Supporting Information

Transcription

1 Supporting Information Huang et al /pnas SI Materials and Methods Animals and Tumor Models. FVB, Tie2 p -GFP/FVB, and C3H mice were bred and maintained in our gnotobiotic animal facility. MMTV-PyVT mice were kept in a barrier animal facility in Massachusetts General Hospital. In some experiments, fragments of spontaneous MMTV-PyVT breast tumors were transplanted orthotopically into syngeneic FVB female mice for no more than three generations (1). To obtain source tumor tissue, MCaP0008 mammary carcinoma cells ( cells) were injected orthotopically into female FVB mice (2). When the tumor reached 8 mm in diameter, it was excised, and a small piece (about 1 mm 3 )of viable tumor tissue was transplanted orthotopically into different female FVB mice. P1073 is a spontaneous autochthonous C3H mouse breast tumor. These tumors were implanted directly into C3H female mice for experiments. All animal procedures were carried out following the Public Health Service Policy on Humane Care of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of Massachusetts General Hospital. Mammary Fat Pad Window Model. The mammary fat pad window model permits intravital imaging of orthotopically grown breast cancers through a glass window placed on the mammary tumor (3). Tie2 p -GFP/FVB mice were anesthetized, and surgery was performed under sterile conditions. A flap of skin (15-mm diameter) from an opposing surface of the mammary fat pad skin fold was removed to leave a fascial plane consisting of epidermis with nipple, mammary fat pad, and vasculature. A piece of breast tumor tissue (1 mm 3 ) was implanted into the remaining fascial layer, and a glass coverslip was placed over the center of a frame to cover the surgical area. Anti-VEGF Receptor 2 Treatment. Fragments of spontaneous murine mammary carcinoma from MMTV-PyVT mice (1) or MCaP0008 tumor fragments (2) were implanted orthotopically in the mammary fat pad of syngeneic immunocompetent FVB mice. When tumors reached 4 5 mm in diameter, mice were divided into appropriate groups and received four doses administered at 3-d intervals by i.p. injection of either control rat IgG [20 or 40 mg/kg body weight (bw)] (Jackson ImmunoResearch Laboratories, Inc.) or the anti-vegf receptor 2 (VEGFR2) antibody DC101 (10, 20, or 40 mg/kg bw) (ImClone Systems/Eli Lilly) (4). Tumor dimensions were measured by caliper every 3 d, and tumor volume (mm 3 ) was estimated using the formula: tumor volume = (long axis) (short axis) 2 π/6. Combination of Anti-VEGFR2 Treatment and Breast Cancer Vaccine Therapy. Whole breast cancer cell vaccine was generated from MCaP0008 or MMTV-PyVT tumor tissues. Fresh breast tumor tissues were digested enzymatically at room temperature for 1 h in HBSS containing collagenase type 1A (1.5 mg/ml), hyaluronidase (1.5 mg/ml), and DNase (20 U/mL). CD45 + tumor-infiltrating leukocytes were depleted from the single-cell suspension using antimouse CD45 microbeads kit (Miltenyi). Cells from CD45 tumor tissue were incubated with mitomycin C (50 μg/ml) for 1 h at 37 C and then were washed three times with PBS. In the MCaP0008 tumor model, 7 d after tumor implantation, mice were divided randomly into appropriate groups and were injected i.p. four times (at 2- to 3-d intervals) with mitomycin-c treated cells derived from CD45 breast tumor tissue or an equal volume of PBS (Fig. 1A). In the MMTV-PyVT tumor model, the same vaccination protocol was started when tumors reached 3 mm in diameter. One day before the last vaccination, both vaccination and control groups were divided randomly into several groups and were treated with different doses of DC101 or control IgG, respectively. Tumor dimensions were measured by caliper at 3-d intervals, and tumor volume was estimated