Supporting Information
|
|
- Dorcas Anderson
- 5 years ago
- Views:
Transcription
1 Supporting Information Huang et al /pnas SI Materials and Methods Animals and Tumor Models. FVB, Tie2 p -GFP/FVB, and C3H mice were bred and maintained in our gnotobiotic animal facility. MMTV-PyVT mice were kept in a barrier animal facility in Massachusetts General Hospital. In some experiments, fragments of spontaneous MMTV-PyVT breast tumors were transplanted orthotopically into syngeneic FVB female mice for no more than three generations (1). To obtain source tumor tissue, MCaP0008 mammary carcinoma cells ( cells) were injected orthotopically into female FVB mice (2). When the tumor reached 8 mm in diameter, it was excised, and a small piece (about 1 mm 3 )of viable tumor tissue was transplanted orthotopically into different female FVB mice. P1073 is a spontaneous autochthonous C3H mouse breast tumor. These tumors were implanted directly into C3H female mice for experiments. All animal procedures were carried out following the Public Health Service Policy on Humane Care of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of Massachusetts General Hospital. Mammary Fat Pad Window Model. The mammary fat pad window model permits intravital imaging of orthotopically grown breast cancers through a glass window placed on the mammary tumor (3). Tie2 p -GFP/FVB mice were anesthetized, and surgery was performed under sterile conditions. A flap of skin (15-mm diameter) from an opposing surface of the mammary fat pad skin fold was removed to leave a fascial plane consisting of epidermis with nipple, mammary fat pad, and vasculature. A piece of breast tumor tissue (1 mm 3 ) was implanted into the remaining fascial layer, and a glass coverslip was placed over the center of a frame to cover the surgical area. Anti-VEGF Receptor 2 Treatment. Fragments of spontaneous murine mammary carcinoma from MMTV-PyVT mice (1) or MCaP0008 tumor fragments (2) were implanted orthotopically in the mammary fat pad of syngeneic immunocompetent FVB mice. When tumors reached 4 5 mm in diameter, mice were divided into appropriate groups and received four doses administered at 3-d intervals by i.p. injection of either control rat IgG [20 or 40 mg/kg body weight (bw)] (Jackson ImmunoResearch Laboratories, Inc.) or the anti-vegf receptor 2 (VEGFR2) antibody DC101 (10, 20, or 40 mg/kg bw) (ImClone Systems/Eli Lilly) (4). Tumor dimensions were measured by caliper every 3 d, and tumor volume (mm 3 ) was estimated using the formula: tumor volume = (long axis) (short axis) 2 π/6. Combination of Anti-VEGFR2 Treatment and Breast Cancer Vaccine Therapy. Whole breast cancer cell vaccine was generated from MCaP0008 or MMTV-PyVT tumor tissues. Fresh breast tumor tissues were digested enzymatically at room temperature for 1 h in HBSS containing collagenase type 1A (1.5 mg/ml), hyaluronidase (1.5 mg/ml), and DNase (20 U/mL). CD45 + tumor-infiltrating leukocytes were depleted from the single-cell suspension using antimouse CD45 microbeads kit (Miltenyi). Cells from CD45 tumor tissue were incubated with mitomycin C (50 μg/ml) for 1 h at 37 C and then were washed three times with PBS. In the MCaP0008 tumor model, 7 d after tumor implantation, mice were divided randomly into appropriate groups and were injected i.p. four times (at 2- to 3-d intervals) with mitomycin-c treated cells derived from CD45 breast tumor tissue or an equal volume of PBS (Fig. 1A). In the MMTV-PyVT tumor model, the same vaccination protocol was started when tumors reached 3 mm in diameter. One day before the last vaccination, both vaccination and control groups were divided randomly into several groups and were treated with different doses of DC101 or control IgG, respectively. Tumor dimensions were measured by caliper at 3-d intervals, and tumor volume was estimated as described above. CD8 + T-Cell Depletion. CD8 + T-cell depletion was performed according to a previously described protocol (5) with a minor modification. MCaP0008 or MMTV tumor-bearing mice were injected i.p. with 200 μg anti-cd8a monoclonal antibody ( ; Bio X Cell) or isotype-matched rat IgG2a (2A3; Bio X Cell) on days 