RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
|
|
- Antony Robinson
- 5 years ago
- Views:
Transcription
1 Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions. 2 µg of total RNA was used for cdna synthesis with random hexamers. For RT-PCR amplification of HOXB7, an initial amplification using HOXB7 primers was done with a denaturation step at 95 C for 10 min, followed by 28 cycles of denaturation at 95 C for 1 min, primer annealing at 55 C for 30 s, and primer extension at 72 C for 45s. Upon completion of the cycling steps, a final extension at 72 C for 5 min was done and then the reaction was stored at 4 C. Real-time PCR was carried out using an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Reactions were run in triplicate in three independent experiments. The geometric mean of housekeeping gene GAPDH was used as an internal control to normalize the variability in expression levels. The primer sequences are provided in Supplemental table 1. Expression data were normalized to the geometric mean of housekeeping gene GAPDH to control the variability in expression levels and were analyzed using the 2 -ΔΔCT method described by Livak and Schmittgen (1). Immunohistochemistry (IHC). IHC staining and scoring were done as previously described (2). Tissue sections were incubated with polyclonal mouse antibody against HOXB7 (Sigma-Aldrich, MO) at dilutions of 1:200 overnight at 4. For negative controls, the mouse anti-hoxb7 antibody was replaced with normal nonimmune
2 serum. The cells at each intensity of staining were recorded on a scale of 0 (no staining), 1 (weak staining = light yellow), 2 (moderate staining = yellowish brown), and 3 (strong staining = brown). An intensity score of 2 with at least 50% of malignant cells with positive HOXB7 staining was used to classify tumors with high expression, and < 50% of malignant cells with nuclear staining or < 2 intensity score classified tumors with low expression of HOXB7. Mouse anti-ki-67 monoclonal antibody (Dako, Copenhagen, Denmark) was used to evaluate the Ki-67 labeling index, which was calculated as the positive tumor nuclei divided by the total number tumor cells in each case. The cut-off value was based on a measurement of heterogeneity with a log-rank test statistical analysis with respect to overall survival. Using this assessment system, 30% was identified as an optimal cutoff value for Ki-67 labeling index. 3-(4,5 -Dimethyl-2-thiazolyl)-2,5 -diphenyl-2h-tetrazolium bromide (MTT) assays. Cells were seeded on 96-well plates at initial density of ( /well). At each time point, The cells were stained with 100μl sterile MTT dye (0.5 mg/ml, Sigma-Aldrich, MO) at each time point for 4 h at 37ºC followed by removal of the culture medium and addition of 150 μl of dimethyl sulphoxide (DMSO) (Sigma-Aldrich, MO). The absorbance was measured at 570 nm, with 655 nm as the reference wavelength. All experiments were performed in triplicates. The data were analyzed by factor analysis and one-way ANOVA. Cell cycle analysis. Cell cycle distribution was examined by measuring the cellular DNA content using flow cytometry. Cells at 80-90% confluence were incubated for
3 36 h in the RPMI-1640 medium containing 0.5% FBS, then released through culturing back in RPMI-1640 medium with 10% FBS for 12 h. 1x10 6 cells were collected and fixed with 70% cold ethanol. After treated with RNase A (10 μg/ml) for 30 minutes at 37 C, the cells were resuspended in 0.5 ml propidium iodide (PI) solution (50 μg/ml in 0.1% sodium citrate with 0.1% NP-40). Cell cycle distribution was analyzed by FACScan cytometry (Becton-Dickinson, San Jose, CA, USA). References: 1. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25: Liao WT, Wang X, Xu LH, et al. Centromere protein H is a novel prognostic marker for human nonsmall cell lung cancer progression and overall patient survival. Cancer 2009;115:
4 Supplementary Table Supplementary Table S1. Primer Sequences Used for Reverse Transcription-Polymerase Chain Reaction (PCR) and Real-time Quantitative Reverse Transcription-PCR (5' to 3') Gene Forward primer Reverse primer Probe RT-PCR HOXB7 AGAGTAACTTCCGGATCTA TCGGCTTCAGCCCTGTCTT GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCAC HOXB7 AGAGTAACTTCCGGATCTA CAGGTAGCGATTGTAGTG FAM-ACCCCTGGATGCGAAGCTCA-TAMRA Real-time PCR p27kip1 CCGGTGGACCACGAAGAGT GCTCGCCTCTTCCATGTCTC FAM-AACCCGGGACTTGGAGAAGCACTGC-TAMRA cyclind1 CCGTCCATGCGGAAGATC ATGGCCAGCGGGAAGAC FAM-CTTCTGTTCCTCGCAGACCTCCAGCAT-TAMRA GAPDH GACTCATGACCACAGTCCATGC AGAGGCAGGGATGATGTTCTG FAM-CATCACTGCCACCCAGAAGACTGTG-TAMRA