as described above. CD8 + T-Cell Depletion. CD8 + T-cell depletion was performed according to a previously described protocol (5) with a minor modification. MCaP0008 or MMTV tumor-bearing mice were injected i.p. with 200 μg anti-cd8a monoclonal antibody ( ; Bio X Cell) or isotype-matched rat IgG2a (2A3; Bio X Cell) on days 1 (1 d before the first vaccination), 1, 7, and 13. Peripheral blood drawn on day 10 after the first vaccination and tumors harvested at the end of the experiment were used to confirm the depletion of CD8 + T cells by flow cytometry. Intravital Microscopy. MCaP0008 tumors were grown in the mammary fat pad chambers. When tumors reached about 4 5 mm in diameter, mice were treated with DC101 or IgG on days 0, 3, and 6 at a dose of 20 or 40 mg/kg bw. Vessel angiography was performed using multiphoton laser-scanning microscopy as described previously (6, 7). For each tumor, four to six adjacent images were obtained through the mammary fat pad chamber. For each region, 60 images, spaced 2.5 μm apart, were collected in the z direction, producing stacks with a volume of μm 3. The same region was imaged on days 0, 2, and 8. Analysis of Tumor Tissue Perfusion. Tumor tissue perfusion was determined by histological analysis of the i.v.-injected perfusion marker, Hoechst (Sigma Chemical Co.). Briefly, 5 min after i.v. injection of Hoechst (10 mg/kg in 200 μl PBS), mice were systemically perfused with PBS, and the tumors were removed and fixed. This procedure allows localization of tumor areas proximal to perfused vessels with fluorescence of nucleus-bound Hoechst 33342; hence the Hoechst-negative area reflects hypoxic areas within the tumor (8, 9). Mosaic images of tumors were collected using an Olympus FV1000 confocal laser scanning microscope. A 20 oil immersion objective acquired 640-μm square tiles, and an automated stage scanned through the entire cross-section of tumor tissue. The imaged tiles were stitched into a final mosaic image using Olympus software. Nonspecific nuclear staining (Sytox green) was performed and used to exclude necrotic areas. Hoechst was segmented using simple threshold-based method. To assess spatial heterogeneity, tumor area was broken into several area units based on a 700-μm grid. In each area unit, the mean Hoechst intensity and the fraction of the area that was Hoechst positive (based on the segmented data) were calculated. To visualize the heterogeneity of perfusion, a histogram of Hoechst was plotted. The Wilcoxon exact test was used to compare the heterogeneity of both DC101 groups with control. (A detailed analysis is given in Statistical Analysis.) Isolation and Functional Analyses of Splenic and Intratumoral T Cells. MMTV-PyVT tumor-bearing mice were perfused through intracardiac injection of PBS at killing. Breast tumor tissues were dissected, chopped into small pieces using a razor blade, and digested enzymatically at room temperature for 1 h in HBSS containing collagenase type 1A (1 mg/ml), hyaluronidase (1 mg/ ml), and DNase (20 U/mL). The digestion mixtures were filtered through 70-μm cell strainers to obtain single-cell suspensions. Tumor-infiltrating CD8 + cells were isolated by immunomagnetic separation using MS columns and anti-mouse CD8-conjugated magnetic beads according to the manufacturer s instructions (Miltenyi Biotec). Isolated CD8 + cells were restimulated with 1of9

