Supplementary Information Titles
|
|
- Thomasina Kelley
- 5 years ago
- Views:
Transcription
1 Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry Item & Numer Supplementry Figure 1 Supplementry Figure 2 Supplementry Figure 3 Supplementry Figure 4 Supplementry Figure 5 Supplementry Figure 6 Supplementry Figure 7 Supplementry Figure 8 Supplementry Figure 9 Supplementry Tle 1 Supplementry Tle 2 Supplementry Tle 3 Supplementry Tle 4 Title or Cption Estlishment of CRISPR-Cs9-engineered orgnoids. CRISPR-Cs9-medited introduction of muttions in driver pthwys. Het mps of differentilly expressed genes in engineered orgnoids. Estlishment of lentivirlly engineered orgnoids. Tumour grfts of lentivirlly engineered orgnoids Tumour grfts of CRISPR-Cs9-engineered orgnoids nd CRC orgnoids. Glol gene expression of denom, engineered nd CRC orgnoids. Sequence nlysis of engineered orgnoids. Estlishment of engineered denom orgnoids. Summry of clinicl informtion Gene trgeting efficiency of CRISPR-Cs9 in humn colonic orgnoids. Sequence nlysis of predicted off-trget loci of CRISPR/Cs- 9 edited orgnoids. Oligonucleotides used in this study. AIP Checklist 1
2 Supplementry Figure 1 Orgnoids CRISPR Selection SURVEYOR ssy Trypsiniztion Sequencing Cloning Norml orgnoids Adenom orgnoids CRC orgnoids Norml1 Norml2 Norml3 Ade1 Ade2 Ade3 Ade4 Ade5 CRC1 CRC2 CRC3 CRC4 CRC5 CRC6 CRC7 CRC8 CRC9 CRISPR-Cs9 engineering Lentivirusengineering Lentivirusengineering CRISPRengineering c Norml1 (WR ENA) A (ENA) AST AKST AKSTP (E+TGF+Nut) (None) (MEKi) A: 3 p (SD) del (5/8), 11p del (3/8) S: 3 p (V370) del, lrge ins T: 2 p del (4/8), 2 p del (4/8) K: V12G (direct), P: E545K (5/8) (S.Fig.8) Norml2 (WR ENA) A (ENA) AS AST AKST AKSTP (E+TGF) (E+Nut) (None) (MEKi) A: 1 p del(8/8) S: 2 p ins (4/8), 51 p ins (4/8) T: 1 p del (8/8) K: V12G (direct), P: E545K (3/8) (S.Fig.8c) Supplementry Figure 1: Estlishment of CRISPR-Cs9-Engineered Orgnoids. () Summry of strtegy for CRISPR-Cs9-sed orgnoid engineering. () Summry of clinicl informtion for orgnoids used in this study. R: Rectum, FAP: fmilil denomtous polyposis. (c) Genertion of second nd third line of CRISPR-Cs9-engineered orgnoids. Sequences of del (deletions) nd ins (insertions) re shown in Supplementry Fig. 8,c.
3 Supplementry Figure 2 g h (p) A WT A- A WT A- -ctenin (k) perk WT perk 200 -ctin 2 KI ERK 100 c d (p) 300 S WT S- S WT S- i 200 -ctin 100 * pakt AKT * e f (p) T WT T- T WT T ctin 100 Supplementry Figure 2: CRISPR-Cs9-medited introduction of muttions in driver pthwys. (, c, e) SURVEYOR ssy to detect CRISPR-Cs9-medited clevge t the APC-trgeted (A-), -trgeted (S-) nd -trgeted (T-) orgnoids. WT: Wild type. (, d, f) Western lot nlysis of engineered orgnoids. Expression of -ctenin ( consequence of Wnt ctivtion), nd re indicted. -ctin, loding control. (g) Southern lot nlysis of DNA isolted from control nd KRAS G12V orgnoid clones. Proes for the Southern lot nlyses re indicted in (Fig. 1g). (h) Western lot for phospho-erk nd totl ERK in KRAS WT or KRAS G12V orgnoids. (i) Western lot nlysis of phospho-akt nd totl AKT in KRAS G12V nd KRAS G12V PIK3CA E545K orgnoids. *, non-specific nds.