1 (1 d before the first vaccination), 1, 7, and 13. Peripheral blood drawn on day 10 after the first vaccination and tumors harvested at the end of the experiment were used to confirm the depletion of CD8 + T cells by flow cytometry. Intravital Microscopy. MCaP0008 tumors were grown in the mammary fat pad chambers. When tumors reached about 4 5 mm in diameter, mice were treated with DC101 or IgG on days 0, 3, and 6 at a dose of 20 or 40 mg/kg bw. Vessel angiography was performed using multiphoton laser-scanning microscopy as described previously (6, 7). For each tumor, four to six adjacent images were obtained through the mammary fat pad chamber. For each region, 60 images, spaced 2.5 μm apart, were collected in the z direction, producing stacks with a volume of μm 3. The same region was imaged on days 0, 2, and 8. Analysis of Tumor Tissue Perfusion. Tumor tissue perfusion was determined by histological analysis of the i.v.-injected perfusion marker, Hoechst (Sigma Chemical Co.). Briefly, 5 min after i.v. injection of Hoechst (10 mg/kg in 200 μl PBS), mice were systemically perfused with PBS, and the tumors were removed and fixed. This procedure allows localization of tumor areas proximal to perfused vessels with fluorescence of nucleus-bound Hoechst 33342; hence the Hoechst-negative area reflects hypoxic areas within the tumor (8, 9). Mosaic images of tumors were collected using an Olympus FV1000 confocal laser scanning microscope. A 20 oil immersion objective acquired 640-μm square tiles, and an automated stage scanned through the entire cross-section of tumor tissue. The imaged tiles were stitched into a final mosaic image using Olympus software. Nonspecific nuclear staining (Sytox green) was performed and used to exclude necrotic areas. Hoechst was segmented using simple threshold-based method. To assess spatial heterogeneity, tumor area was broken into several area units based on a 700-μm grid. In each area unit, the mean Hoechst intensity and the fraction of the area that was Hoechst positive (based on the segmented data) were calculated. To visualize the heterogeneity of perfusion, a histogram of Hoechst was plotted. The Wilcoxon exact test was used to compare the heterogeneity of both DC101 groups with control. (A detailed analysis is given in Statistical Analysis.) Isolation and Functional Analyses of Splenic and Intratumoral T Cells. MMTV-PyVT tumor-bearing mice were perfused through intracardiac injection of PBS at killing. Breast tumor tissues were dissected, chopped into small pieces using a razor blade, and digested enzymatically at room temperature for 1 h in HBSS containing collagenase type 1A (1 mg/ml), hyaluronidase (1 mg/ ml), and DNase (20 U/mL). The digestion mixtures were filtered through 70-μm cell strainers to obtain single-cell suspensions. Tumor-infiltrating CD8 + cells were isolated by immunomagnetic separation using MS columns and anti-mouse CD8-conjugated magnetic beads according to the manufacturer s instructions (Miltenyi Biotec). Isolated CD8 + cells were restimulated with 1of9
2 mitomycin C-treated breast tumor cells or with medium alone in vitro for 22 h; GolgiPlug (BD Bioscience) was added during the last 5 h. Single-splenocyte suspensions were obtained by lysis of erythrocytes using M-Lyse buffer (R&D) and then were restimulated with MCaP0008 breast tumor lysate or medium alone in vitro for 72 h with the addition of GolgiPlug during the last 5 h. The cells were stained for CD3 and CD8 and then were fixed and permeabilized in Cytofix/Cytoperm solution (BD Bioscience) according to the manufacturer s instructions and were stained for intracellular IFN-γ. Tumor-specific IFN-γ producing CD3 + CD8 + T cells were quantified through a fluorescence-minus-one gating strategy by flow cytometry using a BD LSR II flow cytometer (BD Biosciences). Data were analyzed using FACS DIVA 6.0 software (BD Biosciences). Immunohistochemistry. Mice were injected i.v. with 100 μg of FITClabeled tomato lectin in PBS. After 5 min, the mice were perfused systemically with 4% (vol/vol) paraformaldehyde and killed. For hypoxia study, mice were injected i.p. with 60 mg/kg of pimonidazole