Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Transcription

1 Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving cells Profiling lncrns by comparing to the same population before selection Re-introduce enriched grns into MCF-7 cells and repeat above steps Supplementary figure 1 Screening procedure

2 Relative K level K SM Vector Relative expression level S S C Supplementary figure 2 Identification of potential lncrn for activation by screening SM lncrn library., Five lncrns were identified as candidates. S, before selection; S, after selection., K SM grns increase the endogenous K level. C, K SM grns confer resistance to puromycin.

3 Relative K level Relative K level C p T Supplementary figure 3 &, Effect of ectopic expression of K23948 and K sirn on K23948 expression, as determined by qrt-pcr. C, K sirn2 also suppresses activity.

4 Marker Vector Relative K level ~2.8 kb grn-1 K23948 grn GGTTTTGTCCCTTCTGGG CTCTCGTGGTGTCCC GGTGTCCTTGTGCCGGCCGG CCCTGGCCGTGCCGGTCC 3 bp 2 bp 1 bp K23948 KO #13 #28 #32 18 bp C ** D GGCCGCTGGGGGTTTTGTCCCTTCTGGG K GGTGTCCTTGTGCCGGCCGGGTCTGTGGGGGTCTGTGGTGCCTCTCTG GGCCGCTGGGGGTT. GTCTGTGGTGCCTCTCTG GGCCGCTGGGGGTTTTGTCCCTT GCCGGGTCTGTGGGGGTCTGTGGTGCCTCTCTG WT KO#13 KO#28. GGCCGCTGGG. TCTGTGGTGCCTCTCTG KO#32 Supplementary figure 4 Generation of K23948 knockout by CRISPR/Cas9., Knockout strategy with grn sequences. Relative positions of primers (5.1/3.1) used for genomic PCR and qrt-pcr, and those used to detect deletions (5.2/3.2) are shown under K sequence., Identification of KO clones by genomic PCR. C, Detection of K23948 in KO clones by qrt-pcr. D, Nucleotide sequences of three clones involving deletions.

5 Relative SL level Relative level of K C ppdk1 PDK n.s. K KO# ppdk1 p T473 GGDH Rescue in KO#13 PDK1 KO#13 Supplementary figure 5, Relative expression of K23948 after KO (#13) or rescue (top) and its effect on activity (bottom)., K KO (#13) suppresses PDK1 activity (top) whereas re-expression of K23948 restores PDK1 activity (bottom). C, K23948 KO (#13) has no effect on SL.

6 K23948 fter stripping p ISH IHC Supplementary figure 6 Sequential detection of K23948 and p in the same breast tumor tissue by ISH and IHC, respectively. fter ISH, the tissue was treated with 1% acid alcohol to remove the ISH, followed by IHC. Scale bar, 1 μm.

7 * Supplementary figure 7nalysis of RN precipitation with PGE and silver staining. unique band (*) for K23948 was clearly visible.

8 95 kda p85β 95 kda p85α p85β p85 Overlay Supplementary figure 8, lthough there are two major p85 isoforms, we detected a predominant p85β band with p85β antibody, but little p85α with p85α antibody in MCF-7 cells., Pan-p85 antibody (p85) recognizes the same band that was recognized by p85β antibody. No p85α was visible for pan-p85 antibody.

9 mplified signal/1 cells p85β p85α C 3 K-1 1,8 bp 2 K-2 K-FL 1,727 bp 2,87 bp 1 DHX9 p85 Supplementary figure 9, K23948 KO (#28) suppresses the p85β level, as detected by Western blot., Interaction between K23948 with DHX9 and p85 by RN precipitation, followed by Western blot. Probes used for precipitation were shown on top; Western blot of the precipitates was shown at bottom. oth DHX9 and p85 interact with K23948 at 3 region (K-2). C, K sirn suppresses the interaction between DHX9 and p85, as detected by PL assay. The number of red spots was counted based on 1 cells each for control sirn and K sirn.

10 Time (h) DHX9 p85 p T473 p85β p S473 Ctrl sirn DHX9 sirn Supplementary figure 1, DHX9 sirns reduces the p85 stability. Cells were first transfected with DHX9 sirn and 24 h later CHX was added, and the cells were harvested at indicated time points after CHX., p85β sirn suppresses activity. Two transfection experiments were done on separate days.

11 Relative K level Ctrl sirn DHX9 sirn DHX9 Tubulin K23948 n.s. DPI Merged Supplementary figure 11, Suppression of K23948 by DHX9 sirns in MCF-7 cells and detection of K23948 level after treatment with DHX9 sirns in MCF-7 cells, by qrt- PCR. Two transfection experiments were done on separate days., DHX9 sirn has no effect on the subcellular localization of K23948 (by FISH) in MCF-7 cells. Scale bar, 1 μm.

12 grn ctrl K KO #13 p S473 perk min p S473 p T38 SF EGF Insulin ERK perk1/2 ERK1/2 Supplementary figure 12, K23948 KO (#28) inhibits the EGF/insulin-induced activation., K23948 KO (#13) inhibits the insulin-induced activation. Cells were first cultured in serum free medium for 12 h and then insulin was added at 1 ng/ml for indicated time points. Note that little effect was seen for perk1/2 under the same condition.