4 Supplementry Figure 3 Adenom Engineered CRC CA1 REG4 GCG LYZ CHGA PLA2G2A TFF1 TFF2 SPINK4 MUC2 ETV4 TRPM2 EREG KRT Supplementry Figure 3. Het mps of differentilly expressed genes in engineered orgnoids. Gene expression dt of denom orgnoids is dded on the het mps shown in Fig. 2g.
5 Supplementry Figure 4 WR ENA ENA Hygro G418 Puro Zeo Norml Orgnoid 2 B BK BKS BKST BKSTP Lentivirus CTNNB1S33Y KRASG12V PGK-Hygro r KD PGK-Neo r KD PGK-Puro r PIK3CA E545K PGK-Zeo r c d Cont Cont B S33Y Cont K G12V -ctenin perk1/2 S KD -ctin Erk1/2 -ctin e Control KD f Cont P E454K pakt g -ctin Nutlin-3 ENA NA TGF Nutlin3 MEKi Akt BKSTP Supplementry Figure 4: Estlishment of Lentivirlly Engineered Orgnoids. () Selection strtegy for lentivirus-sed engineered orgnoids. Arevitions for overexpressed or knockdown genes were s follows: B, constitutive ctive form of -ctenin; K, KRAS G12V ; S, knockdown (KD) of ; T, KD of ; P, PIK3CAE545K. (-f). Vlidtion of lentivirus-sed engineered orgnoids. () Western lot nlysis illustrtes upregultion of the ctive form of -ctenin in B orgnoids (BS33Y). Cont: wild-type control orgnoids. (c) Downstrem ERK ctivtion in control wild-type KRAS or KRASG12V-trnsduced (K G12V ) orgnoids under EGF removed culture conditions. Western lot nlyses of the phosphorylted form of ERK1/2 (perk) nd totl ERK protein. (d) Knockdown of protein. Nutlin-3 tretment induced protein in wild-type orgnoids. The effect of Nutlin-3 ws olished in knockdown ( KD ) orgnoids. (e) Knockdown of protein in -shrna trnsduced orgnoids (S KD ). (f) Downstrem PI3 kinse ctivtion in control wild-type PIK3CA or PIK3CA E545K -trnsduced orgnoids under EGF removed culture conditions. Western lot nlyses of the phosphorylted form of Akt (pakt) nd totl Akt protein. (g) Response to niche modulted culture conditions (See Figure 2B for the revitions) in BKSTP-orgnoids.
6 Supplementry Figure 5 1M 2M 25 B 20 1M 2M BK BKS BKST GFP re (mm 2 ) BKSTP 0 B BK BS BT BKS BKST BKSTP c HE PAS Ki67 KRT20 Supplementry Figure 5: Tumour Grfts of Lentivirlly Engineered Orgnoids () Photogrphs of representtive tumours derived from indicted orgnoids in kidney sucpsules of NOG mice. Xenotrnsplnted tumours re lelled y EGFP. Tumours were isolted 1 month (1M) or 2 months (2M) fter trnsplnttion. Scle r = 5 mm. () The verge surfce re of xenogrfts derived from orgnoids indictes the tumour size t 1 or 2 months fter trnsplnttion (n=4). Error rs indicte s.e.m. (c) Histochemicl nlysis of BKSTP-orgnoids isolted 1 month fter the trnsplnttion. Indicted stining ws shown. KRT: cytokertin 20.
7 Supplementry Figure 6 HE Ki67 PAS CK20 AKST 1M CRC 1M HE -ctenin CK20 Supplementry Figure 6: Tumour Grfts of CRISPR-Cs9-Engineered Orgnoids nd CRC Orgnoids. Representtive histochemicl nlysis of kidney sucpsule xenogrfts derived from AKST-orgnoids () or CRCorgnoids () isolted 1 month fter trnsplnttion. Indicted stining ws shown. KRT20: cytokertin 20. Scle r = 500 m
8 Supplementry Figure 7 Adenom/Engineered Ade CIN TSP 2000 CRC PC Ade 0 Ade CIN TS Ade CIN TSK PC1 Supplementry Figure 7: Glol gene expression of denom, engineered nd CRC orgnoids. PCA nlysis including gene expression of Ade CIN TSK- nd Ade CIN TSP- orgnoids (grey). Engineered orgnoids from norml epithelium (lue), Adenom orgnoids (red) nd CRC orgnoids (rown) were indicted. Arrows indicte engineering from prentl denom orgnoids.