hydrochloride (Hypoxyprobe; Hypoxyprobe, Inc.) and were killed after 60 min. Then tumor tissues were postfixed for 2 3 h in 4% (vol/vol) paraformaldehyde followed by incubation in 30% (wt/vol) sucrose overnight at 4 C. The tissues then were embedded in OCT compound and kept frozen at 80 C. CD31 (1:200) (Chemicon) and NG2 (1:1,000) (Chemicon) staining was carried out on frozen sections (20 μm thick). The slides were counterstained for cell nuclei by DAPI. Fluorescent images were taken using a confocal laser-scanning microscope. Microvessel density, microvessel area, and pericyte coverage were assessed using a custom algorithm in MATLAB. These parameters were determined in four to six photographic areas ( μm 2 each) from each tumor. For pimonidazole staining, after blocking with mouse IgG (M.O.M. Basic Kit #BMK2202; Vector Labs), pimonidazole antigens in the tumor tissues were detected by the mouse Ig monoclonal antibody, Hypoxyprobe-1 MAb1, (1:50) and the secondary antibody, Cy3 anti-mouse antibody, (1:200). The slides were counterstained with Sytox Green (Molecular Probes). Mosaic images of tumors were collected using an Olympus FV1000 confocal laser scanning microscope. A 20 oil immersion objective acquired 640-μm square tiles, and an automated stage scanned through the entire cross-section of tumor tissue. The imaged tiles were stitched into a final mosaic image using Olympus software. Nonspecific nuclear staining (Sytox green) was used to exclude necrotic areas. Areas staining positive for pimonidazole within the viable areas were normalized to the total viable area. Flow Cytometry Analysis. Tumor-bearing mice were perfused through intracardiac injection of PBS and killed. Breast tumor tissues were harvested, minced, and digested at 37 C for 1 h with DMEM containing collagenase type 1A (1.5 mg/ml), hyaluronidase (1.5 mg/ml), and DNase (2 mg/ml). The digestion mixtures were filtered through 70-μm cell strainers. Single-cell suspensions were incubated with rat anti-mouse CD16/CD32 mab and then were stained, washed, and resuspended in cold buffer (1% BSA, 0.1% NaN3 in PBS). 7-Amino-actinomycin D (7AAD) reagent (ebioscience) was added to the stained tubes (5 μl per tube) just before running the flow analysis. The doublet/aggregated events were gated out using forward scatter area (FSC-A) vs. forward scatter width (FSC-W) and side scatter area (SSC-A) vs. side scatter width (SSC-W). Flow cytometry data were acquired on an LSRII flow cytometer (Becton Dickinson) and were analyzed with FACSDiva software. FSC-A vs. FSC-W and SSC-A vs. SSC-W were applied to discriminate the doublet/aggregated events. The appropriate fluorochrome-conjugated, isotypematched control IgGs were used in all experiments. The following monoclonal anti-mouse antibodies were used: CD4-FITC, CD4-PE-Cy7, CD8a-FITC, CD8a-PE, CD45-PE, CD45-PE-Cy7, CD25-APC-Cy7, Foxp3-APC, Gr1-APC, and CD11b-APC-Cy7 (BD Biosciences) and F4/80-FITC and F4/80-PE (ebioscience). Quantitative Real Time PCR. Total RNA was extracted from flowsorted Hoechst negative or Hoechst positive tumorassociated macrophages (TAMs) (7AAD CD45 + F4/80 + Gr1 ) using an RNeasy Mini Kit (QIAGEN). cdnas were synthesized using the TaqMan RT Kit (Applied Biosystems). Primers specific for β-actin, Arignase-1, IL10, CCL17, CCL22, MRC1, Nos2, IL-12a, IL-1β, TNF-α, CXCL9, CXCL-11, CSF1, MMP9,andTGF-β were used (Table S1), and relative gene expression was determined using Real-Time SYBR Green PCR Master Mix (Applied Biosystems) on a Stratagene Mx3000P QPCR System. The comparative threshold cycle method was used to calculate fold change in gene expression, which was normalized to β-actin as a reference gene. Statistical Analysis. We verified that day 16 tumor volume measurements had approximately log-normal distribution (P > 0.05, Wilks-Shapiro test), then compared log-transformed measurements using Student s t test. Heterogeneity was quantified, after dividing the image into squares of 700 μm, as the variance in the proportion of Hoechst positive area. The heterogeneity of measurements was compared between DC101 and control using Mann-Whitney test; we presented medians for each group and area under ROC. We used log-rank test for comparison of survival data. In all comparisons, statistical significance was set at P < Data are expressed as mean ± standard error of the mean (SEM). 