SuperARMS EGFR Mutation Detection Kit
|
|
- Mariah Bishop
- 6 years ago
- Views:
Transcription
1 SuperARMS EGFR Mutation Detection Kit Detection of 41 mutations in exons Instruction for Use Instruction Version: P1.0 Revision Date: July 2016 Store at -20±5
2 Background For: ADx-EG14 Due to its association with malignancies, epidermal growth factor receptor (EGFR) has become the target of an expanding class of anticancer therapies, such as gefitinib (Iressa) and erlotinib (Tarceva), which are tyrosine kinase inhibitors (TKIs). These drugs work best on patients whose cancer is driven by abnormal EGFR signaling. Lung cancer patients who experienced rapid, durable, complete or partial responses to TKIs therapy have been found to harbor somatic mutations in the EGFR gene. Cancer patients with somatic EGFR mutations have shown an impressive 60% response rate, much higher than that for conventional chemotherapy. Therefore, detection of the EGFR mutation status in tumor tissue is key to offering tailored, personalized treatment to cancer patients. Resistance to therapy, either in the primary tumor or acquired after TKI treatment, is also associated with somatic mutations. Currently, tumor tissue is the most frequent material for EGFR mutation testing, however, for the advanced non-small cell lung cancer (NSCLC) patients, tumor tissue is always difficult to obtain. Peripheral blood of cancer patients frequently contains circulating tumor DNA (ctdna) derived from tumor cells, which has been used to detect tumor-specific alterations. Moreover, blood sampling is minimally invasive, readily accessible, and relatively repeatable. Thus, using blood for EGFR mutation identification and follow-up shows promise. The SuperARMS EGFR Mutation Detection Kit is highly selective and sensitive, detecting 41 of the most common somatic mutations (both activating and resistance-related) in the EGFR gene. Our company s patented technology allows detection of 0.2% - 0.8% mutant DNA in a background of 99.8% % normal DNA, while ensuring that false negatives are minimized. The procedure is easily adapted for use in high-throughput sample processing. The purpose of the kit is to aid physicians and clinical researchers in identifying non-small cell lung cancer patients whose tumors harbor EGFR mutations. Intended Use The SuperARMS EGFR Mutation Detection Kit is a highly sensitive real-time PCR-based test designed to accurately identify 41 EGFR mutations in exons The used DNA is extracted from peripheral blood (plasma or serum). Kit Contents This kit contains sufficient reagents to carry out 12 tests (Table 1). Table 1 Kit Contents Contents Amount P-EGFR Reaction Strips 8 strips P-EGFR Reaction Mix µl*16 P-EGFR Enzyme Mix 40 µl P-EGFR Positive Control 400 µl One 8-tube strip is employed for 2 tests (Table 2). The 19-Del reaction mix can detect the presence of any of 29 deletions in exon 19. The 20-Ins reaction mix can detect the presence of any of 6 insertions in exon 20. The G719X reaction mix can detect the presence of G719A and G719C. Table 2 Mutation Information for Each Strip Tube No. Reagent Supplied Volume (μl) Mutation detected FAM HEX ROX CY Del / L858R Del IC L858R / 1/7
3 2 T790M 10 T790M IC / / 3 G719X / L861Q / S768I 10 G719X IC L861Q S768I 4 20-Ins Ins IC / / 5 19-Del / L858R Del IC L858R / 6 T790M 10 T790M IC / / 7 G719X / L861Q / S768I 10 G719X IC L861Q S768I 8 20-Ins Ins IC / / * IC: Internal Control The reagents are pre-loaded into strips that are compatible with Stratagene Mx3000P /Mx3005P, ABI7500, SLAN-96S instruments. For the transparent strip, the number is marked on the side of each tube. For the milky white strip, one pinhole will lay in the corner of the tab beside tube No.1, and the other pinhole will lay in the middle of the tab beside tube No.8. Equipment and Reagents Not Supplied With Kit 1. Compatible PCR instruments: Stratagene Mx3000P /Mx3005P, ABI7500, SLAN-96S (1) For Stratagene Mx3000P /Mx3005P, if there s low net fluorescence signal (dr) but high background signal (R), please reduce the signal gain setting of instrument properly. (2) For ABI instruments please set up as follows: Reporter Dye: FAM, VIC, ROX, CY5; Quencher Dye: TAMRA; Passive Reference: NONE. (3) For SLAN-96S, please set up as follows: Probe mode: FAM, VIC, ROX, CY5. During the result analysis, open the Preference window and select Absolute Fluorescence Value Normalization in Amplification Curve section. (4) We recommend that all PCR instruments in use should be conducted fluorescence calibration once a year. 2. Sterile, nuclease-free tubes and pipette tips. 3. Dedicated pipettes and filtered pipette tips for handling DNA template. 