SuperARMS EGFR Mutation Detection Kit

Size: px
Start display at page:

Download "SuperARMS EGFR Mutation Detection Kit"

Transcription

1 SuperARMS EGFR Mutation Detection Kit Detection of 41 mutations in exons Instruction for Use Instruction Version: P1.0 Revision Date: July 2016 Store at -20±5

2 Background For: ADx-EG14 Due to its association with malignancies, epidermal growth factor receptor (EGFR) has become the target of an expanding class of anticancer therapies, such as gefitinib (Iressa) and erlotinib (Tarceva), which are tyrosine kinase inhibitors (TKIs). These drugs work best on patients whose cancer is driven by abnormal EGFR signaling. Lung cancer patients who experienced rapid, durable, complete or partial responses to TKIs therapy have been found to harbor somatic mutations in the EGFR gene. Cancer patients with somatic EGFR mutations have shown an impressive 60% response rate, much higher than that for conventional chemotherapy. Therefore, detection of the EGFR mutation status in tumor tissue is key to offering tailored, personalized treatment to cancer patients. Resistance to therapy, either in the primary tumor or acquired after TKI treatment, is also associated with somatic mutations. Currently, tumor tissue is the most frequent material for EGFR mutation testing, however, for the advanced non-small cell lung cancer (NSCLC) patients, tumor tissue is always difficult to obtain. Peripheral blood of cancer patients frequently contains circulating tumor DNA (ctdna) derived from tumor cells, which has been used to detect tumor-specific alterations. Moreover, blood sampling is minimally invasive, readily accessible, and relatively repeatable. Thus, using blood for EGFR mutation identification and follow-up shows promise. The SuperARMS EGFR Mutation Detection Kit is highly selective and sensitive, detecting 41 of the most common somatic mutations (both activating and resistance-related) in the EGFR gene. Our company s patented technology allows detection of 0.2% - 0.8% mutant DNA in a background of 99.8% % normal DNA, while ensuring that false negatives are minimized. The procedure is easily adapted for use in high-throughput sample processing. The purpose of the kit is to aid physicians and clinical researchers in identifying non-small cell lung cancer patients whose tumors harbor EGFR mutations. Intended Use The SuperARMS EGFR Mutation Detection Kit is a highly sensitive real-time PCR-based test designed to accurately identify 41 EGFR mutations in exons The used DNA is extracted from peripheral blood (plasma or serum). Kit Contents This kit contains sufficient reagents to carry out 12 tests (Table 1). Table 1 Kit Contents Contents Amount P-EGFR Reaction Strips 8 strips P-EGFR Reaction Mix µl*16 P-EGFR Enzyme Mix 40 µl P-EGFR Positive Control 400 µl One 8-tube strip is employed for 2 tests (Table 2). The 19-Del reaction mix can detect the presence of any of 29 deletions in exon 19. The 20-Ins reaction mix can detect the presence of any of 6 insertions in exon 20. The G719X reaction mix can detect the presence of G719A and G719C. Table 2 Mutation Information for Each Strip Tube No. Reagent Supplied Volume (μl) Mutation detected FAM HEX ROX CY Del / L858R Del IC L858R / 1/7

3 2 T790M 10 T790M IC / / 3 G719X / L861Q / S768I 10 G719X IC L861Q S768I 4 20-Ins Ins IC / / 5 19-Del / L858R Del IC L858R / 6 T790M 10 T790M IC / / 7 G719X / L861Q / S768I 10 G719X IC L861Q S768I 8 20-Ins Ins IC / / * IC: Internal Control The reagents are pre-loaded into strips that are compatible with Stratagene Mx3000P /Mx3005P, ABI7500, SLAN-96S instruments. For the transparent strip, the number is marked on the side of each tube. For the milky white strip, one pinhole will lay in the corner of the tab beside tube No.1, and the other pinhole will lay in the middle of the tab beside tube No.8. Equipment and Reagents Not Supplied With Kit 1. Compatible PCR instruments: Stratagene Mx3000P /Mx3005P, ABI7500, SLAN-96S (1) For Stratagene Mx3000P /Mx3005P, if there s low net fluorescence signal (dr) but high background signal (R), please reduce the signal gain setting of instrument properly. (2) For ABI instruments please set up as follows: Reporter Dye: FAM, VIC, ROX, CY5; Quencher Dye: TAMRA; Passive Reference: NONE. (3) For SLAN-96S, please set up as follows: Probe mode: FAM, VIC, ROX, CY5. During the result analysis, open the Preference window and select Absolute Fluorescence Value Normalization in Amplification Curve section. (4) We recommend that all PCR instruments in use should be conducted fluorescence calibration once a year. 2. Sterile, nuclease-free tubes and pipette tips. 3. Dedicated pipettes and filtered pipette tips for handling DNA template. 4. Sterile, nuclease-free H 2 O. Shipping and Storage The kit requires cold-chain-transportation. All contents of the kit should be stored immediately upon receipt at -20±5 in the dark in a constant temperature freezer. Avoid unnecessary freezing and thawing of the contents of the kit. Do not use the reagent after five freeze-thaw cycles. Once opened, this reagent is stable at -20±5 until the expiry. Stability The shelf-life of the kit is eight months when stored under the recommended conditions and in the original packaging. Do not use the kit after the stated expiry date. Specimen Material Human genomic DNA must be extracted from peripheral blood (plasma or serum). Selection of high quality DNA extraction reagents is essential for the kit. We recommend use AmoyDx Circulating DNA kit, Cat No. ADx-BL03. Note: a) The kit requires 10 ml whole blood and the recommended volume of plasma is no less than 4 ml. 2/7