13 Expression of K23948 C D p S p S473 ph 7.4 ph 6.6. E Okadaic acid p S473 grn ctrl KO#13 Supplementary figure 12 continued C, K23948 KO (#28) inhibits the acidosis-induced activation. Cells were cultured at ph 7.4 or ph 6.6 for 2 h before harvesting for Western blot. D, K sirn2 suppresses p in T549 cells. E, Suppression of PP2 by okadaic acid increases activity, but this induction is lower in KO #13 than in grn control cells. The cells were treated with.4 µm okadaic acid for 1 h before harvesting for Western.

14 R e la tiv e c e ll g ro w th Relative R e e c cell e g growth w Relative cell growth Relative growth rate **** SCtrl i c o1 n5 sirn tro l S i K K sirn 1 5 * V e c r Vector K K23948 * C 2 V e c to r 1 5 K Vector e c r K D Ka ta KKO#28 O 11 3 ** d a y d a y V e c to r K V e c to r K V ek c t o rk O V1e K 3c t o rk O 1 3 S i Sc oi nktr o 2S l 3i 9c S4 oi 8n Ktr o 2l S i Sc oi nktr o 2S l 3i 9c S4 oi 8n Ktr o 2l V e c to r K V e c to r K C o n tr K o l 2 8C o n tr KoO l 2 8 Supplementary figure 13 K23948 promotes cell proliferation in vitro., K23948 sirn suppresses cell growth in MCF-7 cells., Ectopic expression of K23948 promotes cell growth. C, K23948 KO (#28) suppresses cell growth.

15 grn ctrl K KO#13 grn ctrl K KO#28 TUNEL DPI Merge Supplementary figure 14 K KO (#13 and #28) promotes H induced apoptosis. Cells were seeded in slide chambers, treated with H 2 2 at.8 mm for 4 h before TUNEL assay. Scale bar, 1 μm.

16 Tumor weight (g) K KO#13 Vector.5.4 ** V e c to r K K O V e c to rk K O Supplementary figure 15, K23948 KO (#13) decreases tumor weight., Detection of a low level of Ki-67 in tumors derived from K KO (#13) cells compared to vector control. Scale bar, 1 μm.

17 21% DHX9 mrn upregulation Cases With DHX9 upregulation Without DHX9 upregulation # total cases # cases deceased Median months survival DHX9 Supplementary figure 16, Upregulation of DHX9 can predict overall patient survival. total of 191 samples with RN-Seq data were analyzed for DHX9 expression using QQL (EXP > 1.5)., Upregulation of DHX9 in breast cancer cell lines as compared to nonmalignant HMLE cells.

18 RTK PTEN p11 p85 PIP2 PIP3 PDK1 K23948 Supplementary figure 17 working model for K23948-mediated activation. See explanation in Discussion.

19 Figure 1 Figure 1C p KD 135 KD 8 KD 58 KD 58kd p38 17 KD 135 KD 8 KD 58 KD 58 KD p38 58 KD 58 KD 58 KD p KD 35kD 35kd Figure2 p473 p473 58kd 58kd 58kd 58kd C 58kd 58kd 35kd p473 Figure KD DHX9 Myc-tagged DHX9 Figure 3 D 135KD 135KD DHX9 p473 p473 58kd 58kd p473 58kd p38 58kd 35kd p38 p38 35 KD Supplementary figure 18 Uncropped Western blots

20 Figure 4 Fig 4 G 8kD p85β 35KD p85α C 135kD 8kD 135kD 8kD 8KD 35KD DHX9 p85 DHX9 p85 D 135kD 8kD 8kD E DHX9 135KD 135kD GST-p85 135KD 8kD 58 KD 135KD DHX9 input DHX9 p85 Tubulin p p85 p473 8 KD 58 KD 135kd Myc-tagged DHX9 58 KD Tubulin 55kd Fig 5 8 kd 35 KD D p85 p85 p kd 8 kd C 58 kd 58 kd 35 kd p473 58kd Figure5. F PTEN p473 58kd 35kd 46kD E perk 35kd 46kD ERK Supplementary figure 18 continued Uncropped Western blots

21 p/ expression p/ expression Relative expression Relative expression p/ expression p/ expression p/ expression p/ expression p/ expression p/ expression p/ expression Fig. 1 p/ expression Fig. 1C Fig. 2 4 L e g e n3d Fig Fig. 2C Fig. 3D Fig. 4G LCtrl e g esirn n d L eldhx9 ge ng de n dsirn 1. L elg e ng de n d D1 a ta 1 LVector e g e n d LDHX9 e g el ne dg e n d 5 L e g el ne dg e n d Fig. 5C LgRN e g e n dctrl LK e g e nko d Fig. 5D LgRN e g e n dctrl LK e g e nko d ph7.4 ph6.6 Supplementary figure 19 Quantification of western blots