1. DeNardo DG, et al. (2011) Leukocyte complexity predicts breast cancer survival and functionally regulates response to chemotherapy. Cancer Discov 1(1): Huang P, Duda DG, Jain RK, Fukumura D (2008) Histopathologic findings and establishment of novel tumor lines from spontaneous tumors in FVB/N mice. Comp Med 58: Tam J, et al. (2009) Blockade of VEGFR2 and not VEGFR1 can limit diet-induced fat tissue expansion: Role of local versus bone marrow-derived endothelial cells. PLoS ONE 4:e Witte L, et al. (1998) Monoclonal antibodies targeting the VEGF receptor-2 (Flk1/KDR) as an anti-angiogenic therapeutic strategy. Cancer Metastasis Rev 17: Huang Y, et al. (2011) Resuscitating cancer immunosurveillance: Selective stimulation of DLL1-Notch signaling in T cells rescues T-cell function and inhibits tumor growth. Cancer Res 71: Tong RT, et al. (2004) Vascular normalization by vascular endothelial growth factor receptor 2 blockade induces a pressure gradient across the vasculature and improves drug penetration in tumors. Cancer Res 64: Kashiwagi S, et al. (2008) Perivascular nitric oxide gradients normalize tumor vasculature. Nat Med 14: Olive PL, Chaplin DJ, Durand RE (1985) Pharmacokinetics, binding and distribution of Hoechst in spheroids and murine tumours. Br J Cancer 52: Chaplin DJ, Durand RE, Olive PL (1986) Acute hypoxia in tumors: Implications for modifiers of radiation effects. Int J Radiat Oncol Biol Phys 12: of9
3 Percentage of CD3+CD8+IFNg + cells in CD3+CD8+ T cells PBS/IgG PBS/ DC PBS/ DC Vaccine/ IgG Vaccine/ DC Vaccine/ DC Fig. S1. Whole MCaP0008 cancer cell vaccine therapy stimulates anticancer CD8 + T-cell response in spleens. MCaP0008 tumor-bearing mice were treated as described in Fig. 1A. Splenocytes were harvested on day 11 after treatment with anti-vegfr2 antibody (DC101) and were restimulated by MCaP0008 tumor cell lysate in vitro for 72 h. Cell-mediated immune responses were determined by IFN-γ production in CD3 + CD8 + T cells using intracellular staining and flow cytometry. The differences between nonstimulated (medium alone) and tumor lysate-stimulated cells were calculated and expressed as frequency of parent CD8 + T cells. P values showed the difference compared with the PBS/IgG control group. n = 10 mice per group. Data are mean ± SEM. 3of9
4 Fig. S2. Lower-dose anti-vegfr2 treatment does not prune breast tumor vessels but reduces tumor tissue hypoxia. (A) Intravital multiphoton laser-scanning microscopy images of orthotopic MCaP0008 tumor vasculature in Tie2 p -GFP/FVB mice on days 0, 2, and 8 of DC101 treatment. Tie2-expressing vessels are shown in green. When tumors reached 4 5 mm in diameter, mice were treated with DC101 (20 or 40 mg/kg) at 3-d intervals. (B) Total vessel length and area within region of interests in orthotopic MCaP0008 tumors. Randomly selected fields ( μm 2 ) excluding the tumor periphery were analyzed (four to six fields per tumor, six to eight tumors per group). Four doses of DC101 and IgG (20 mg/kg bw) were administered at 3-d intervals, and tumors were harvested on day 11 after DC101 treatment. Data are shown as mean ± SEM. (C) Representative images of hypoxic marker staining. Hypoxic cells and vascular endothelial cells were stained with anti-pimonidazole and anti-cd31 antibodies, respectively. Mosaic images of the whole tumor section were taken by multispectral confocal microscopy and were analyzed as shown in Fig. 2C. DC101-10, 10 mg/kg bw; DC101-40, 40 mg/kg bw. Green, Sytox Green, blue: pimonidazole; red, CD31. 4of9