4 b) The plasma should be separated from whole blood within 2 hours, If not, please store the blood sample at 2~8 for no more than 4 hours. We recommend use AmoyDx Cell-free DNA Protection Vacuum Tube (Cat No. ADx-VT01-R) for blood collection. (The collected blood samples are stable for 5~7 days at 4~25 for storage and transportation). c) EDTA is recommended for anticoagulation, avoid using heparin anticoagulant. d) The DNA should be extracted from plasma within 2 hours, if not, please store the plasma at -20±5 for no more than 2 years. e) If the extracted DNA is not used immediately, it should be stored at -20±5 for no more than 3 months. Technological Principles The kit adopts ARMS (Amplification Refractory Mutation System) and real-time PCR technology, which uses novel, proprietary primers and probes in a real-time PCR assay to detect EGFR mutations in human plasma cfdna samples. The mutant EGFR gene DNA is amplified by the specific primers, and detected by the novel probes. A highly validated procedure based on EGFR Taq DNA polymerase contributes to outstanding assay sensitivity and selectivity. Protocol 1. The reaction buffer, dntps, specific oligos and novel probes are pre-loaded in the PCR tubes. 2. The contents in P-EGFR Reaction strip and P-EGFR Reaction Mix formed a mutation detection system and an internal control system. The mutation detection system is used to detect the mutation status of EGFR gene (positive or negative). The internal control system is designed to detect the presence of inhibitors and monitor the accuracy of experimental operation. 3. The P-EGFR Positive Control contains a recombinant gene with EGFR mutations, and normal human genomic DNA. Experimental Procedure 1. Thaw the P-EGFR Positive Control and P-EGFR Reaction Mix at room temperature. When the reagents are completely thawed, mix the reagents by inverting the tube 10 times and centrifuge briefly to collect the contents at the bottom of the tube. 2. Briefly centrifuge P-EGFR Enzyme Mix prior to use. 3. Add 67.5 µl DNA sample, and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. 4. Add 67.5 µl no-template controls (sterile water, NTC), and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. 5. Add 67.5 µl P-EGFR Positive Control, and 2.16 µl P-EGFR Enzyme Mix into µl P-EGFR Reaction Mix. Note: The volumes given for each reaction mix have been optimized and validated. Changing volumes of any reagent may result in a loss of performance. Do not store user-prepared mixes, use immediately. Since Taq DNA polymerase is viscous, please pay attention to the centrifugation and pipetting process. Minimize the contact interface between the pipette tip and Taq DNA polymerase to avoid adding excess enzyme. 6. Mix each solution thoroughly by gently pipetting up and down more than 10 times. Note: avoid vortexing solutions with Taq DNA Polymerase. 3/7

5 7. Centrifuge briefly. 8. Take out the P-EGFR Reaction Strips and centrifuge the strips if there are any reagent droplets in the caps of the PCR tubes. Then briefly uncover the caps prior to use. 9. Transfer 70 µl of above mixed solution to the appropriate PCR tube of the P-EGFR Reaction Strips. Add the solution to the inside of the tube wall above the reagents in the tube. 10. Seal the strips. 11. Spin down the PCR tubes gently or centrifuge them briefly to collect the reagents at the bottom of tubes. Note: this spin or centrifuge step is essential for proper mixing of the reagents. 12. Place the PCR tubes into the real-time PCR instrument. A recommended plate layout is shown in Table 3. Table 3 Suggested PCR Plate Layout Well layout A Sample 1 Sample 3 Sample 5 NTC B Sample 1 Sample 3 Sample 5 NTC C Sample 1 Sample 3 Sample 5 NTC D Sample 1 Sample 3 Sample 5 NTC E Sample 2 Sample 4 Sample 6 PC F Sample 2 Sample 4 Sample 6 PC G Sample 2 Sample 4 Sample 6 PC H Sample 2 Sample 4 Sample 6 PC 13. Carry out real-time PCR using the cycling conditions described in Table 4. Note: The reaction volume is 80 μl per well. Please pack the post-pcr tubes with two disposable gloves and discard properly. Do NOT open the post-pcr tubes to avoid contamination. Table 4 Cycling Parameters Stage Temperature Time Cycles min s s 72 30s 93 40s 60 45s Data collection of FAM, HEX/VIC, ROX, CY s Sample Data Analysis 1. The FAM/ROX/CY5 signals of the mutation detection system indicate the mutation status of the sample. The HEX/VIC signals indicate the internal control status. The internal control amplifies and detects a region of genomic DNA that has no known mutations or SNPs. 4/7