4. Sterile, nuclease-free H 2 O. Shipping and Storage The kit requires cold-chain-transportation. All contents of the kit should be stored immediately upon receipt at -20±5 in the dark in a constant temperature freezer. Avoid unnecessary freezing and thawing of the contents of the kit. Do not use the reagent after five freeze-thaw cycles. Once opened, this reagent is stable at -20±5 until the expiry. Stability The shelf-life of the kit is eight months when stored under the recommended conditions and in the original packaging. Do not use the kit after the stated expiry date. Specimen Material Human genomic DNA must be extracted from peripheral blood (plasma or serum). Selection of high quality DNA extraction reagents is essential for the kit. We recommend use AmoyDx Circulating DNA kit, Cat No. ADx-BL03. Note: a) The kit requires 10 ml whole blood and the recommended volume of plasma is no less than 4 ml. 2/7
4 b) The plasma should be separated from whole blood within 2 hours, If not, please store the blood sample at 2~8 for no more than 4 hours. We recommend use AmoyDx Cell-free DNA Protection Vacuum Tube (Cat No. ADx-VT01-R) for blood collection. (The collected blood samples are stable for 5~7 days at 4~25 for storage and transportation). c) EDTA is recommended for anticoagulation, avoid using heparin anticoagulant. d) The DNA should be extracted from plasma within 2 hours, if not, please store the plasma at -20±5 for no more than 2 years. e) If the extracted DNA is not used immediately, it should be stored at -20±5 for no more than 3 months. Technological Principles The kit adopts ARMS (Amplification Refractory Mutation System) and real-time PCR technology, which uses novel, proprietary primers and probes in a real-time PCR assay to detect EGFR mutations in human plasma cfdna samples. The mutant EGFR gene DNA is amplified by the specific primers, and detected by the novel probes. A highly validated procedure based on EGFR Taq DNA polymerase contributes to outstanding assay sensitivity and selectivity. Protocol 1. The reaction buffer, dntps, specific oligos and novel probes are pre-loaded in the PCR tubes. 2. The contents in P-EGFR Reaction strip and P-EGFR Reaction Mix formed a mutation detection system and an internal control system. The mutation detection system is used to detect the mutation status of EGFR gene (positive or negative). The internal control system is designed to detect the presence of inhibitors and monitor the accuracy of experimental operation. 3. The P-EGFR Positive Control contains a recombinant gene with EGFR mutations, and normal human genomic DNA. Experimental Procedure 1. Thaw the P-EGFR Positive Control and P-EGFR Reaction Mix at room temperature. When the reagents are completely thawed, mix the reagents by inverting the tube 10 times and centrifuge briefly to collect the contents at the bottom of the tube. 2. Briefly centrifuge P-EGFR Enzyme Mix prior to use. 3. Add 67.5 µl DNA sample, and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. 4. Add 67.5 µl no-template controls (sterile water, NTC), and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. 5. Add 67.5 µl P-EGFR Positive Control, and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. Note: The volumes given for each reaction mix have been optimized and validated. Changing volumes of any reagent may result in a loss of performance. Do not store user-prepared mixes, use immediately. Since Taq DNA polymerase is viscous, please pay attention to the centrifugation and pipetting process. Minimize the contact interface between the pipette tip and Taq DNA polymerase to avoid adding excess enzyme. 6. Mix each solution thoroughly by gently pipetting up and down more than 10 times. Note: avoid vortexing solutions with Taq DNA Polymerase. 3/7