2 mitomycin C-treated breast tumor cells or with medium alone in vitro for 22 h; GolgiPlug (BD Bioscience) was added during the last 5 h. Single-splenocyte suspensions were obtained by lysis of erythrocytes using M-Lyse buffer (R&D) and then were restimulated with MCaP0008 breast tumor lysate or medium alone in vitro for 72 h with the addition of GolgiPlug during the last 5 h. The cells were stained for CD3 and CD8 and then were fixed and permeabilized in Cytofix/Cytoperm solution (BD Bioscience) according to the manufacturer s instructions and were stained for intracellular IFN-γ. Tumor-specific IFN-γ producing CD3 + CD8 + T cells were quantified through a fluorescence-minus-one gating strategy by flow cytometry using a BD LSR II flow cytometer (BD Biosciences). Data were analyzed using FACS DIVA 6.0 software (BD Biosciences). Immunohistochemistry. Mice were injected i.v. with 100 μg of FITClabeled tomato lectin in PBS. After 5 min, the mice were perfused systemically with 4% (vol/vol) paraformaldehyde and killed. For hypoxia study, mice were injected i.p. with 60 mg/kg of pimonidazole hydrochloride (Hypoxyprobe; Hypoxyprobe, Inc.) and were killed after 60 min. Then tumor tissues were postfixed for 2 3 h in 4% (vol/vol) paraformaldehyde followed by incubation in 30% (wt/vol) sucrose overnight at 4 C. The tissues then were embedded in OCT compound and kept frozen at 80 C. CD31 (1:200) (Chemicon) and NG2 (1:1,000) (Chemicon) staining was carried out on frozen sections (20 μm thick). The slides were counterstained for cell nuclei by DAPI. Fluorescent images were taken using a confocal laser-scanning microscope. Microvessel density, microvessel area, and pericyte coverage were assessed using a custom algorithm in MATLAB. These parameters were determined in four to six photographic areas ( μm 2 each) from each tumor. For pimonidazole staining, after blocking with mouse IgG (M.O.M. Basic Kit #BMK2202; Vector Labs), pimonidazole antigens in the tumor tissues were detected by the mouse Ig monoclonal antibody, Hypoxyprobe-1 MAb1, (1:50) and the secondary antibody, Cy3 anti-mouse antibody, (1:200). The slides were counterstained with Sytox Green (Molecular Probes). Mosaic images of tumors were collected using an Olympus FV1000 confocal laser scanning microscope. A 20 oil immersion objective acquired 640-μm square tiles, and an automated stage scanned through the entire cross-section of tumor tissue. The imaged tiles were stitched into a final mosaic image using Olympus software. Nonspecific nuclear staining (Sytox green) was used to exclude necrotic areas. Areas staining positive for pimonidazole within the viable areas were normalized to the total viable area. Flow Cytometry Analysis. Tumor-bearing mice were perfused through intracardiac injection of PBS and killed. Breast tumor tissues were harvested, minced, and digested at 37 C for 1 h with DMEM containing collagenase type 1A (1.5 mg/ml), hyaluronidase (1.5 mg/ml), and DNase (2 mg/ml). The digestion mixtures were filtered through 70-μm cell strainers. Single-cell suspensions were incubated with rat anti-mouse CD16/CD32 mab and then were stained, washed, and resuspended in cold buffer (1% BSA, 0.1% NaN3 in PBS). 7-Amino-actinomycin D (7AAD) reagent (ebioscience) was added to the stained tubes (5 μl per tube) just before running the flow analysis. The doublet/aggregated events were gated out using forward scatter area (FSC-A) vs. forward scatter width (FSC-W) and side scatter area (SSC-A) vs. side scatter width (SSC-W). Flow cytometry data were acquired on an LSRII flow cytometer (Becton Dickinson) and were analyzed with FACSDiva software. FSC-A vs. FSC-W and SSC-A vs. SSC-W were applied to discriminate the doublet/aggregated events. The appropriate fluorochrome-conjugated, isotypematched control IgGs were used in all experiments. The following monoclonal anti-mouse antibodies were used: CD4-FITC, CD4-PE-Cy7, CD8a-FITC, CD8a-PE, CD45-PE, CD45-PE-Cy7, CD25-APC-Cy7, Foxp3-APC, Gr1-APC, and CD11b-APC-Cy7 (BD Biosciences) and F4/80-FITC and F4/80-PE (ebioscience). Quantitative Real Time PCR. Total RNA was extracted from flowsorted Hoechst negative or Hoechst positive tumorassociated