6 2. Ensure the passive reference is unselected, and select single mutation detection for each tube accordingly. It is necessary to choose the reaction wells for positive control, no-template control and sample simultaneously. Then users could adjust the threshold of each amplification curve, and obtain the Ct value of mutant group. 3. The threshold at which the signal is detected above background fluorescence is called the Cycle threshold (Ct). The Ct values used to determine if a sample is positive or negative are based on extensive validation. 4. Assess each NTC Ct value of FAM/ROX/CY5 signals to ensure that there is no positive amplification, if the NTC has positive amplification, the data must be discarded as there is contamination. If the HEX/VIC signal occasionally rises, further analysis could be carried out. 5. In general, the Ct values of FAM/ROX/CY5 signals for P-EGFR Positive Control will be less than 20, but variation may occur due to different threshold settings on different instruments. 6. The Ct value for HEX/VIC signal should be less than 19, otherwise, the DNA sample may contains PCR inhibitors or the DNA amount is insufficient, indicating that the DNA needs to be re-extracted or increase the DNA amount. 7. If the Ct value is less than the corresponding Cut-off value of Ct, the sample is confirmed as positive. Otherwise, the sample is classified as negative or below the detection limit of the kit. (See Table 5) a) The calculation of Ct: Ct = mutant Ct value (FAM/ROX/CY5) internal control Ct value (HEX/VIC). The mutant Ct value indicates the Ct value of the mutant signal from a sample. The internal control FAM Ct value indicates the Ct value of the internal control signal of the sample. Table 5 Result Determination Tube No. FAM ROX CY / Ct Cut-off value 2 8 / / Performance Characteristics 4 11 / / The performance characteristics of this kit were validated on Stratagene Mx3000P /Mx3005P, ABI7500, and SLAN-96S 1. Sensitivity: The kit allows detect % mutant DNA in a background of % normal DNA (Table 6). Table 6 LOD for each EGFR mutation Exon Mutation Base Change Cosmic ID Name % LOD Exon 18 Exon 19 G719A 2156G>C 6239 E-18-M1 0.20% G719C 2155G>T 6253 E-18-M3 0.40% E746_A750del (1) 2235_2249del E-19-M1 0.20% E746_A750del (2) 2236_2250del E-19-M2 0.20% L747_P753>S 2240_2257del E-19-M3 0.60% E746_T751>I 2235_2252>AAT(complex) E-19-M4 0.40% E746_T751del 2236_2253del E-19-M5 0.40% E746_T751>A 2237_2251del E-19-M6 0.20% E746_S752>A 2237_2254del E-19-M7 0.20% E746_S752>V 2237_2255>T(complex) E-19-M8 0.20% E746_S752>D 2238_2255del E-19-M9 0.40% 5/7

7 L747_A750>P 2238_2248>GC(complex) E-19-M % L747_T751>Q 2238_2252>GCA(complex) E-19-M % L747_E749del 2239_2247del E-19-M % L747_T751del 2239_2253del E-19-M % L747_S752del 2239_2256del E-19-M % L747_A750>P 2239_2248TTAAGAGAAG>C(complex) E-19-M % L747_P753>Q 2239_2258>CA(complex) E-19-M % L747_T751>S 2240_2251del E-19-M % Exon 19 Exon 20 Exon 21 L747_T751del 2240_2254del E-19-M % L747_T751>P 2239_2251>C(complex) E-19-M % L747_T751del 2238_2252del E-19-M % L747_S752>Q 2239_2256>CAA E-19-M % E746_T751>V 2237_2252>T E-19-M % E746_T751>T 2236_2253> ACG / E-19-M % L747_A750>P 2239_2250>CCC / E-19-M % L747_K754>QL 2239_2261>CAATT / E-19-M % E746_K754>EQHL 2238_2261>GCAACATCT / E-19-M % E746_S752>EQ 2238_2256>GCAA / E-19-M % E746_A750>QP 2236_2248>CAAC E-19-M % E746_T751>Q 2236_2253>CAA E-19-M % T790M 2369C>T 6240 E-20-M1 0.20% S768I 2303G>T 6241 E-20-M2 0.20% H773_V774insH 2319_2320insCAC E-20-M3 0.40% D770_N771insG 2310_2311insGGT E-20-M4 0.60% V769_D770insASV 2307_2308insgccagcgtg E-20-M5 0.60% D770_N771insSVD 2311_2312insGCGTGGACA E-20-M8 0.40% D770ASVD 2309_2310AC>CCAGCGTGGAT E-20-M9 0.40% H773_V774insNPH 2319_2320insAACCCCCAC E-20-M % L858R 2573T>G 6224 E-21-M1 0.20% L861Q 2582T>A 6213 E-21-M2 0.20% 2. Productivity: The kit can be used to analysis 12 samples maximum. (see Table 7) Table 7 Sample Qty detected with the Kit PCR Run(s) Control Qty Total samples can be detected 2 runs 4 (2 controls/run * 2) 12 4 runs 8 (2 controls/run * 4) 8 3. Accuracy: Accuracy of the kit was established by testing 7 mutant positive reference controls and 8 negative reference controls, the detection concordance rate is 100%. 4. Precision: Precision of the kit was established by performing a certain mutant positive reference control for 10 repeats; all the controls can be detected. Warnings and Precautions 1. Please read the instruction carefully and become familiar with all components of the kit prior to use. 2. The product specified above does not contain any virus, reagent by-product of the same or metabolic by-product of Hepatitis A, B, C, D or HIV. 6/7