5 Fig. S3. Effect of different doses of DC101 on the infiltration and distribution of CD11b + Gr1 + cells and TAMs. This figure shows representative flow quadrants for the data represented in Fig. 3. Flow cytometric analyses were performed on day 11 after the treatment with the indicated doses and with prior Hoechst perfusion as described in Fig. 2. Mice were treated with four doses of DC101 (10, 20, or 40 mg/kg bw) or rat IgG as control (40 mg/kg bw) administered at 3-d intervals. The doublet/aggregated events were gated out using FSC-A vs. FSC-W and SSC-A vs. SSC-W, and dead cells were excluded by 7-AAD staining. (A) Representative flow quadrants of CD11b + Gr1 + cells and TAMs (7AAD CD45 + CD11b + Gr1 F4/80 + ) in MCaP0008 tumors. Numbers show the average percentage of cell populations in total viable cells. (B) Representative flow quadrants of Hoechst positive TAMs (Ho + TAMs) in MCaP0008 tumors. Numbers show the average percentage of Ho + TAMs in total TAMs. (C) Representative flow quadrants of Ho + TAMs in MMTV-PyVT tumors. Numbers show the average percentage of Ho + TAMs in total TAMs. n =8 10 mice per group in A and B; n = 5 mice per group in C. Data are shown as mean values. 5of9
6 Fig. S4. The phenotypes of TAMs in MCaP0008 and MMTV-PyVT tumors. (A) Cytokine expression in TAMs from well- or poorly perfused areas in MCaP0008 tumors. To mark cells proximal to perfused blood vessels, MCaP0008 tumor-bearing mice were injected i.v. with 200 μg Hoechst After 5 min of circulation, mice were perfused with PBS, and tumors were harvested. TAMs were enriched by CD11b microbeads and were isolated by flow sorting from fresh tumors. TAMs from 8 10 tumors were pooled as three samples in each group. Total RNA was extracted from sorted cells and converted to cdna for quantitative real-time PCR. Data shown are the mean values ± SEM of the ratios of target gene to β-actin. *P < 0.05, **P < 0.01 compared with F4/80 + Ho cells. (B) The dose effect of DC101 treatment on TAM phenotypes in MMTV-PyVT tumors. Quarter-dose, but not full-dose, DC101 treatment polarized Ho TAMs to an M1-like phenotype in MMTV-PyVT tumors. Ho + TAMs were separated, and levels of typical M1-like markers (inos and IL-12a) and an M2-like marker (Arg1) were analyzed as described in Fig. 4. Five tumors were pooled as one sample in each group. Fig. S5. Effect of different doses of anti-vegfr2 treatment on tumor-infiltrating CD8 + and CD4 + T cells in MCaP0008 tumors. MCaP0008 tumor-bearing mice were treated with four doses of DC101 (20 or 40 mg/kg bw) or rat IgG (40 mg/kg bw) administered at 3-d intervals. (A) Representative flow cytometric analyses of tumor-infiltrating CD4 + and CD8 + T cells are shown. Lymphoid cells in CD45 + cells were analyzed with expression of CD4 and CD8. Numbers show the percentages of CD4 + and CD8 + T cells in total viable cells. (B) The percentage of tumor-infiltrating CD4 + and CD8 + T cells in total viable cells is shown (n =8 10 mice). Data are shown as mean values ± SEM. *P < 0.05, **P < 0.01 compared with IgG control. 6of9
7 Fig. S6. Half-dose anti-vegfr2 treatment increases CD8 + T cells in a model of spontaneous autochthonous breast cancer in C3H mice. (A) Tumor-infiltrating CD4 + and CD8 + T cells in the spontaneous autochthonous breast tumors. A naturally developed breast tumor (P1073) was transplanted into syngeneic C3H mice. When tumors reached 4 5 mm in diameter, these mice were treated with four doses of DC101 (20 or 40 mg/kg bw) or rat IgG (40 mg/kg bw) as control, administered at 3-d intervals. Tumors were harvested on day 11 after treatment. Flow data were analyzed as described in Fig. 5A. Representative flow figures are shown. Numbers show the percentages of CD4 + and CD8 + T cells in total viable cells. (B) The percentage of tumor-infiltrating CD4 + and CD8 + T cells in total viable cells. n = 5 mice. Data are shown as mean values ± SEM. *P < 0.05, **P < 0.01 compared with IgG control. Fig. S7. Vaccination dramatically increases tumor-infiltrating CD8 + T cells in MMTV-PyVT breast cancers. Whole breast tumor tissue cell vaccination dramatically increased tumor-infiltrating CD8 + T cells (n = 8 mice per group). The vaccination protocol is described above in the legend to Fig. 6A. Data are shown as mean ± SEM. *P < 0.05, **P < 0.01 compared with PBS control. 7of9