macrophages (TAMs) (7AAD CD45 + F4/80 + Gr1 ) using an RNeasy Mini Kit (QIAGEN). cdnas were synthesized using the TaqMan RT Kit (Applied Biosystems). Primers specific for β-actin, Arignase-1, IL10, CCL17, CCL22, MRC1, Nos2, IL-12a, IL-1β, TNF-α, CXCL9, CXCL-11, CSF1, MMP9,andTGF-β were used (Table S1), and relative gene expression was determined using Real-Time SYBR Green PCR Master Mix (Applied Biosystems) on a Stratagene Mx3000P QPCR System. The comparative threshold cycle method was used to calculate fold change in gene expression, which was normalized to β-actin as a reference gene. Statistical Analysis. We verified that day 16 tumor volume measurements had approximately log-normal distribution (P > 0.05, Wilks-Shapiro test), then compared log-transformed measurements using Student s t test. Heterogeneity was quantified, after dividing the image into squares of 700 μm, as the variance in the proportion of Hoechst positive area. The heterogeneity of measurements was compared between DC101 and control using Mann-Whitney test; we presented medians for each group and area under ROC. We used log-rank test for comparison of survival data. In all comparisons, statistical significance was set at P < Data are expressed as mean ± standard error of the mean (SEM). 1. DeNardo DG, et al. (2011) Leukocyte complexity predicts breast cancer survival and functionally regulates response to chemotherapy. Cancer Discov 1(1): Huang P, Duda DG, Jain RK, Fukumura D (2008) Histopathologic findings and establishment of novel tumor lines from spontaneous tumors in FVB/N mice. Comp Med 58: Tam J, et al. (2009) Blockade of VEGFR2 and not VEGFR1 can limit diet-induced fat tissue expansion: Role of local versus bone marrow-derived endothelial cells. PLoS ONE 4:e Witte L, et al. (1998) Monoclonal antibodies targeting the VEGF receptor-2 (Flk1/KDR) as an anti-angiogenic therapeutic strategy. Cancer Metastasis Rev 17: Huang Y, et al. (2011) Resuscitating cancer immunosurveillance: Selective stimulation of DLL1-Notch signaling in T cells rescues T-cell function and inhibits tumor growth. Cancer Res 71: Tong RT, et al. (2004) Vascular normalization by vascular endothelial growth factor receptor 2 blockade induces a pressure gradient across the vasculature and improves drug penetration in tumors. Cancer Res 64: Kashiwagi S, et al. (2008) Perivascular nitric oxide gradients normalize tumor vasculature. Nat Med 14: Olive PL, Chaplin DJ, Durand RE (1985) Pharmacokinetics, binding and distribution of Hoechst in spheroids and murine tumours. Br J Cancer 52: Chaplin DJ, Durand RE, Olive PL (1986) Acute hypoxia in tumors: Implications for modifiers of radiation effects. Int J Radiat Oncol Biol Phys 12: of9

3 Percentage of CD3+CD8+IFNg + cells in CD3+CD8+ T cells PBS/IgG PBS/ DC PBS/ DC Vaccine/ IgG Vaccine/ DC Vaccine/ DC Fig. S1. Whole MCaP0008 cancer cell vaccine therapy stimulates anticancer CD8 + T-cell response in spleens. MCaP0008 tumor-bearing mice were treated as described in Fig. 1A. Splenocytes were harvested on day 11 after treatment with anti-vegfr2 antibody (DC101) and were restimulated by MCaP0008 tumor cell lysate in vitro for 72 h. Cell-mediated immune responses were determined by IFN-γ production in CD3 + CD8 + T cells using intracellular staining and flow cytometry. The differences between nonstimulated (medium alone) and tumor lysate-stimulated cells were calculated and expressed as frequency of parent CD8 + T cells. P values showed the difference compared with the PBS/IgG control group. n = 10 mice per group. Data are mean ± SEM. 3of9