9 Supplementry Figure 8 APC APC 7 p (SD) del (8/8) 3 p (V371) del (3/6) 2 p del (3/6) 1 p ins (4/8) 18 p del (4/8) 3 p (SD) del (5/8) 11 p del (3/8) 3 p (V370) del (8/8) p ins (8/8) 2 p del (4/8) 2 p del (4/8) c APC 1 p del (8/8) 2 p ins (4/8) 51 p ins (4/8) 1 p del (8/8) d N369K/V370 del (8/8) 1 p del (3/6) 2 p del (3/6) e 3 p del NV369N (4/8) 1 p del (4/8) 1 p del (8/8) Supplementry Figure 8. Sequence nlysis of engineered orgnoids. (-c) Sequences of AKSTP orgnoids shown in Fig. 2 nd Supplementry Fig.1c. (d, e) Sequences of Ade ST orgnoids (d) or Ade CIN TSK orgnoids (e) shown in Fig. 4. SD: splicing donor sites, del: deletion, ins: insertion (underlined). Trget regions were mplified y PCR nd sucloned to E. Coli. Indicted numer of suclones were sequenced. Note tht V370 is in conserved loop/helix region of MH2 domin nd criticl for TGF-/BMP signlling (Shi, Y., Ht, A., Lo, R.S., Mssgue, J. & Pvletich, N.P. A structurl sis for muttionl inctivtion of the tumour suppressor Smd4. Nture 388, (1997))
10 Supplementry Figure 9 Adenom1 (ENA) Lentivirus Ade 1 T (Puro) Ade 1 TS (Neo) Ade 1 TSK (Hygro) Adenom 2 (ENA) CRISPR Ade 2 TSK (EGFRi+TGF+Nut) Adenom1 Ade 1 TSK Ade 2 TSK c Are of metstses log (mm 2 ) ATKSP Adenom Ade T Ade S Ade ST Ade CIN TS Ade CIN TSP Ade CIN TSK CRC Adenom1 Ade 1 TSK Ade 2 TSK Supplementry Figure 9. Estlishment of engineered denom orgnoids. () Selection strtegy of second nd third line of engineered denom orgnoids. () Photogrphs of representtive tumours derived from indicted orgnoids in kidney sucpsules of NOG mice. Xenotrnsplnted tumours re lelled y EGFP. Tumours were isolted 1 month (1M) fter trnsplnttion. Scle r = 5 mm. (c) Dt of metstsized lesions from Adenom1, Ade1TSK nd Ade2TSK orgnoids is dded on the sctter plot shown in Fig. 4e. Plots represent EGFP + re of metstsized lesions in liver. n=4 mice per genotype.
11 Supplementry Tle 1 Ptient Tumor Ptient Clinicl Tumor Ptient Prior Orgnoid ID ID Loction Disese Stge Histology Sex tretment #1 CRC1 R CRC Stge IV Moderte F None #1 CRC2 R CRC Stge IV Moderte F None #1 CRC3 Liver CRC Stge IV Moderte F None #2 CRC4 Liver CRC Stge IV Moderte M None #3 CRC5 R CRC Stge IV Moderte F None #4 CRC6 Distl CRC Stge IIIA Well M None #5 CRC7 Proximl CRC Stge IIA Moderte F None #6 CRC8 Proximl CRC Stge II Moderte M None #7 CRC9 Distl CRC Stge I Well M None #8 Adenom1 (Ade1) Colon NS FAP F None #9 Adenom2 (Ade2) Colon NS FAP F None #10 Adenom3 (Ade3) Colon NS FAP M None #11 Adenom4 (Ade4) Colon NS FAP M None #11 Adenom5 (Ade5) Colon NS FAP M None #12 Norml1 Proximl CRC Stge 0 F None #13 Norml2 Distl CRC Stge 0 M None #10 Norml3 Colon NS FAP M None Supplementry Tle 1. Summry of Clinicl Informtion. NS: not specified. F: femle, M: Mle.
