 values for ABT-888, carboplatin, cisplatin, ABT-888/carboplatin or ABT- 888/cisplatin in different cell lines. All values are in μm. (A) Brca mesc, (B) BRCA human cancer cell lines, and (C) CHO cell lines. Note that for combination drug treatments, the IC 50 value was determined at a fixed concentration of one of the drugs, which is indicated. Also, a dash ( ) indicates that the IC 50 values were above that of the concentration range studied. A. mesc Cell Lines ABT-888 Carboplatin Cisplatin ABT μm Carboplatin WT Brca Brca ABT μm Cisplatin B. Human Cancer Cell Lines Cell Lines ABT-888 Carboplatin Cisplatin Carboplatin μm ABT-888 Cisplatin μm ABT-888 BRCA BRCA1 Comp Cell Lines ABT-888 Carboplatin Cisplatin Carboplatin μm ABT-888 Cisplatin μm ABT-888 BRCA BRCA2 Comp C. CHO Cell Lines Cell Lines Carboplatin+ ABT-888 Carboplatin ABT.0100 μm VC VC8 + Brca
5 5
6 Supplementary Figure Legends SUPPLEMENTARY FIGURE S1. Clonogenic cell survival of WT and Brca mescs and inhibition of human BRCA-deficient or -complemented cell proliferation after treatment with cisplatin alone or in combination with ABT (A) Cisplatin structure. For WT (AB2.2, Brca) Brca1 (Brca1 -/- ) and Brca2 (Brca2 -/- ) mescs were treated for 48 h with the indicated drugs and concentrations and survival assessed using colony formation. (B) cisplatin and (C) ABT-888 with cisplatin. Data represent average of triplicate measurements. For (D-G), cell growth as assessed by MTT assay at 72 h for D-G post drug treatment. Percentage of growth inhibition of HCC1937 or HCC1937+BRCA1 cells after treatment with (D) cisplatin or (E) ABT-888 (200 μm)/cisplatin combination. Percentage of growth inhibition of EUFA423F and EUFA423F+BRCA2 cells after treatment with (F) cisplatin or (G) 12.5 μm ABT-888/ cisplatin combination. The percentage of cells that exhibited growth inhibition after 72 h of continuous drug treatment was compared to that of untreated cells. Data represent the average of at least triplicate samples. Error bars, mean + SEM. SUPPLEMENTARY FIGURE S2. Calculated combination index (CI) values for ABT-888/carboplatin or ABT-888/cisplatin treatments of mescs and human tumor cell lines. Data used for these plots is found in Supplementary Table 2. (a) CI values for treatment of Brca1 mescs with ABT-888 in combination with cisplatin or carboplatin. Filled circles, ABT-888/carboplatin combinations; open circles, ABT-888/cisplatin combinations. Area between the horizontal lines represents additivity, area above the upper horizontal line represents antagonism, and area below the lower horizontal line represents synergism. (b) CI values for 6
7 treatment of Brca2 mescs with ABT-888 in combination with either cisplatin or carboplatin. Filled circles, ABT-888/carboplatin combinations; open circles, ABT- 888/cisplatin combinations. (c) CI values for treatment of HC1937 (BRCA1- deficient) cells with ABT-888/carboplatin. (d) CI values for treatment of HC1937 (BRCA2-deficient) cells with ABT-888/carboplatin. (e) CI values for treatment of V-C8 (BRCA2-deficient) cells with ABT-888/carboplatin. SUPPLEMENTARY FIGURE S3. Clonogenic cell survival of isogenic VC8 (Brca2-deficient) and VC8+Brca2 (Brca2-complemented) CHO cells after treatment with ABT-888, carboplatin, cisplatin alone or ABT-888 combined with a platinum drug. VC8 and VC8+Brca2 cells were treated for 6 days with the indicated drugs and concentrations. (A) ABT-888, (B) carboplatin, and (C) ABT- 888/carboplatin. Data represent the average of triplicate measurements. Error bars, mean + SEM. (D) Interaction effects of ABT-888 with carboplatin treatment in VC8 CHO cell line. SUPPLEMENTARY FIGURE S4. Hematoxylin and Eosin staining (200x magnification) of tumor sections. SUPPLEMENTARY FIGURE S5. RAD51 foci formed in cells as a function of BRCA status after treatment with ABT-888/carboplatin. All RAD51 foci were analyzed by immunostaining after cells were treated with drugs for 24 h. (A) HCC1937 and HCC1937+BRCA1 treated with vehicle or 200 μm ABT-888/25 μm 7
8 carboplatin. (B) EUFA423 and EUFA423+BRCA2 treated with vehicle or 12.5 μm ABT-888/12.5 μm carboplatin. SUPPLEMENTARY FIGURE S6. Apoptosis in mesc after treatment with ABT-888 and carboplatin, singly or in combination. WT, Brca1, and Brca2 mescs were treated with ABT-888 (0.5 μm) and carboplatin (0.5 μm), singly or in combination. (A) Percentage of apoptotic cells after treatment with ABT- 888, carboplatin or their combination for 48 h. Apoptosis was measured by Annexin V/propidium iodide staining and analyzed by FACS. The percentage of apoptotic cells was obtained by determining the percentage of Annexin V-positive cells. (B) Western blots of Parp1 cleavage after treatment with ABT-888, carboplatin or their combination for the indicated times. The red box indicates cleaved PARP1, which is an indication of apoptosis. Actin served as a loading control. 8
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationTo determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationSarah A. Kopecky and Douglas S. Lyles*