4 Fig. S2. Lower-dose anti-vegfr2 treatment does not prune breast tumor vessels but reduces tumor tissue hypoxia. (A) Intravital multiphoton laser-scanning microscopy images of orthotopic MCaP0008 tumor vasculature in Tie2 p -GFP/FVB mice on days 0, 2, and 8 of DC101 treatment. Tie2-expressing vessels are shown in green. When tumors reached 4 5 mm in diameter, mice were treated with DC101 (20 or 40 mg/kg) at 3-d intervals. (B) Total vessel length and area within region of interests in orthotopic MCaP0008 tumors. Randomly selected fields ( μm 2 ) excluding the tumor periphery were analyzed (four to six fields per tumor, six to eight tumors per group). Four doses of DC101 and IgG (20 mg/kg bw) were administered at 3-d intervals, and tumors were harvested on day 11 after DC101 treatment. Data are shown as mean ± SEM. (C) Representative images of hypoxic marker staining. Hypoxic cells and vascular endothelial cells were stained with anti-pimonidazole and anti-cd31 antibodies, respectively. Mosaic images of the whole tumor section were taken by multispectral confocal microscopy and were analyzed as shown in Fig. 2C. DC101-10, 10 mg/kg bw; DC101-40, 40 mg/kg bw. Green, Sytox Green, blue: pimonidazole; red, CD31. 4of9

5 Fig. S3. Effect of different doses of DC101 on the infiltration and distribution of CD11b + Gr1 + cells and TAMs. This figure shows representative flow quadrants for the data represented in Fig. 3. Flow cytometric analyses were performed on day 11 after the treatment with the indicated doses and with prior Hoechst perfusion as described in Fig. 2. Mice were treated with four doses of DC101 (10, 20, or 40 mg/kg bw) or rat IgG as control (40 mg/kg bw) administered at 3-d intervals. The doublet/aggregated events were gated out using FSC-A vs. FSC-W and SSC-A vs. SSC-W, and dead cells were excluded by 7-AAD staining. (A) Representative flow quadrants of CD11b + Gr1 + cells and TAMs (7AAD CD45 + CD11b + Gr1 F4/80 + ) in MCaP0008 tumors. Numbers show the average percentage of cell populations in total viable cells. (B) Representative flow quadrants of Hoechst positive TAMs (Ho + TAMs) in MCaP0008 tumors. Numbers show the average percentage of Ho + TAMs in total TAMs. (C) Representative flow quadrants of Ho + TAMs in MMTV-PyVT tumors. Numbers show the average percentage of Ho + TAMs in total TAMs. n =8 10 mice per group in A and B; n = 5 mice per group in C. Data are shown as mean values. 5of9

6 Fig. S4. The phenotypes of TAMs in MCaP0008 and MMTV-PyVT tumors. (A) Cytokine expression in TAMs from well- or poorly perfused areas in MCaP0008 tumors. To mark cells proximal to perfused blood vessels, MCaP0008 tumor-bearing mice were injected i.v. with 200 μg Hoechst After 5 min of circulation, mice were perfused with PBS, and tumors were harvested. TAMs were enriched by CD11b microbeads and were isolated by flow sorting from fresh tumors. TAMs from 8 10 tumors were pooled as three samples in each group. Total RNA was extracted from sorted cells and converted to cdna for quantitative real-time PCR. Data shown are the mean values ± SEM of the ratios of target gene to β-actin. *P < 0.05, **P < 0.01 compared with F4/80 + Ho cells. (B) The dose effect of DC101 treatment on TAM phenotypes in MMTV-PyVT tumors. Quarter-dose, but not full-dose, DC101 treatment polarized Ho TAMs to an M1-like phenotype in MMTV-PyVT tumors. Ho + TAMs were separated, and levels of typical M1-like markers (inos and IL-12a) and an M2-like marker (Arg1) were analyzed as described in Fig. 4. Five tumors were pooled as one sample in each group. Fig. S5. Effect of different doses of anti-vegfr2 treatment on tumor-infiltrating CD8 + and CD4 + T cells in MCaP0008 tumors. MCaP0008 tumor-bearing mice were treated with four doses of DC101 (20 or 40 mg/kg bw) or rat IgG (40 mg/kg bw) administered at 3-d intervals. (A) Representative flow cytometric analyses of tumor-infiltrating CD4 + and CD8 + T cells are shown. Lymphoid cells in CD45 + cells were analyzed with expression of CD4 and CD8. Numbers show the percentages of CD4 + and CD8 + T cells in total viable cells. (B) The percentage of tumor-infiltrating CD4 + and CD8 + T cells in total viable cells is shown (n =8 10 mice). Data are shown as mean values ± SEM. *P < 0.05, **P < 0.01 compared with IgG control. 6of9