8 3. Do not exchange and mix up the kit contents with different batches. 4. The kit and its contents cannot be resold or modified for resale without the written approval of manufacturer. 5. Using other sources of reagents is not recommended. Strictly distinguish the reagents from mixed standard to avoid contamination. Otherwise, false positive may be produced. 6. Do the experiments with attention to prevent exogenous DNA contamination to reagents. It is recommended that users have separate, dedicated pipettes and filtered pipette tips to add DNA template during the preparation of reagents. 7. To optimize the activity and performance, mixtures should always be protected from light to avoid photo bleaching. 8. All the chemicals are potential hazard, only trained professionals could use this kit. Please wear suitable lab coat and disposable gloves. The used kit should be disposed of properly. Notes 1. Symbol for "AUTHORISED REPRESENTATIVE IN THE EUROPEAN COMMUNITY" 2. Symbol for "IN VITRO DIAGNOSTIC MEDICAL DEVICE" 3. Symbol for "KEEP DRY" 4. Symbol for "THIS WAY UP" 5. Symbol for "FRAGILE,HANDLE WITH CARE" Information of European Authorised Representative Wellkang Ltd t/a Wellkang Tech Consulting Suite B, 29 Harley Street, London W1G 9QR United Kingdom References 1. Shama SV, Bell DW, Settleman J, et al; Epidermal growth factor receptor muataions in lung cancer. Nat Rev Cancer, 2007,7(3): Ressel R, Moran T, Queralt C, et al; Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med, 2009,361(10): Mork Ts, Wu YL, Thongprasert S, et al; Gefitinib or carboplatin-paclitaxel in pulmonary ademocarcinoma. N Engl J Med, 2009,361(10): Gazdar AF; Personalized medicine and inhibition of EGFR singnaling in lung cancer. N Engl J Med, 2009, 361(10): Dancey JE; Epidermal growth factor receptor inhibitors in non-small cell lung cancer. Drugs, 2007, 67(8): Kobayashi S, Boggon TJ, Dayaram T, et al; EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med, 2005, 352(8): Yasuda H., S kobayshi, Costa, D. B, et al. EGFR exon 20 insertion mutations in non-small-cell lung cancer: preclinical data and clinical implications. Lancet Oncol,2012, 13(1): e Kimura H, Suminoe M, Kasahara K, et al; Evaluation of epidermal growth factor receptor mutation status in serum DNA as a predictor of response to gefitinib (IRESSA). Br J Cancer, 2007, 97(6): Huang Z, Wang ZJ, Bai H, et al; The detection of EGFR mutation status in plasma is reproducible and can dynamically predict the efficacy of EGFR-TKI. Thoracic Cancer, 2012, 3(4): /7

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

More information

RealLine Mycoplasma genitalium Str-Format

RealLine Mycoplasma genitalium Str-Format Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF MYCOPLASMA GENITALIUM DNA BY REAL-TIME PCR METHOD In vitro Diagnostics () VBD4396 96 Tests valid from December 2018 Rev06_1218_EN Page 1

More information

Pneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual

Pneumocystis Carinii Real Time PCR Kit. For In Vitro Diagnostic Use Only User Manual Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Pneumocystis Carinii Real Time PCR Kit Cat. No.: QD-0082-02 For use with ABI Prism 7000/7300/7500/7900; Smart CyclerII; icycler iq 4/iQ 5; Rotor Gene 2000/3000;

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

Kit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive

Kit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product

More information

Product # Kit Components

Product # Kit Components 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information

More information

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit

Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Revision No.: ZJ0003 Issue Date: Aug 7 th, 2008 Leukemia BCR-ABL Fusion Gene Real Time RT-PCR Kit Cat. No.: TR-0126-02 For use with ABI Prism 7000/7300/7500/7900(96 well); Smart Cycler II; icycler iq 4/iQ

More information

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us. Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com

More information

RealLine HBV / HCV / HIV Str-Format

RealLine HBV / HCV / HIV Str-Format Instructions for use ASSAY KIT FOR THE QUALITATIVE AND DIFFERENTIAL DETECTION OF HEPATITIS B VIRUS DNA, HEPATITIS C VIRUS RNA, AND HUMAN IMMUNODEFICIENCY VIRUS TYPES 1 AND 2 RNA USING THE PCR/RT-PCR METHOD

More information

AmpliX HBV Quantitative

AmpliX HBV Quantitative Instructions for use REAL TIME PCR DETECTION AND QUANTITATION KIT OF HEPATITIS B VIRUS DNA Research Use Only (RUO) (Lyo-format) VBD0595 96 rcs valid from May 2013 Explanation of symbols used in labeling

More information

RealLine HCV Qualitative Str-Format

RealLine HCV Qualitative Str-Format Instructions for use REAL TIME PCR DETECTION KIT FOR THE HEPATITIS C VIRUS RNA (HCV) Research Use Only (RUO) (Str-format) VBD0795 96 Tests valid from: October 2018 Rev05_1018_EN Page 1 of 8 Explanation

More information

RealLine HIV quantitative Str-Format

RealLine HIV quantitative Str-Format Instructions for use DETECTION AND QUANTIFICATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR Research Use Only (RUO) Attention! Please read the information about quantification process carefully!

More information

RealLine HIV qualitative Str-Format

RealLine HIV qualitative Str-Format Instructions for Use REAL TIME PCR DETECTION KIT FOR HUMAN IMMUNODEFICIENCY VIRUS RNA Research Use Only (RUO) RealLine HIV Qualitative (Str-format) VBD0196 96 Tests valid from July 2016 Rev01072016_EN

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information

Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300

Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product

More information

HDV Real-TM. Handbook

HDV Real-TM. Handbook HDV Real-TM Handbook for use with RotorGene 3000/6000 (Corbett Research), SmartCycler (Cepheid), iq icycler and iq5 (Biorad), Applied Biosystems 7300/7500 Real Time PCR Systems (Applera), MX3000P and MX3005P

More information

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended

More information

HBV Real-TM Quant Handbook

HBV Real-TM Quant Handbook HBV Real-TM Quant Handbook Real Time Kit for the Quantitative detection of Hepatitis B Virus in human plasma for use with SmartCycler (Cepheid), RotorGene 3000/6000 (Corbett Research), iq icycler and iq5