5 7. Centrifuge briefly. 8. Take out the P-EGFR Reaction Strips and centrifuge the strips if there are any reagent droplets in the caps of the PCR tubes. Then briefly uncover the caps prior to use. 9. Transfer 70 µl of above mixed solution to the appropriate PCR tube of the P-EGFR Reaction Strips. Add the solution to the inside of the tube wall above the reagents in the tube. 10. Seal the strips. 11. Spin down the PCR tubes gently or centrifuge them briefly to collect the reagents at the bottom of tubes. Note: this spin or centrifuge step is essential for proper mixing of the reagents. 12. Place the PCR tubes into the real-time PCR instrument. A recommended plate layout is shown in Table 3. Table 3 Suggested PCR Plate Layout Well layout A Sample 1 Sample 3 Sample 5 NTC B Sample 1 Sample 3 Sample 5 NTC C Sample 1 Sample 3 Sample 5 NTC D Sample 1 Sample 3 Sample 5 NTC E Sample 2 Sample 4 Sample 6 PC F Sample 2 Sample 4 Sample 6 PC G Sample 2 Sample 4 Sample 6 PC H Sample 2 Sample 4 Sample 6 PC 13. Carry out real-time PCR using the cycling conditions described in Table 4. Note: The reaction volume is 80 μl per well. Please pack the post-pcr tubes with two disposable gloves and discard properly. Do NOT open the post-pcr tubes to avoid contamination. Table 4 Cycling Parameters Stage Temperature Time Cycles min s s 72 30s 93 40s 60 45s Data collection of FAM, HEX/VIC, ROX, CY s Sample Data Analysis 1. The FAM/ROX/CY5 signals of the mutation detection system indicate the mutation status of the sample. The HEX/VIC signals indicate the internal control status. The internal control amplifies and detects a region of genomic DNA that has no known mutations or SNPs. 4/7
6 2. Ensure the passive reference is unselected, and select single mutation detection for each tube accordingly. It is necessary to choose the reaction wells for positive control, no-template control and sample simultaneously. Then users could adjust the threshold of each amplification curve, and obtain the Ct value of mutant group. 3. The threshold at which the signal is detected above background fluorescence is called the Cycle threshold (Ct). The Ct values used to determine if a sample is positive or negative are based on extensive validation. 4. Assess each NTC Ct value of FAM/ROX/CY5 signals to ensure that there is no positive amplification, if the NTC has positive amplification, the data must be discarded as there is contamination. If the HEX/VIC signal occasionally rises, further analysis could be carried out. 5. In general, the Ct values of FAM/ROX/CY5 signals for P-EGFR Positive Control will be less than 20, but variation may occur due to different threshold settings on different instruments. 6. The Ct value for HEX/VIC signal should be less than 19, otherwise, the DNA sample may contains PCR inhibitors or the DNA amount is insufficient, indicating that the DNA needs to be re-extracted or increase the DNA amount. 7. If the Ct value is less than the corresponding Cut-off value of Ct, the sample is confirmed as positive. Otherwise, the sample is classified as negative or below the detection limit of the kit. (See Table 5) a) The calculation of Ct: Ct = mutant Ct value (FAM/ROX/CY5) internal control Ct value (HEX/VIC). The mutant Ct value indicates the Ct value of the mutant signal from a sample. The internal control FAM Ct value indicates the Ct value of the internal control signal of the sample. Table 5 Result Determination Tube No. FAM ROX CY / Ct Cut-off value 2 8 / / Performance Characteristics 4 11 / / The performance characteristics of this kit were validated on Stratagene Mx3000P /Mx3005P, ABI7500, and SLAN-96S 1. Sensitivity: The kit allows detect % mutant DNA in a background of % normal DNA (Table 6). Table 6 LOD for each EGFR mutation Exon Mutation Base Change Cosmic ID Name % LOD Exon 18 Exon 19 G719A 2156G>C 6239 E-18-M1 0.20% G719C 2155G>T 6253 E-18-M3 0.40% E746_A750del (1) 2235_2249del E-19-M1 0.20% E746_A750del (2) 2236_2250del E-19-M2 0.20% L747_P753>S 2240_2257del E-19-M3 0.60% E746_T751>I 2235_2252>AAT(complex) E-19-M4 0.40% E746_T751del 2236_2253del E-19-M5 0.40% E746_T751>A 2237_2251del E-19-M6 0.20% E746_S752>A 2237_2254del E-19-M7 0.20% E746_S752>V 2237_2255>T(complex) E-19-M8 0.20% E746_S752>D 2238_2255del E-19-M9 0.40% 5/7
7 L747_A750>P 2238_2248>GC(complex) E-19-M % L747_T751>Q 2238_2252>GCA(complex) E-19-M % L747_E749del 2239_2247del E-19-M % L747_T751del 2239_2253del E-19-M % L747_S752del 2239_2256del E-19-M % L747_A750>P 2239_2248TTAAGAGAAG>C(complex) E-19-M % L747_P753>Q 2239_2258>CA(complex) E-19-M % L747_T751>S 2240_2251del E-19-M % Exon 19 Exon 20 Exon 21 L747_T751del 2240_2254del E-19-M % L747_T751>P 2239_2251>C(complex) E-19-M % L747_T751del 2238_2252del E-19-M % L747_S752>Q 2239_2256>CAA E-19-M % E746_T751>V 2237_2252>T E-19-M % E746_T751>T 2236_2253> ACG / E-19-M % L747_A750>P 2239_2250>CCC / E-19-M % L747_K754>QL 2239_2261>CAATT / E-19-M % E746_K754>EQHL 2238_2261>GCAACATCT / E-19-M % E746_S752>EQ 2238_2256>GCAA / E-19-M % E746_A750>QP 2236_2248>CAAC E-19-M % E746_T751>Q 2236_2253>CAA E-19-M % T790M 2369C>T 6240 E-20-M1 0.20% S768I 2303G>T 6241 E-20-M2 0.20% H773_V774insH 2319_2320insCAC E-20-M3 0.40% D770_N771insG 2310_2311insGGT E-20-M4 0.60% V769_D770insASV 2307_2308insgccagcgtg E-20-M5 0.60% D770_N771insSVD 2311_2312insGCGTGGACA E-20-M8 0.40% D770ASVD 2309_2310AC>CCAGCGTGGAT E-20-M9 0.40% H773_V774insNPH 2319_2320insAACCCCCAC E-20-M % L858R 2573T>G 6224 E-21-M1 0.20% L861Q 2582T>A 6213 E-21-M2 0.20% 2. Productivity: The kit can be used to analysis 12 samples maximum. (see Table 7) Table 7 Sample Qty detected with the Kit PCR Run(s) Control Qty Total samples can be detected 2 runs 4 (2 controls/run * 2) 12 4 runs 8 (2 controls/run * 4) 8 3. Accuracy: Accuracy of the kit was established by testing 7 mutant positive reference controls and 8 negative reference controls, the detection concordance rate is 100%. 4. Precision: Precision of the kit was established by performing a certain mutant positive reference control for 10 repeats; all the controls can be detected. Warnings and Precautions 1. Please read the instruction carefully and become familiar with all components of the kit prior to use. 2. The product specified above does not contain any virus, reagent by-product of the same or metabolic by-product of Hepatitis A, B, C, D or HIV. 6/7
8 3. Do not exchange and mix up the kit contents with different batches. 4. The kit and its contents cannot be resold or modified for resale without the written approval of manufacturer. 5. Using other sources of reagents is not recommended. Strictly distinguish the reagents from mixed standard to avoid contamination. Otherwise, false positive may be produced. 6. Do the experiments with attention to prevent exogenous DNA contamination to reagents. It is recommended that users have separate, dedicated pipettes and filtered pipette tips to add DNA template during the preparation of reagents. 7. To optimize the activity and performance, mixtures should always be protected from light to avoid photo bleaching. 8. All the chemicals are potential hazard, only trained professionals could use this kit. Please wear suitable lab coat and disposable gloves. The used kit should be disposed of properly. Notes 1. Symbol for "AUTHORISED REPRESENTATIVE IN THE EUROPEAN COMMUNITY" 2. Symbol for "IN VITRO DIAGNOSTIC MEDICAL DEVICE" 3. Symbol for "KEEP DRY" 4. Symbol for "THIS WAY UP" 5. Symbol for "FRAGILE,HANDLE WITH CARE" Information of European Authorised Representative Wellkang Ltd t/a Wellkang Tech Consulting Suite B, 29 Harley Street, London W1G 9QR United Kingdom References 1. Shama SV, Bell DW, Settleman J, et al; Epidermal growth factor receptor muataions in lung cancer. Nat Rev Cancer, 2007,7(3): Ressel R, Moran T, Queralt C, et al; Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med, 2009,361(10): Mork Ts, Wu YL, Thongprasert S, et al; Gefitinib or carboplatin-paclitaxel in pulmonary ademocarcinoma. N Engl J Med, 2009,361(10): Gazdar AF; Personalized medicine and inhibition of EGFR singnaling in lung cancer. N Engl J Med, 2009, 361(10): Dancey JE; Epidermal growth factor receptor inhibitors in non-small cell lung cancer. Drugs, 2007, 67(8): Kobayashi S, Boggon TJ, Dayaram T, et al; EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med, 2005, 352(8): Yasuda H., S kobayshi, Costa, D. B, et al. EGFR exon 20 insertion mutations in non-small-cell lung cancer: preclinical data and clinical implications. Lancet Oncol,2012, 13(1): e Kimura H, Suminoe M, Kasahara K, et al; Evaluation of epidermal growth factor receptor mutation status in serum DNA as a predictor of response to gefitinib (IRESSA). Br J Cancer, 2007, 97(6): Huang Z, Wang ZJ, Bai H, et al; The detection of EGFR mutation status in plasma is reproducible and can dynamically predict the efficacy of EGFR-TKI. Thoracic Cancer, 2012, 3(4): /7
AmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
More informationRealLine Mycoplasma genitalium Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1
More informationPneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Pneumocystis Carinii Real Time PCR Kit Cat. No.: QD-0082-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5; Rotor Gene 2000/3000;
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationLeukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit
Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ
More informationMolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.
Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com
More informationRealLine HBV / HCV / HIV Str-Format
Instructions for use ASSAY KIT FOR THE QUALITATIVE AND DIFFERENTIAL DETECTION OF HEPATITIS B VIRUS DNA, HEPATITIS C VIRUS RNA, AND HUMAN IMMUNODEFICIENCY VIRUS TYPES 1 AND 2 RNA USING THE PCR/RT-PCR METHOD
More informationAmpliX HBV Quantitative
Instructions for use REAL TIME PCR DETECTION AND QUANTITATION KIT OF HEPATITIS B VIRUS DNA Research Use Only (RUO) (Lyo-format) VBD0595 96 rcs valid from May 2013 Explanation of symbols used in labeling
More informationRealLine HCV Qualitative Str-Format
Instructions for use REAL TIME PCR DETECTION KIT FOR THE HEPATITIS C VIRUS RNA (HCV) Research Use Only (RUO) (Str-format) VBD0795 96 Tests valid from: October 2018 Rev05_1018_EN Page 1 of 8 Explanation
More informationRealLine HIV quantitative Str-Format
Instructions for use DETECTION AND QUANTIFICATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR Research Use Only (RUO) Attention! Please read the information about quantification process carefully!
More informationRealLine HIV qualitative Str-Format
Instructions for Use REAL TIME PCR DETECTION KIT FOR HUMAN IMMUNODEFICIENCY VIRUS RNA Research Use Only (RUO) RealLine HIV Qualitative (Str-format) VBD0196 96 Tests valid from July 2016 Rev01072016_EN
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationCytomegalovirus (CMV) End-Point PCR Kit Product# EP36300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product
More informationHDV Real-TM. Handbook
HDV Real-TM Handbook for use with RotorGene 3000/6000 (Corbett Research), SmartCycler (Cepheid), iq icycler and iq5 (Biorad), Applied Biosystems 7300/7500 Real Time PCR Systems (Applera), MX3000P and MX3005P
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationHBV Real-TM Quant Handbook
HBV Real-TM Quant Handbook Real Time Kit for the Quantitative detection of Hepatitis B Virus in human plasma for use with SmartCycler (Cepheid), RotorGene 3000/6000 (Corbett Research), iq icycler and iq5
More informationAssay Location Primer TaqMan probe Reference
Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original
More information1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir
New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal
More informationReal Time Kit. Pneumocystis jirovecii (carinii) Real-TM Handbook. for the detection of Pneumocystis jirovecii (carinii) in biological materials
IVD For in Vitro Diagnostic Use Pneumocystis jirovecii (carinii) Real-TM Handbook Real Time Kit for the detection of Pneumocystis jirovecii (carinii) in biological materials REF P2-50FRT VER 07.02.2010
More informationaltona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS
altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationStorage: Logix Smart Zika Virus Master Mix and Logix Smart Zika Virus Positive Control must be stored at -20 ⁰C and can last up to 60 days.
Logix Smart Zika Virus (ZIKV-K-003; ZIKV-PC-003; GEN-NTC-001) Description The Logix Smart Zika Virus Test developed by Co-Diagnostics, Inc. detects ribonucleic acid (RNA) of Zika Virus in a single step
More informationABIOpure TM Viral (version 2.0)
ABIOpure TM Viral (version 2.0) DNA/RNA Extraction Handbook Cat No: M561VT50 FOR RESEARCH USE ONLY Table of Contents Contents Page Kit Components 3 Precautions 3 Stability & Storage 4 General Description
More informationRealLine HCV quantitative Str-Format
Instructions for use QUANTITATIVE KIT FOR REAL TIME PCR DETECTION FOR RNA OF HEPATITIS C VIRUS Attention! Please read the information about quantification process carefully! Research Use Only (RUO) (Str
More informationWHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,
More informationSputum DNA Collection, Preservation and Isolation Kit 50 Individual Devices
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Sputum DNA Collection, Preservation and Isolation Kit 50 Individual
More informationDETECTION AND QUANTITATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR
Lyo-Format Instructions for use Lyo-Format DETECTION AND QUANTITATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR (Lyo-format) 5645 96 rcs valid from May 2013 Distribué par / Distributed by:
More informationIV2-113E Use by. Invitron Glargine ELISA Kit REF LOT IVD. Definitions. English. For in-vitro diagnostic use. Instructions for use.