8 Fig. S8. Effect of CD8 + T-cell depletion on tumor growth during vaccine therapy. MMTV-PyVT tumor-bearing mice were injected i.p. with anti-cd8a monoclonal antibody or isotype rat IgG2a (2A3) (200 μg per mouse) on days 1 (1 d before the first vaccination), 1, 7, and 13. (A) Representative flow data for CD4+ and CD8+ T-cell populations with and without anti-cd8a antibody treatment. Administration of anti-cd8a monoclonal antibody selectively depletes CD8 + T cells in both peripheral blood and breast tumors. Blood was drawn on day 10 after the first vaccination, and tumors were harvested for flow analysis at the end of the experiment. (B) Tumor growth curves. Tumor size was measured at 3-d intervals beginning at day 7 after the first vaccination (the first day of DC101 treatment). The vaccine/dc101-10/anti-cd8 group had 10 mice, the vaccine/dc101-10/2a3 group had five mice, and all other groups had 11 mice. Fig. S9. The intrinsic characteristics of MMTV-PyVT breast cancer vasculature. Mice bearing MMTV-PyVT breast cancers were injected i.v. with 100 μg of FITClabeled tomato lectin in PBS. After 5 min, tumors were harvested and stained for pericyte marker (NG2) and endothelial cell marker (CD31). Confocal images were taken within randomly selected fields excluding the tumor periphery (four to six fields per tumor, 8 10 tumors per group). (A) A representative confocal image. Green, FITC-lectin; red, NG2; blue, CD31. A 20 objective was used for imaging. (Scale bar, 100 μm.) (B) Quantification of tumor vessel perfusion (area fractions of FITC-lectin/CD31) and pericyte coverage (area fractions of NG2/CD31). Data are shown as mean ± SEM. 8of9
9 Table S1. Name Mouse primer sequences Primer sequences Murine β-actin For: 5 ATCGTGCGTGACATCAAAGA 3 Rev: 5 ACAGGATTCCATACCCAAGAAG 3 marg1 For: 5 CAACCAGCTCTGGGAATCTG 3 Rev: 5 AATCGGCCTTTTCTTCCTTC 3 mil-10 For: 5 CCAGAGCCACATGCTCCTA 3 Rev: 5 AGGGGAGAAATCGATGACAG 3 mccl-17 For: 5 TGCTTCTGGGGACTTTTCTG 3 Rev: 5 TGGCCTTCTTCACATGTTTG 3 mccl-22 For: 5 GTCCTTCTTGCTGTGGCAAT 3 Rev: 5 ACGGTTATCAAAACAACGCC 3 mmrc-1 For: 5 CCTGAACAGCAACTTGACCA 3 Rev: 5 GCAATGGCCATAGAAAGGAA 3 mnos2 For: 5 CCACCTCTATCAGGAAGAAA 3 Rev: 5 CTGCACCGAAGATATCTTCA 3 mil-12a For: 5 GCCAGGTGTCTTAGCCAGTC 3 Rev: 5 AGCTCCCTCTTGTTGTGGAA 3 mil-1b For: 5 TGCCACCTTTTGACAGTGAT 3 Rev: 5 TGTCCTCATCCTGGAAGGTC 3 mtnfa For: 5 CCGATGGGTTGTACCTTGTC 3 Rev: 5 CGGACTCCGCAAAGTCTAAG 3 mcxcl-9 For: 5 AGTGTGGAGTTCGAGGAACC 3 Rev: 5 GAGTCCGGATCTAGGCAGG 3 mcxcl-11 For: 5 AGCTGCTCAAGGCTTCCTTA 3 Rev: 5 AGTAACAATCACTTCAACTTTGTCG 3 mcsf-1 For: 5 TCACAACCTCATCCTTCTGCG 3 Rev: 5 GACCCAGTTAGTGCCCAGTGA 3 mmmp-9 For: 5 TGAGTCCGGCAGACAATCCT 3 Rev: 5 CCCTGGATCTCAGCAATAGCA 3 mtgfb For: 5 GCTGAACCAAGGAGACGGAAT 3 Rev: 5 GCCTTAGTTTGGACAGGATCTG 3 9of9
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationIn vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + regulatory T cell isolation, Workflow in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation of T
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationIn vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + CD127 dim/- regulatory T cell Workflow isolation, in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationComparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-
Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationT H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells
A complete workflow for cell preparation, isolation, polarization and analysis T H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells Introduction Workflow CD4 + T helper (T H) cells play a
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationB6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
More informationSupporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationCytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells
Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSupporting Information
Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience
More informationSupplementary figure 1. Systemic delivery of anti-cd47 antibody controls tumor growth in
T u m o r v o lu m e (m m 3 ) P e rc e n t s u rv iv a l P e rc e n t s u rv iv a l Supplementary data a 1 8 6 4 2 5 1 1 5 2 2 5 3 3 5 4 T im e a fte r tu m o r in o c u la tio n (d ) b c 1 5 1 1 5 * *
More informationDetailed step-by-step operating procedures for NK cell and CTL degranulation assays
Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,