More information

Assay Location Primer TaqMan probe Reference

Assay Location Primer TaqMan probe Reference Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original

More information

1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir

1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal

More information

Real Time Kit. Pneumocystis jirovecii (carinii) Real-TM Handbook. for the detection of Pneumocystis jirovecii (carinii) in biological materials

Real Time Kit. Pneumocystis jirovecii (carinii) Real-TM Handbook. for the detection of Pneumocystis jirovecii (carinii) in biological materials IVD For in Vitro Diagnostic Use Pneumocystis jirovecii (carinii) Real-TM Handbook Real Time Kit for the detection of Pneumocystis jirovecii (carinii) in biological materials REF P2-50FRT VER 07.02.2010

More information

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.

More information

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

More information

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.

More information

Storage: Logix Smart Zika Virus Master Mix and Logix Smart Zika Virus Positive Control must be stored at -20 ⁰C and can last up to 60 days.

Storage: Logix Smart Zika Virus Master Mix and Logix Smart Zika Virus Positive Control must be stored at -20 ⁰C and can last up to 60 days. Logix Smart Zika Virus (ZIKV-K-003; ZIKV-PC-003; GEN-NTC-001) Description The Logix Smart Zika Virus Test developed by Co-Diagnostics, Inc. detects ribonucleic acid (RNA) of Zika Virus in a single step

More information

ABIOpure TM Viral (version 2.0)

ABIOpure TM Viral (version 2.0) ABIOpure TM Viral (version 2.0) DNA/RNA Extraction Handbook Cat No: M561VT50 FOR RESEARCH USE ONLY Table of Contents Contents Page Kit Components 3 Precautions 3 Stability & Storage 4 General Description

More information

RealLine HCV quantitative Str-Format

RealLine HCV quantitative Str-Format Instructions for use QUANTITATIVE KIT FOR REAL TIME PCR DETECTION FOR RNA OF HEPATITIS C VIRUS Attention! Please read the information about quantification process carefully! Research Use Only (RUO) (Str

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,

More information

Sputum DNA Collection, Preservation and Isolation Kit 50 Individual Devices

Sputum DNA Collection, Preservation and Isolation Kit 50 Individual Devices 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Sputum DNA Collection, Preservation and Isolation Kit 50 Individual

More information

DETECTION AND QUANTITATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR

DETECTION AND QUANTITATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR Lyo-Format Instructions for use Lyo-Format DETECTION AND QUANTITATION OF THE HUMAN IMMUNODEFICIENCY VIRUS RNA BY REAL TIME PCR (Lyo-format) 5645 96 rcs valid from May 2013 Distribué par / Distributed by:

More information

IV2-113E Use by. Invitron Glargine ELISA Kit REF LOT IVD. Definitions. English. For in-vitro diagnostic use. Instructions for use.

IV2-113E Use by. Invitron Glargine ELISA Kit REF LOT IVD. Definitions. English. For in-vitro diagnostic use. Instructions for use. Definitions Instructions for use REF Catalogue number IV2-113E Use by English Invitron Glargine ELISA Kit For in-vitro diagnostic use Σ 96 LOT IVD Lot/Batch Code Storage temperature limitations In vitro

More information

Carnitine / Acylcarnitines Dried Blood Spots LC-MS/MS Analysis Kit User Manual

Carnitine / Acylcarnitines Dried Blood Spots LC-MS/MS Analysis Kit User Manual Page 1 / 14 Carnitine / Acylcarnitines Dried Blood Spots LC-MS/MS Analysis Kit User Manual ZV-3051-0200-15 200 Page 2 / 14 Table of Contents 1. INTENDED USE... 3 2. SUMMARY AND EXPLANATION... 3 3. TEST

More information

HIV DNA Qual FRT Real Time Kit

HIV DNA Qual FRT Real Time Kit REF TR-V1-D HIV DNA Qual FRT Real Time Kit Key to symbols used List Number Store at 2-8 C/-20 C RUO For Research Use Only Caution! Lot Number VER Version Expiration Date Negative Control Contains reagents

More information

ab HIV-1 Protease Inhibitor Screening Kit (Fluorometric)

ab HIV-1 Protease Inhibitor Screening Kit (Fluorometric) Version 1 Last updated 2 March 2017 ab211106 HIV-1 Protease Inhibitor Screening Kit (Fluorometric) For the rapid, sensitive and accurate screening of potential HIV-1 Protease inhibitors. This product is

More information

Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only

Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus

More information

CMV Real-TM Quant. REF List Number Store at 2-8 C/-20 C. RUO For Research Use Only Caution! LOT Lot Number VER Version.

CMV Real-TM Quant. REF List Number Store at 2-8 C/-20 C. RUO For Research Use Only Caution! LOT Lot Number VER Version. REF TV7-100/2 FRT CMV Real-TM Quant Real Time Kit for use with SmartCycler (Cepheid), RotorGene 3000/6000 (Corbett Research), Applied Biosystems 7300/7500 Real Time PCR Systems (Applera), iq icycler and

More information

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing! attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95

More information

Mouse C-Peptide ELISA Kit

Mouse C-Peptide ELISA Kit Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and

More information

RayBio DPP4 Inhibitor Screening Kit

RayBio DPP4 Inhibitor Screening Kit RayBio DPP4 Inhibitor Screening Kit User Manual Version 1.0 Mar 25, 2013 RayBio DPP4 Inhibitor Screening (Cat#: 68SR-DPP4-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Abbott RealTime HIV-1

Abbott RealTime HIV-1 E RealTime HIV-1 6L18 51-602146/R2 Abbott RealTime HIV-1 Customer Service: 1-800-553-7042 This package insert must be read carefully prior to use. Package insert instructions must be followed accordingly.