Definitions Instructions for use REF Catalogue number IV2-113E Use by English Invitron Glargine ELISA Kit For in-vitro diagnostic use Σ 96 LOT IVD Lot/Batch Code Storage temperature limitations In vitro
More informationCarnitine / Acylcarnitines Dried Blood Spots LC-MS/MS Analysis Kit User Manual
Page 1 / 14 Carnitine / Acylcarnitines Dried Blood Spots LC-MS/MS Analysis Kit User Manual ZV-3051-0200-15 200 Page 2 / 14 Table of Contents 1. INTENDED USE... 3 2. SUMMARY AND EXPLANATION... 3 3. TEST
More informationHIV DNA Qual FRT Real Time Kit
REF TR-V1-D HIV DNA Qual FRT Real Time Kit Key to symbols used List Number Store at 2-8 C/-20 C RUO For Research Use Only Caution! Lot Number VER Version Expiration Date Negative Control Contains reagents
More informationab HIV-1 Protease Inhibitor Screening Kit (Fluorometric)
Version 1 Last updated 2 March 2017 ab211106 HIV-1 Protease Inhibitor Screening Kit (Fluorometric) For the rapid, sensitive and accurate screening of potential HIV-1 Protease inhibitors. This product is
More informationHuman Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationCMV Real-TM Quant. REF List Number Store at 2-8 C/-20 C. RUO For Research Use Only Caution! LOT Lot Number VER Version.
REF TV7-100/2 FRT CMV Real-TM Quant Real Time Kit for use with SmartCycler (Cepheid), RotorGene 3000/6000 (Corbett Research), Applied Biosystems 7300/7500 Real Time PCR Systems (Applera), iq icycler and
More informationattomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!
attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95
More informationMouse C-Peptide ELISA Kit
Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and
More informationRayBio DPP4 Inhibitor Screening Kit
RayBio DPP4 Inhibitor Screening Kit User Manual Version 1.0 Mar 25, 2013 RayBio DPP4 Inhibitor Screening (Cat#: 68SR-DPP4-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationAbbott RealTime HIV-1
E RealTime HIV-1 6L18 51-602146/R2 Abbott RealTime HIV-1 Customer Service: 1-800-553-7042 This package insert must be read carefully prior to use. Package insert instructions must be followed accordingly.
More informationHuman HIV (1+2) antigen&antibody ELISA Kit
Human HIV (1+2) antigen&antibody ELISA Kit Catalog Number. CSB-E18042h For the qualitative determination of human HIV (1+2) antibody and P24 antigen concentrations in serum, plasma. This package insert
More informationHBeAg and HBeAg Ab ELISA Kit
HBeAg and HBeAg Ab ELISA Kit Catalog Number KA0290 96 assays Version: 17 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3
More informationMidi Plant Genomic DNA Purification Kit
Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple
More informationRat Hemoglobin A1c (HbA1c) Kit Instructions
V.3 Crystal Chem Rat Hemoglobin A1c (HbA1c) Kit Instructions For the quantitative determination of hemoglobin A1c (HbA1c) in rat whole blood Catalog #80300 96 Assays For research use only. Not for use
More informationHDV Real-TM Quant Handbook
HDV Real-TM Quant Handbook Real Time PCR Kit for the Quantitative detection of Hepatitis D Virus in human plasma for use with Real Time PCR instruments, like RotorGene 3000/6000/Q (Corbett Research, Qiagen),
More informationHIV-1 Viral Load Real Time (RG)
-1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy
More informationHuman Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.
PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded
More informationHuman Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationCladosporium_spp genesig Standard Kit
TM Primerdesign Ltd Cladosporium_spp genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies
More informationHAV IgG/IgM Rapid Test
HAV IgG/IgM Rapid Test Cat. No.:DTS649 Pkg.Size: Intended use CD HAV IgG/IgM Rapid Test is a solid phase immunochromatographic assay for the rapid, qualitative and differential detection of IgG and IgM
More informationCoQ10(Coenzyme Q10) ELISA Kit
CoQ10(Coenzyme Q10) ELISA Kit Catalogue No.: EU0196 Size: 48T/96T Reactivity: Universal Detection Range: 0.781-50ng/ml Sensitivity:
More informationPKU (Phenylketonuria) Serum HPLC Analysis Kit User Manual
Page 1 / 20 PKU (Phenylketonuria) Serum HPLC Analysis Kit User Manual ZV-4003-0200-10 200 2-8 C Page 2 / 20 Table of Contents 1. INTENDED USE... 3 2. SUMMARY AND EXPLANATION... 3 3. TEST PRINCIPLE... 3
More informationRIDA GENE HLA-B27 PY0205
RIDA GENE HLA-B27 PY0205 R-Biopharm AG, An der neuen Bergstraße 17, 64297 Darmstadt, Germany Phone: +49 (0) 61 51 81 02-0 / Fax: +49 (0) 61 51 81 02-20 1. Intended use For in vitro diagnostic use. With
More informationNo. Reagent Name Specification & Qty Main Ingredients
Product Name Human Immunodeficiency Virus Type 1 RNA Quantitative Fluorescence Diagnostic Kit (PCR-Fluorescence Probing) Packaging Specification 24 tests/kit Intended Use Human Immunodeficiency Virus Type
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationMouse HBsAg(Hepatitis B Virus Surface Antigen) ELISA Kit
Mouse HBsAg(Hepatitis B Virus Surface Antigen) ELISA Kit Catalogue No.: EM0002 Size: 96T Reactivity: Mouse Application: This immunoassay kit allows for the qualitative determination of HBsAg in Mouse serum
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationdesign national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation
Ring Trial Molecular Diagnostics EGFR mutations in NSCLC Series II March 2012 results design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen
More informationHuman Alpha 1 microglobulin ELISA Kit
Human Alpha 1 microglobulin ELISA Kit Catalogue No.: EH4144 Size: 48T/96T Reactivity: Human Range:0.625-40ng/ml Sensitivity:
More informationCanine Thyroid Stimulating Hormone, TSH ELISA Kit
Canine Thyroid Stimulating Hormone, TSH ELISA Kit Catalog No: E0463c 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH
More informationEpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
More informationRealLine HCV Quantitative - Uni-Format
Instructions for use - KIT FOR EXTRACTION OF RNA AND SUBSEQUENT REAL TIME PCR DETECTION AND QUANTIFICATION OF HEPATITIS C VIRUS RNA Attention! Please read the information about quantification process carefully!