JOURNAL OF VIROLOGY, Apr. 2003, p. 4658 4669 Vol. 77, No. 8 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.8.4658 4669.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Contrasting
More informationCaspase-3 Assay Cat. No. 8228, 100 tests. Introduction
Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationEffect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationONCOLOGY LETTERS 7: , 2014
1738 Fermentation supernatants of Lactobacillus delbrueckii inhibit growth of human colon cancer cells and induce apoptosis through a caspase 3 dependent pathway YING WAN 1, YI XIN 1, CUILI ZHANG 1, DACHANG
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationHIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates
HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationInstructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests
3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationCell Lysis Buffer. Catalog number: AR0103
Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells
Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationInhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationArgininosuccinate synthetase 1 suppression and arginine restriction inhibit cell
Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell migration in gastric cancer cell lines Yan-Shen Shan 1, Hui-Ping Hsu 1, Ming-Derg Lai 2,3, Meng-Chi Yen 2,4, Wei-Ching Chen
More informationSupporting Information Nitric oxide releasing photoresponsive nanohybrids as excellent therapeutic agent for cervical cancer cell lines
upporting Information itric oxide releasing photoresponsive nanohybrids as excellent therapeutic agent for cervical cancer cell lines Priya udhesh a, Kaviyarasan Tamilarasan a, Palaniappan Arumugam a and
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationGlobal Histone H3 Acetylation Assay Kit
Global Histone H3 Acetylation Assay Kit Catalog Number KA0633 96 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationTECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C
Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationAMPK Assay. Require: Sigma (1L, $18.30) A4206 Aluminum foil
AMPK Assay Require: Acetone Sigma (1L, $18.30) A4206 Aluminum foil Ammonium sulfate Fisher BP212R-1 AMP Sigma A1752 ATP Sigma A6144 (alt. use A7699) Beta-mercaptoethanol Sigma M6250 (alt. use M7154) Bio-Rad
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationFocus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity Featured Study: Using the Time Resolving Function of the xcelligence System to Optimize Endpoint Viability and
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationData Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
More informationSupplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
More informationTECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates
Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS
7 CHAPTER SEVEN ELUCIDATION OF ANTICANCER MECHANSIMS OF ISOLATED PHYTO- CONSTITUENTS 136 7.1 INTRODUCTION Breast cancer is one of the leading causes of death in women (Stephens et al., 2012). Several chemotherapeutic
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationJohannes F Fahrmann and W Elaine Hardman *
Fahrmann and Hardman Lipids in Health and Disease 2013, 12:36 RESEARCH Open Access Omega 3 fatty acids increase the chemo-sensitivity of B-CLL-derived cell lines EHEB and and of B-PLL-derived cell line
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationJournal of Chemical and Pharmaceutical Research, 2017, 9(12): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2017, 9(12):30-34 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 Evaluation of Anticancer Activity of Alphonsea Sclerocarpa
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationEPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H3 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H3 Acetylation Assay Kit is suitable for specifically measuring global
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationFocus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationEPIGENTEK. EpiQuik Global Histone H4 Acetylation Assay Kit. Base Catalog # P-4009 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H4 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H4 Acetylation Assay Kit is suitable for specifically measuring global
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSuperoxide Dismutase Assay Kit
Superoxide Dismutase Assay Kit Catalog Number KA3782 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupporting Information
Supporting Information Sasportas et al. 10.1073/pnas.0806647106 SI Methods Lentiviral Transduction. MSC and glioma cells were transduced with LVs at varying multiplicity of infection (moi) by incubating
More informationIN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS
292 Tang, An, Du, Zhang, Zhou 292 IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS Qin-qing Tang, a Xiao-jing An, a Jun Du, a Zheng-xiang Zhang, a Xiao-jun Zhou a
More informationEpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More information