More information

Human HIV (1+2) antigen&antibody ELISA Kit

Human HIV (1+2) antigen&antibody ELISA Kit Human HIV (1+2) antigen&antibody ELISA Kit Catalog Number. CSB-E18042h For the qualitative determination of human HIV (1+2) antibody and P24 antigen concentrations in serum, plasma. This package insert

More information

HBeAg and HBeAg Ab ELISA Kit

HBeAg and HBeAg Ab ELISA Kit HBeAg and HBeAg Ab ELISA Kit Catalog Number KA0290 96 assays Version: 17 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3

More information

Midi Plant Genomic DNA Purification Kit

Midi Plant Genomic DNA Purification Kit Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple

More information

Rat Hemoglobin A1c (HbA1c) Kit Instructions

Rat Hemoglobin A1c (HbA1c) Kit Instructions V.3 Crystal Chem Rat Hemoglobin A1c (HbA1c) Kit Instructions For the quantitative determination of hemoglobin A1c (HbA1c) in rat whole blood Catalog #80300 96 Assays For research use only. Not for use

More information

HDV Real-TM Quant Handbook

HDV Real-TM Quant Handbook HDV Real-TM Quant Handbook Real Time PCR Kit for the Quantitative detection of Hepatitis D Virus in human plasma for use with Real Time PCR instruments, like RotorGene 3000/6000/Q (Corbett Research, Qiagen),

More information

HIV-1 Viral Load Real Time (RG)

HIV-1 Viral Load Real Time (RG) -1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy

More information

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01. PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded

More information

Human Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only

Human Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus

More information

Cladosporium_spp genesig Standard Kit

Cladosporium_spp genesig Standard Kit TM Primerdesign Ltd Cladosporium_spp genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies

More information

HAV IgG/IgM Rapid Test

HAV IgG/IgM Rapid Test HAV IgG/IgM Rapid Test Cat. No.:DTS649 Pkg.Size: Intended use CD HAV IgG/IgM Rapid Test is a solid phase immunochromatographic assay for the rapid, qualitative and differential detection of IgG and IgM

More information

CoQ10(Coenzyme Q10) ELISA Kit

CoQ10(Coenzyme Q10) ELISA Kit CoQ10(Coenzyme Q10) ELISA Kit Catalogue No.: EU0196 Size: 48T/96T Reactivity: Universal Detection Range: 0.781-50ng/ml Sensitivity:

More information

PKU (Phenylketonuria) Serum HPLC Analysis Kit User Manual

PKU (Phenylketonuria) Serum HPLC Analysis Kit User Manual Page 1 / 20 PKU (Phenylketonuria) Serum HPLC Analysis Kit User Manual ZV-4003-0200-10 200 2-8 C Page 2 / 20 Table of Contents 1. INTENDED USE... 3 2. SUMMARY AND EXPLANATION... 3 3. TEST PRINCIPLE... 3

More information

RIDA GENE HLA-B27 PY0205

RIDA GENE HLA-B27 PY0205 RIDA GENE HLA-B27 PY0205 R-Biopharm AG, An der neuen Bergstraße 17, 64297 Darmstadt, Germany Phone: +49 (0) 61 51 81 02-0 / Fax: +49 (0) 61 51 81 02-20 1. Intended use For in vitro diagnostic use. With

More information

No. Reagent Name Specification & Qty Main Ingredients

No. Reagent Name Specification & Qty Main Ingredients Product Name Human Immunodeficiency Virus Type 1 RNA Quantitative Fluorescence Diagnostic Kit (PCR-Fluorescence Probing) Packaging Specification 24 tests/kit Intended Use Human Immunodeficiency Virus Type

More information

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based

More information

Mouse HBsAg(Hepatitis B Virus Surface Antigen) ELISA Kit

Mouse HBsAg(Hepatitis B Virus Surface Antigen) ELISA Kit Mouse HBsAg(Hepatitis B Virus Surface Antigen) ELISA Kit Catalogue No.: EM0002 Size: 96T Reactivity: Mouse Application: This immunoassay kit allows for the qualitative determination of HBsAg in Mouse serum

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation

design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen with or without EGFRmutation Ring Trial Molecular Diagnostics EGFR mutations in NSCLC Series II March 2012 results design national external quality control instrument 4 distributions per year 3 unstained slides from 3 resection-specimen

More information

Human Alpha 1 microglobulin ELISA Kit

Human Alpha 1 microglobulin ELISA Kit Human Alpha 1 microglobulin ELISA Kit Catalogue No.: EH4144 Size: 48T/96T Reactivity: Human Range:0.625-40ng/ml Sensitivity:

More information

Canine Thyroid Stimulating Hormone, TSH ELISA Kit

Canine Thyroid Stimulating Hormone, TSH ELISA Kit Canine Thyroid Stimulating Hormone, TSH ELISA Kit Catalog No: E0463c 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH

More information

EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)

EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric) EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)

More information

RealLine HCV Quantitative - Uni-Format

RealLine HCV Quantitative - Uni-Format Instructions for use - KIT FOR EXTRACTION OF RNA AND SUBSEQUENT REAL TIME PCR DETECTION AND QUANTIFICATION OF HEPATITIS C VIRUS RNA Attention! Please read the information about quantification process carefully!