More informationHuman influenza A virus subtype (H3) genesig Easy Kit for use on the genesig q reaction. Primerdesign Ltd
TM Primerdesign Ltd Human influenza A virus subtype (H3) genesig Easy Kit for use on the genesig q16 50 reaction For general laboratory and research use only 1 genesig Easy: at a glance guide For each
More informationProcine sphingomyelin ELISA Kit
Procine sphingomyelin ELISA Kit For the quantitative in vitro determination of Procine sphingomyelin concentrations in serum - plasma - celiac fluid - tissue homogenate - body fluid FOR LABORATORY RESEARCH
More informationMicrosart Calibration Reagent
Instructions for Use Microsart Calibration Reagent Prod. No. SMB95-2021 Mycoplasma arginini Prod. No. SMB95-2022 Mycoplasma orale Prod. No. SMB95-2023 Mycoplasma gallisepticum Prod. No. SMB95-2024 Mycoplasma
More informationInstructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600
Instructions for use TSH rat ELISA AR E-8600 TSH rat ELISA 1. INTRODUCTION 1.1 Intended use The TSH rat ELISA is an enzyme immunoassay for the quantitative measurement of TSH in rat serum. For research
More informationartus CMV TM PCR Kit Handbook
artus CMV TM PCR Kit Handbook 24 (catalog no. 4503163) 96 (catalog no. 4503165) Quantitative in vitro Diagnostics For use with the ABI PRISM 7000, 7700, and 7900HT Sequence Detection Systems December 2014
More informationSerum Amyloid A ELISA
Serum Amyloid A ELISA For the quantitative determination of serum amyloid A (SAA) in serum plasma For Research use Only. Not for Use in Diagnostic Procedures Please see Appendix A for Reference Serum information
More informationHuman Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit
Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit Catalog No: E0442h 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH
More informationab HIV-1 Protease Activity Assay Kit
Version 1 Last updated 2 February 2017 ab211105 HIV-1 Protease Activity Assay Kit For the rapid, sensitive and accurate measurement of HIV-1 Protease activity in a variety of samples. This product is for
More informationab HRV 3C Protease Inhibitor Screening Kit (Colorimetric)
Version 2 Last updated 2 March 2017 ab211089 HRV 3C Protease Inhibitor Screening Kit (Colorimetric) For the rapid, sensitive and accurate screening of potential HRV 3C Protease inhibitors. This product
More informationCladosporium_spp genesig Advanced Kit
TM Primerdesign Ltd Cladosporium_spp genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies
More informationaltona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 always a drop ahead. 11/2012
altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Moerkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com
More informationHuman Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
More informationInsulin Aspart ELISA Kit
Insulin Aspart ELISA Kit Catalogue DEIABL215 For the qualitative determination of antibodies to insulin aspart in human serum and plasma FOR RESEARCH USE ONLY Creative Diagnostics. All rights reserved
More informationHuman Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C. genesig PLEX kit. 100 tests. Primerdesign Ltd
Primerdesign Ltd Human Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C genesig PLEX kit 100 tests For general laboratory and research use only 1 Introduction HIV1 & HIV2 Human immunodeficiency
More informationRotavirus Test Kit. Instructions For Use. Format: Cassette Specimen: Fecal Extract Catalog Number: VEL-001-ROTA
Rotavirus Test Kit Instructions For Use Format: Cassette Specimen: Fecal Extract Catalog Number: VEL-001-ROTA * Please read the instructions carefully before use INTENDED USE Velotest Rotavirus Test is
More informationEGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester
EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology
More informationRobert Beer
Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free
More informationHbA1c (Human) ELISA Kit