12 Supplementry Tle 2 Recipient Cells CRISPR/Cs9 No. of electroported cells Ave. no. of recovered orgnoids (n=3) Ave. no. of selected orgnoids Correctly trgeted clones Norml PiggyBc-GFP-Puro/APC (+Puro) N.A. Norml PiggyBc-GFP-Puro/APC (-Wnt) 3/3 Norml APC (-Wnt) 3/3 Norml APC/ 1x10 5 N.A. 2 (-Wnt/+BMP4) 2/2 A PiggyBc-GFP-Puro/ (+Puro) N.A. A PiggyBc-GFP-Puro/ (+Nutlin) 2/2 A KRAS (Knock-in) 1x10 5 N.A. 3 (+EGFRi) 3/3 AKST PIK3CA (Knock-in) 1x10 5 N.A. 3(+EGFRi/MEKi) 2/3 Supplementry Tle 2. Gene Trgeting efficiency of CRISPR-Cs9 in humn colonic orgnoids. Summry of the genome engineering efficiency. Indicted numer of dissocited cells from Norml, A-orgnoids or AKSTorgnoids were electroported with indicted sgrna. The experiments were performed in triplicte nd verge numer (Ave. No.) of recovered orgnoids ± s.e.m is shown. After electroportion, round 1-5 % of electroported cells were recovered. In some experiments, Piggy-Bc GFP-Puro vectors were co-electroported to determine the efficiency of gene introduction. The ntiiotics - or niche fctor- selected orgnoids were verified y Snger sequencing nlysis.
13 Supplementry Tle 4 mirna trget sequence mirna #1 mirna #2 mirna #1 mirna #2 TCCACTACAACTACATGTGTA AGTCTGTGACTTGCACGTACT GGTGTGCAGTTGGAATGTAAA GGTGGAGAGAGTGAAACATTT CRISPR trget sequence APC CRISPR CRISPR #1 CRISPR #2 CRISPR KRAS CRISPR PIK3CA CRISPR GGCAACTTCTGGTAATGGTC AGG GCTGAAGATGGCCGTTTTGG TGG GTCAACTCTCCAATGTCCAC AGG GAATGAGGCCTTGGAACTCA AGG GCATTTTTCTTAAGCGTCGA TGG TCTCTCTGAAATCACTGAGC AGG Donor ssoligo PIK3CA Donor ssoligo (nti-sense) AGCACTTACCTGTGACTCCATAGAAAATCTTTCTCtTGCTtgGTGATTTC Primers for SURVEYOR Assy APC SURVEYOR-F APC SURVEYOR-R #1 SURVEYOR-F #1 SURVEYOR-R #2 SURVEYOR-F #2 SURVEYOR-R SURVEYOR-F SURVEYOR-R CGACCGCCAATCGTACTGGAGG GACAGCACATTGGTACTGAATGC TATAAAAGCAAATTAACCCATGT TTACAAAAAATACTGAAAAGCAC GAGAGACATTTAAGGTTCC ACAATTAAGATGGAGTGCT CAGCTGTATAGGTACTTGAAGTGCAGTTT CAATGAGATGGGGTCAGCTGCCTTTG Supplementry Tle 4: Oligonucleotides used in this study.
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationCRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus
CRISPR/Cs9: An inexpensive, efficient loss of function tool to screen humn disese genes in Xenopus Frgment nlysis to test the efficcy of CRISPR Cs9 protein is more effective nd less toxic CRISPR/Cs9 provides
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationUnique roles of the unfolded protein response pathway in fungal. development and differentiation. Kwang Woo Jung, Yee Seul So, & Yong Sun Bahn *
Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationSupplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.
Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p
More informationSUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationK-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF
shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)
More informationSupplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationSupplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationSUPPLEMENTARY INFORMATION
Supplementry Tble 1. Sttistics of dt sets nd structure refinement PYL1 po PYL2/ABA PYL2 po PYL2/ABA/HAB1 PDB code 3KAY 3KAZ 3KB0 3KB3 Dt collection APS bem line 21-ID 21-ID 21-ID 21-ID Spce group P6 5
More informationmir-212 and mir-132 are required for epithelial stromal interactions necessary for mouse mammary gland development
mir-212 nd mir-132 re required for epithelil stroml interctions necessry for mouse mmmry glnd development Ahmet Ucr 1,5, Vid Vfizdeh 2, Huertus Jrry 3, Jn Fiedler 4, Petr A B Klemmt 2, Thoms Thum 4, Bernd
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationSUPPLEMENTARY INFORMATION
Synthesis of ONC-101 nd Derivtives: The imidzo-pyrzine Synthesis The synthesis of imidzo[1,2-]pyrzines is simple three-component-one-pot rection s shown in Scheme 1: Scheme 1: The synthesis of imidzo[1,2-]pyrzines
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture73 Glucose SSP THF Methyl- THF Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA Cycle Glucose p53 p Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Overview of the transplant procedure and supplementary data to Figure 1. a. Under isofluorane anesthesia, the lumen of the colon is washed by a gentle PBS enema. b. Using a p200
More informationDefective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationLETTERS. Foxp3 occupancy and regulation of key target genes during T-cell stimulation
Vol 44 Ferury 007 doi:./nture047 occupncy nd regultion of key trget genes during T-cell stimultion Alexnder Mrson, *, Krsten Kretschmer 6,7 *, Grrett M. Frmpton,, Elizeth S. Jcosen, Juli K. Polnsky 6,
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
Supplementry Informtion Supplementry Figure legends Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. The hrored domins, their puttive cytologicl functions, nd
More information* * A3027. A4623 e A3507 A3507 A3507
a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary
More informationresidual wild type band (Supplementary Fig. 5c) that may be explained by the presence of
doi:1.138/nture9387 Supplementry Text RANK deletion in tumors nd Cre effects. Southern lotting of the tumors tht developed in RANK mm femles showed deletion of RANK, leit we oserved some residul wild type
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationFoxP3 + regulatory CD4 T cells control the generation of functional CD8 memory
Received Fe Accepted 6 Jul Pulished 7 Aug DOI:.8/ncomms99 FoxP + regultory CD T cells control the genertion of functionl memory M.G. de Goër de Herve,,, S. Jfour,,, M. Vllée, & Y. Toufik, During the primry
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More informationStudy of Stress Distribution in the Tibia During Stance Phase Running Using the Finite Element Method
Ksetsrt J. (Nt. Sci.) 48 : 729-739 (2014) Study of Stress Distriution in the Tii During Stnce Phse Running Using the Finite Element Method Thepwchr Ruchirh 1, Tumrong Puttpitukporn 1, * nd Siriporn Ssimontonkul
More informationOvercoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme
Cittion: Moleculr Therpy Nucleic Acids (214) 3, e15; doi:1.138/mtn.214.3 214 The Americn Society of Gene & Cell Therpy All rights reserved 2162-2531/14 www.nture.com/mtn Overcoming T79M-sed Tyrosine Kinse
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationSupplementary material for the manuscript
Supplementary material for the manuscript Title: CD200-positive cancer associated fibroblasts augment the sensitivity of Epidermal Growth Factor Receptor mutation-positive lung adenocarcinomas to EGFR
More informationDifferential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation, and tumor progression in the colon
SUPPLEMENTARY INFORMATION Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation, and tumor progression in the colon Kevin M. Haigis, Krystle Kendall, Yufang Wang, Ann Cheung,
More informationPlatelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection
Vol 455 18 Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More information11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More information308 nm excimer lamp in combination with topical tacrolimus: A retrospective study of its efficacy and safety in childhood vitiligo
ORIGINAL ARTICLE 308 nm excimer lmp in comintion with topicl tcrolimus: A retrospective study of its efficcy nd sfety in childhood vitiligo BS Chndrshekr, N Shoh, P Deprtment of Dermtology, Cutis, Acdemy
More informationVEGFR-3 controls tip to stalk conversion at vessel fusion sites by reinforcing Notch signalling
R T I C L E S EGFR-3 controls tip to stlk conversion t vessel fusion sites y reinforcing Notch signlling Tuoms Tmmel 1,9, Georgi Zrkd 1,9, Hrri Nurmi 1, Lrs Jkosson 2,10, Krist Heinolinen 1, Denis Tvorogov
More informationLRH-1 Mitigates Intestinal Inflammatory Disease by Maintaining Epithelial Homeostasis and Cell Survival
Epithelil Renewl iorxiv preprint first posted online My., 8; doi: http://dx.doi.org/./. The copyright holder for this preprint (which ws not LRH- Mitigtes Intestinl Inflmmtory Disese y Mintining Epithelil
More informationCritical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model
Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationIdentification and selective expansion of functionally superior T cells expressing chimeric antigen receptors
Identifiction nd selective expnsion of functionlly superior T cells expressing chimeric ntigen receptors The Hrvrd community hs mde this rticle openly vilble. Plese shre how this ccess benefits you. Your
More information