More information

Human influenza A virus subtype (H3) genesig Easy Kit for use on the genesig q reaction. Primerdesign Ltd

Human influenza A virus subtype (H3) genesig Easy Kit for use on the genesig q reaction. Primerdesign Ltd TM Primerdesign Ltd Human influenza A virus subtype (H3) genesig Easy Kit for use on the genesig q16 50 reaction For general laboratory and research use only 1 genesig Easy: at a glance guide For each

More information

Procine sphingomyelin ELISA Kit

Procine sphingomyelin ELISA Kit Procine sphingomyelin ELISA Kit For the quantitative in vitro determination of Procine sphingomyelin concentrations in serum - plasma - celiac fluid - tissue homogenate - body fluid FOR LABORATORY RESEARCH

More information

Microsart Calibration Reagent

Microsart Calibration Reagent Instructions for Use Microsart Calibration Reagent Prod. No. SMB95-2021 Mycoplasma arginini Prod. No. SMB95-2022 Mycoplasma orale Prod. No. SMB95-2023 Mycoplasma gallisepticum Prod. No. SMB95-2024 Mycoplasma

More information

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600

Instructions for use. TSH rat ELISA. Please use only the valid version of the Instructions for Use provided with the kit AR E-8600 Instructions for use TSH rat ELISA AR E-8600 TSH rat ELISA 1. INTRODUCTION 1.1 Intended use The TSH rat ELISA is an enzyme immunoassay for the quantitative measurement of TSH in rat serum. For research

More information

artus CMV TM PCR Kit Handbook

artus CMV TM PCR Kit Handbook artus CMV TM PCR Kit Handbook 24 (catalog no. 4503163) 96 (catalog no. 4503165) Quantitative in vitro Diagnostics For use with the ABI PRISM 7000, 7700, and 7900HT Sequence Detection Systems December 2014

More information

Serum Amyloid A ELISA

Serum Amyloid A ELISA Serum Amyloid A ELISA For the quantitative determination of serum amyloid A (SAA) in serum plasma For Research use Only. Not for Use in Diagnostic Procedures Please see Appendix A for Reference Serum information

More information

Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit

Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit Catalog No: E0442h 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH

More information

ab HIV-1 Protease Activity Assay Kit

ab HIV-1 Protease Activity Assay Kit Version 1 Last updated 2 February 2017 ab211105 HIV-1 Protease Activity Assay Kit For the rapid, sensitive and accurate measurement of HIV-1 Protease activity in a variety of samples. This product is for

More information

ab HRV 3C Protease Inhibitor Screening Kit (Colorimetric)

ab HRV 3C Protease Inhibitor Screening Kit (Colorimetric) Version 2 Last updated 2 March 2017 ab211089 HRV 3C Protease Inhibitor Screening Kit (Colorimetric) For the rapid, sensitive and accurate screening of potential HRV 3C Protease inhibitors. This product

More information

Cladosporium_spp genesig Advanced Kit

Cladosporium_spp genesig Advanced Kit TM Primerdesign Ltd Cladosporium_spp genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies

More information

altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 always a drop ahead. 11/2012

altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 always a drop ahead. 11/2012 altona DIAGNOSTICS altona DIAGNOSTICS RealStar CMV PCR Kit 1.0 11/2012 altona Diagnostics GmbH Moerkenstr. 12 22767 Hamburg Germany phone +49 40 548 06 76-0 fax +49 40 548 06 76-10 e-mail info@altona-diagnostics.com

More information

Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests

Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research

More information

Insulin Aspart ELISA Kit

Insulin Aspart ELISA Kit Insulin Aspart ELISA Kit Catalogue DEIABL215 For the qualitative determination of antibodies to insulin aspart in human serum and plasma FOR RESEARCH USE ONLY Creative Diagnostics. All rights reserved

More information

Human Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C. genesig PLEX kit. 100 tests. Primerdesign Ltd

Human Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C. genesig PLEX kit. 100 tests. Primerdesign Ltd Primerdesign Ltd Human Immunodeficiency Virus Types 1 & 2 and Hepatitis Viruses B and C genesig PLEX kit 100 tests For general laboratory and research use only 1 Introduction HIV1 & HIV2 Human immunodeficiency

More information

Rotavirus Test Kit. Instructions For Use. Format: Cassette Specimen: Fecal Extract Catalog Number: VEL-001-ROTA

Rotavirus Test Kit. Instructions For Use. Format: Cassette Specimen: Fecal Extract Catalog Number: VEL-001-ROTA Rotavirus Test Kit Instructions For Use Format: Cassette Specimen: Fecal Extract Catalog Number: VEL-001-ROTA * Please read the instructions carefully before use INTENDED USE Velotest Rotavirus Test is

More information

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester

EGFR ctdna Testing. Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester EGFR ctdna Testing Andrew Wallace 21/09/2015 Genomic Diagnostics Laboratory St. Mary s Hospital, Manchester ctdna & EGFR Testing in NSCLC EGFR ctdna testing Non-invasive - patients too sick/biopsy or cytology