HbA1c (Human) ELISA Kit Cat. No.:DEIA3509 Pkg.Size:96T Intended use GHbA1c (Human) ELISA Kit is a sandwich enzyme immunoassay for the quantitative measurement of human GHbA1c. General Description vhemoglobin,
More informationLeadCare BLOOD LEAD ANALYZER. Quick Reference Guide
LeadCare II BLOOD LEAD ANALYZER Quick Reference Guide Precautions Precautions Caution The LeadCare II Blood Lead Analyzer is a CLIA-waived device. Facilities that perform tests with the LeadCare II System
More informationMouse C3 (Complement Factor 3) ELISA Kit
Mouse C3 (Complement Factor 3) ELISA Kit Cat. No.:DEIA8289 Pkg.Size:96T Intended use The Mouse C3 (Complement Factor 3) ELISA Kit is a highly sensitive two-site enzyme linked immunoassay (ELISA) for measuring
More informationEBV Real-TM Quant Handbook
IVD For in Vitro Diagnostic Use EBV Real-TM Quant Handbook Real Time PCR Kit for quantitative detection of Epstein Barr Virus (EBV) for use with RotorGene 3000/6000 (Corbett Research), SmartCycler (Cepheid),
More informationIntroduction to Cladosporium_spp
Techne qpcr test Cladosporium_spp 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies are mostly dark green
More informationrespirarna 2.0 real time RT-PCR Kit
Instruction for Use respirarna 2.0 real time RT-PCR Kit For the in-vitro detection of the RNA of Influenzavirus A, Influenzavirus B and Respiratory Syncytial Virus in clinical specimens. G01084-32 G01084-96
More informationVedolizumab Drug Level ELISA
Vedolizumab Drug Level ELISA For the quantitative determination of free Entyvio concentration in human serum and EDTA plasma. Please read carefully due to Critical Changes, e.g., Updates to specificity
More informationRetro-X qrt-pcr Titration Kit User Manual
Takara Bio USA Retro-X qrt-pcr Titration Kit User Manual Cat. No. 631453 PT3952-1 (030218) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United States/Canada
More informationAvian Influenza A H5N8
TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza
More informationAmplisure HBV Quantitative Kit
Amplisure HBV Quantitative Kit (Real Time PCR Kit) QT-HBV-25 QT-HBV-50 QT-HBV-100 : 25 rxns : 50 rxns :100 rxns Product Insert RAS Lifesciences Pvt. Ltd Plot No. 13, 4-7-18/13/2., Raghavendra Nagar, Nacharam,
More informationEXO-DNAc Circulating and EV-associated DNA extraction kit
Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.
More informationRayBio Phenylalanine Fluorometric Assay Kit
RayBio Phenylalanine Fluorometric Assay Kit User Manual Version 1.0 June 25, 2014 RayBio Phenylalanine Fluorometric (Cat#: 68-Phenyl-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service
More informationMALDI Sepsityper Kit
Instructions for Use MALDI Sepsityper Kit Kit for identification of microorganisms from positive blood cultures using the MALDI Biotyper system CARE products are designed to support our worldwide customers
More informationManual innuprep DNA/RNA Virus PLUS Kit - KFFLX
Manual Order No.: 845-.)- reactions 845-.)- reactions Publication No.: HB_KF-5196_e_150414 This documentation describes the state at the time of publishing. It needs not necessarily agree with future versions.
More informationFinTest TM IgG4 Screen 88 ELISA Kit
FinTest TM IgG4 Screen 88 ELISA Kit Cat. No.:DEIA6227 Pkg.Size:96T Intended use The Kit is for the quantitative determination of IgG4 antibodies against 88 Food Allergens in human serum, plasma and capillary
More informationCMV FEP ALA For nucleic acid amplification of CMV DNA and Fluorescence detection with End Point analysis (FEP) on Aladin (Sacace)
REF TV7-00FRT VER 3.0.06 CMV FEP ALA For nucleic acid amplification of CMV DNA and Fluorescence detection with End Point analysis (FEP) on Aladin (Sacace) Key to symbols used REF List Number Store at 2-8
More informationAvian influenza A virus subtype (H5)
TM Primerdesign Ltd Avian influenza A virus subtype (H5) Haemoglutinin H5 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype
More informationEPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Histone H3 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H3 Acetylation Assay Kit is suitable for specifically measuring global
More information