5 Supplementary Table S2. Correlation between Clinicopathologic Features and HOXB7 expression in CRC Characteristics HOXB7 Expression Low High Age mean(56) > mean (56) Gender Male Female Histology Columnar adenocarcinoma Mucinous adenocarcinoma Others 11 7 Pathologic stage ~ Dukes Stage A 14 2 B C D T stage 1~ N stage Distant metastasis 0 (no) (yes) Ki-67 labeling index <30% % P <
6 Supplementary Table S3. Univariate and Multivariate Analyses of HOXB7 expression level in different prognostic parameters in patients with CRC using Cox Regression model Variable T stage Pathologic stage HOXB7 Category No. Patients 1~ ~4 44 Low 103 High 121 Univariate analysis P Regression Coefficient (S.E) P Multivariate analysis Relative Risk 95% Confidence Interval < (0.183) < < (0.177) < (0.225)
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationEffects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells
Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationBin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationEffect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63
68 Chin J Cancer Res 22(1):68-72, 2010 www.springerlink.com Original Article Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 Jing-Wei Wang 1, Yi Liu 2, Hai-mei Tian 2, Wei
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationTitle page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationMicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction
www.muthjm.com Muthanna Medical Journal 2016; 3(1):23-33 MicroRNA-92gene expression in epithelial ovarian cancer using a novel Real-Time Polymerase change reaction Shoroq Mohammed AL-Temimi 1* Abstract
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationIn-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis aubl
ISSN: 2319-7706 Volume 3 Number 10 (2014) pp. 169-176 http://www.ijcmas.com Original Research Article In-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis
More informationSilibinin Is an Inhibitor of mir-24-3p Gene Expression in T47D Breast Cancer Cell Line
World Journal of Biochemistry and Molecular Biology 2016; 1(2): 6-10 http://www.aascit.org/journal/wjbmb Silibinin Is an Inhibitor of mir-24-3p Gene Expression in T47D Breast Cancer Cell Line Fatemeh Khaloozade
More informationAnnals of Oncology Advance Access published January 10, 2005
Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g
More informationCell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319,
Supplementary Materials and Methods Cell lines and tissue samples. The 18 human NSCLC cell lines used in this study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319, NCI-H1373, PC-3, PC-9,
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationSupporting Information
Supporting Information Bertolini et al. 10.1073/pnas.0905653106 SI Text Lung Tissue Disaggregation. Solid tissues were finely minced by razorblade, washed in DMEM/F12 (Lonza), and then incubated with Accumax
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationData Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621
Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T
More informationFigure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
More information8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES
8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES 8.1. Introduction Nanobiotechnology, an emerging field of nanoscience, utilizes nanobased-systems for various biomedical applications.
More informationSerum mirna expression profile as a prognostic biomarker of stage II/III
Serum mirna expression profile as a prognostic biomarker of stage II/III colorectal adenocarcinoma Jialu Li a,b,, Yang Liu c,, Cheng Wang d,, Ting Deng a,, Hongwei Liang b, Yifei Wang e, Dingzhi Huang
More informationSupplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
More informationIN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS
292 Tang, An, Du, Zhang, Zhou 292 IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS Qin-qing Tang, a Xiao-jing An, a Jun Du, a Zheng-xiang Zhang, a Xiao-jun Zhou a
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationRNA preparation from extracted paraffin cores:
Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationThe levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
More informationMolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.
Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationMesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationHopkins University, Howard Hughes Medical Institute, USA) (27). Cells were maintained in DMEM
Supplementary Materials and Methods Cell Culture HCT116 (TP53 +/+ and TP53 -/- ) cells were provided by Dr. Bert Vogelstein (Johns Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells
More informationA role of ghrelin in canine mammary carcinoma cells proliferation, apoptosis and migration
Majchrzak et al. BMC Veterinary Research 2012, 8:170 RESEARCH ARTICLE Open Access A role of ghrelin in canine mammary carcinoma cells proliferation, apoptosis and migration Kinga Majchrzak 1, Karol M Pawłowski
More informationSupplementary Data. Different volumes of ethanol or calcium solution were slowly added through one of four
Supplementary Data METHODS Liposome preparation Different volumes of ethanol or calcium solution were slowly added through one of four methods: Method I, no ethanol or calcium solution; Method II, exactly
More informationRESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells
RESEARCH COMMUNICATION sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells Wei-Yi Huang, Dong-Hui Chen, Li Ning, Li-Wei Wang* Abstract
More informationIN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS
CHAPTER 3 IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS 3. INTRODUCTION Plants are the basic source of knowledge of modern medicine. Almost all the parts of the plant, namely
More informationThe effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,
More informationSupplemental Information
Supplemental Information Supplemental Experimental Procedures: Tissue culture and cell lines Cell culture was conducted as described earlier (Wang et al., 2011). PA-1 and MCF7 were maintained in Eagle's
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationHuman Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
More informationBy: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationRESEARCH ARTICLE. Comparative Evaluation of Silibinin Effects on Cell Cycling and Apoptosis in Human Breast Cancer MCF-7 and T47D Cell Lines
RESEARCH ARTICLE Comparative Evaluation of Silibinin Effects on Cell Cycling and Apoptosis in Human Breast Cancer MCF-7 and T47D Cell Lines Zohreh Jahanafrooz 1, Nasrin Motameh 1 *, Behnaz Bakhshandeh
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationRotavirus A. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
More informationSupplementary Information
Supplementary Information Pazopanib reveals a role for tumor cell B-Raf in the prevention of HER2+ breast cancer brain metastasis. Brunilde Gril 1, Diane Palmieri 1, Yong Qian 1, DeeDee Smart 2, Lilia
More informationReport on the Development of HP8 a Natural Herbal Formulation for Prostate Health
P. G. Waterman Product Development Report for HP8 page 1 Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health Prepared for InterHealth Biosciences Australia (IBA) by Professor
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-RNA Miniprep Kit Catalog Nos. R1054 & R1055 Highlights High-quality total RNA (including small RNAs) from a wide range of samples. You can opt to isolate small and large RNAs in
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-RNA Miniprep Kit Catalog Nos. R1054 & R1055 Highlights High-quality total RNA (including small RNAs) from a wide range of samples. You can opt to isolate small and large RNAs in
More informationThis chapter deals with the evaluation of alpha amylase inhibitory
This chapter deals with the evaluation of alpha amylase inhibitory activity of different extracts isolated from leaves of Aloe vera L. and leaves of Azadiracta indica A Juss. collected from Bharatpur and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationPrevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang
Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with
More informationElectronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating
More informationA COH protocol with human recombinant FSH (Gonal-F, Merck Serono S.A., Madrid,
Supplemental Methods Detailed protocol for controlled ovarian stimulation A COH protocol with human recombinant FSH (Gonal-F, Merck Serono S.A., Madrid, Spain) was initiated on menstrual cycle day 2 at
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationA novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset:
A novel isothermal amplification approach for rapid identification of BCR-ABL fusion genes at onset: Josh Glason: Sales Manager, DiaSorin Australia Pty Ltd September 6, 2014 This product is not currently
More informationJournal of Chemical and Pharmaceutical Research, 2017, 9(12): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2017, 9(12):30-34 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 Evaluation of Anticancer Activity of Alphonsea Sclerocarpa
More informationProthrombin (Human) ELISA Kit
Prothrombin (Human) ELISA Kit Catalog Number KA0496 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More informationIL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells
IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More information