More information

Robert Beer

Robert Beer Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free

More information

HbA1c (Human) ELISA Kit

HbA1c (Human) ELISA Kit HbA1c (Human) ELISA Kit Cat. No.:DEIA3509 Pkg.Size:96T Intended use GHbA1c (Human) ELISA Kit is a sandwich enzyme immunoassay for the quantitative measurement of human GHbA1c. General Description vhemoglobin,

More information

LeadCare BLOOD LEAD ANALYZER. Quick Reference Guide

LeadCare BLOOD LEAD ANALYZER. Quick Reference Guide LeadCare II BLOOD LEAD ANALYZER Quick Reference Guide Precautions Precautions Caution The LeadCare II Blood Lead Analyzer is a CLIA-waived device. Facilities that perform tests with the LeadCare II System

More information

Mouse C3 (Complement Factor 3) ELISA Kit

Mouse C3 (Complement Factor 3) ELISA Kit Mouse C3 (Complement Factor 3) ELISA Kit Cat. No.:DEIA8289 Pkg.Size:96T Intended use The Mouse C3 (Complement Factor 3) ELISA Kit is a highly sensitive two-site enzyme linked immunoassay (ELISA) for measuring

More information

EBV Real-TM Quant Handbook

EBV Real-TM Quant Handbook IVD For in Vitro Diagnostic Use EBV Real-TM Quant Handbook Real Time PCR Kit for quantitative detection of Epstein Barr Virus (EBV) for use with RotorGene 3000/6000 (Corbett Research), SmartCycler (Cepheid),

More information

Introduction to Cladosporium_spp

Introduction to Cladosporium_spp Techne qpcr test Cladosporium_spp 150 tests For general laboratory and research use only 1 Introduction to Cladosporium_spp Cladosporium is a genus of slow growing fungi, colonies are mostly dark green

More information

respirarna 2.0 real time RT-PCR Kit

respirarna 2.0 real time RT-PCR Kit Instruction for Use respirarna 2.0 real time RT-PCR Kit For the in-vitro detection of the RNA of Influenzavirus A, Influenzavirus B and Respiratory Syncytial Virus in clinical specimens. G01084-32 G01084-96

More information

Vedolizumab Drug Level ELISA

Vedolizumab Drug Level ELISA Vedolizumab Drug Level ELISA For the quantitative determination of free Entyvio concentration in human serum and EDTA plasma. Please read carefully due to Critical Changes, e.g., Updates to specificity

More information

Retro-X qrt-pcr Titration Kit User Manual

Retro-X qrt-pcr Titration Kit User Manual Takara Bio USA Retro-X qrt-pcr Titration Kit User Manual Cat. No. 631453 PT3952-1 (030218) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United States/Canada

More information

Avian Influenza A H5N8

Avian Influenza A H5N8 TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza

More information

Amplisure HBV Quantitative Kit

Amplisure HBV Quantitative Kit Amplisure HBV Quantitative Kit (Real Time PCR Kit) QT-HBV-25 QT-HBV-50 QT-HBV-100 : 25 rxns : 50 rxns :100 rxns Product Insert RAS Lifesciences Pvt. Ltd Plot No. 13, 4-7-18/13/2., Raghavendra Nagar, Nacharam,

More information

EXO-DNAc Circulating and EV-associated DNA extraction kit

EXO-DNAc Circulating and EV-associated DNA extraction kit Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.

More information

RayBio Phenylalanine Fluorometric Assay Kit

RayBio Phenylalanine Fluorometric Assay Kit RayBio Phenylalanine Fluorometric Assay Kit User Manual Version 1.0 June 25, 2014 RayBio Phenylalanine Fluorometric (Cat#: 68-Phenyl-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service

More information

MALDI Sepsityper Kit

MALDI Sepsityper Kit Instructions for Use MALDI Sepsityper Kit Kit for identification of microorganisms from positive blood cultures using the MALDI Biotyper system CARE products are designed to support our worldwide customers

More information

Manual innuprep DNA/RNA Virus PLUS Kit - KFFLX

Manual innuprep DNA/RNA Virus PLUS Kit - KFFLX Manual Order No.: 845-.)- reactions 845-.)- reactions Publication No.: HB_KF-5196_e_150414 This documentation describes the state at the time of publishing. It needs not necessarily agree with future versions.

More information

FinTest TM IgG4 Screen 88 ELISA Kit

FinTest TM IgG4 Screen 88 ELISA Kit FinTest TM IgG4 Screen 88 ELISA Kit Cat. No.:DEIA6227 Pkg.Size:96T Intended use The Kit is for the quantitative determination of IgG4 antibodies against 88 Food Allergens in human serum, plasma and capillary

More information

CMV FEP ALA For nucleic acid amplification of CMV DNA and Fluorescence detection with End Point analysis (FEP) on Aladin (Sacace)

CMV FEP ALA For nucleic acid amplification of CMV DNA and Fluorescence detection with End Point analysis (FEP) on Aladin (Sacace) REF TV7-00FRT VER 3.0.06 CMV FEP ALA For nucleic acid amplification of CMV DNA and Fluorescence detection with End Point analysis (FEP) on Aladin (Sacace) Key to symbols used REF List Number Store at 2-8

More information

Avian influenza A virus subtype (H5)

Avian influenza A virus subtype (H5) TM Primerdesign Ltd Avian influenza A virus subtype (H5) Haemoglutinin H5 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype

More information

EPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Global Histone H3 Acetylation Assay Kit. Base Catalog # P-4008 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Global Histone H3 Acetylation Assay Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Histone H3 Acetylation Assay Kit is suitable for specifically measuring global

More information