More informationFisher et al. Supplemental Figure 1
Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationDC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN. (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
Supplementary methods Flow cytometric analysis of DCs. DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
More informationSupporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationOptimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors An encore presentation by Jurg Rohrer, PhD, BD Biosciences 10.26.10 Outline Introduction Cytokines
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationCommercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationSupporting Information
Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells
More informationCirculating Endothelial Cells and Their Clinical Significance Jaco Kraan
Circulating Endothelial Cells and Their Clinical Significance Jaco Kraan Department of Medical Oncology Erasmus MC Cancer Institute Rotterdam, The Netherlands ISLH 2016 - Milano, Italy Financial disclosure
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationpro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
More informationBD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop
BD CBA on the BD Accuri C6: Bringing Multiplexed Cytokine Detection to the Benchtop Maria Dinkelmann, PhD Senior Marketing Applications Specialist BD Biosciences, Ann Arbor, MI 23-14380-00 Cellular Communication
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationSupplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific
SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationBMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationeffect on the upregulation of these cell surface markers. The mean peak fluorescence intensity
SUPPLEMENTARY FIGURE 1 Supplementary Figure 1 ASIC1 disruption or blockade does not effect in vitro and in vivo antigen-presenting cell activation. (a) Flow cytometric analysis of cell surface molecules
More informationTechnical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures
FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationRapid antigen-specific T cell enrichment (Rapid ARTE)
Direct ex vivo characterization of human antigen-specific CD154+CD4+ T cell Rapid antigen-specific T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central role
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationDirect ex vivo characterization of human antigen-specific CD154 + CD4 + T cells Rapid antigen-reactive T cell enrichment (Rapid ARTE)
Direct ex vivo characterization of human antigen-specific CD154 + CD4 + T cells Rapid antigen-reactive T cell enrichment (Rapid ARTE) Introduction Workflow Antigen (ag)-specific T cells play a central
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationIncreased IL-12 induced STAT-4 signaling in CD8 T cells. from aged mice
Increased IL-2 induced STAT-4 signaling in CD8 T cells from aged mice Erin Rottinghaus * Abstract: Aging is associated with poor immune function leading to increased susceptibility to infectious diseases
More informationConcentration Estimation from Flow Cytometry Exosome Data Protocol
Concentration Estimation from Flow Cytometry Exosome Data Protocol 1. STANDARD CURVE Create a standard curve for the target exosome by plotting the mean fluorescence (y axis) against the protein concentration
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationWe obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan
Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More informationIn vitro human regulatory T cell suppression assay
Human CD4 + CD25 + regulatory T cell isolation, in vitro suppression assay and analysis In vitro human regulatory T cell suppression assay Introduction Regulatory T (Treg) cells are a subpopulation of
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationD CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
More informationInterleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma
Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay
More information% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
More information