7 Fig. S6. Half-dose anti-vegfr2 treatment increases CD8 + T cells in a model of spontaneous autochthonous breast cancer in C3H mice. (A) Tumor-infiltrating CD4 + and CD8 + T cells in the spontaneous autochthonous breast tumors. A naturally developed breast tumor (P1073) was transplanted into syngeneic C3H mice. When tumors reached 4 5 mm in diameter, these mice were treated with four doses of DC101 (20 or 40 mg/kg bw) or rat IgG (40 mg/kg bw) as control, administered at 3-d intervals. Tumors were harvested on day 11 after treatment. Flow data were analyzed as described in Fig. 5A. Representative flow figures are shown. Numbers show the percentages of CD4 + and CD8 + T cells in total viable cells. (B) The percentage of tumor-infiltrating CD4 + and CD8 + T cells in total viable cells. n = 5 mice. Data are shown as mean values ± SEM. *P < 0.05, **P < 0.01 compared with IgG control. Fig. S7. Vaccination dramatically increases tumor-infiltrating CD8 + T cells in MMTV-PyVT breast cancers. Whole breast tumor tissue cell vaccination dramatically increased tumor-infiltrating CD8 + T cells (n = 8 mice per group). The vaccination protocol is described above in the legend to Fig. 6A. Data are shown as mean ± SEM. *P < 0.05, **P < 0.01 compared with PBS control. 7of9

8 Fig. S8. Effect of CD8 + T-cell depletion on tumor growth during vaccine therapy. MMTV-PyVT tumor-bearing mice were injected i.p. with anti-cd8a monoclonal antibody or isotype rat IgG2a (2A3) (200 μg per mouse) on days 1 (1 d before the first vaccination), 1, 7, and 13. (A) Representative flow data for CD4+ and CD8+ T-cell populations with and without anti-cd8a antibody treatment. Administration of anti-cd8a monoclonal antibody selectively depletes CD8 + T cells in both peripheral blood and breast tumors. Blood was drawn on day 10 after the first vaccination, and tumors were harvested for flow analysis at the end of the experiment. (B) Tumor growth curves. Tumor size was measured at 3-d intervals beginning at day 7 after the first vaccination (the first day of DC101 treatment). The vaccine/dc101-10/anti-cd8 group had 10 mice, the vaccine/dc101-10/2a3 group had five mice, and all other groups had 11 mice. Fig. S9. The intrinsic characteristics of MMTV-PyVT breast cancer vasculature. Mice bearing MMTV-PyVT breast cancers were injected i.v. with 100 μg of FITClabeled tomato lectin in PBS. After 5 min, tumors were harvested and stained for pericyte marker (NG2) and endothelial cell marker (CD31). Confocal images were taken within randomly selected fields excluding the tumor periphery (four to six fields per tumor, 8 10 tumors per group). (A) A representative confocal image. Green, FITC-lectin; red, NG2; blue, CD31. A 20 objective was used for imaging. (Scale bar, 100 μm.) (B) Quantification of tumor vessel perfusion (area fractions of FITC-lectin/CD31) and pericyte coverage (area fractions of NG2/CD31). Data are shown as mean ± SEM. 8of9

9 Table S1. Name Mouse primer sequences Primer sequences Murine β-actin For: 5 ATCGTGCGTGACATCAAAGA 3 Rev: 5 ACAGGATTCCATACCCAAGAAG 3 marg1 For: 5 CAACCAGCTCTGGGAATCTG 3 Rev: 5 AATCGGCCTTTTCTTCCTTC 3 mil-10 For: 5 CCAGAGCCACATGCTCCTA 3 Rev: 5 AGGGGAGAAATCGATGACAG 3 mccl-17 For: 5 TGCTTCTGGGGACTTTTCTG 3 Rev: 5 TGGCCTTCTTCACATGTTTG 3 mccl-22 For: 5 GTCCTTCTTGCTGTGGCAAT 3 Rev: 5 ACGGTTATCAAAACAACGCC 3 mmrc-1 For: 5 CCTGAACAGCAACTTGACCA 3 Rev: 5 GCAATGGCCATAGAAAGGAA 3 mnos2 For: 5 CCACCTCTATCAGGAAGAAA 3 Rev: 5 CTGCACCGAAGATATCTTCA 3 mil-12a For: 5 GCCAGGTGTCTTAGCCAGTC 3 Rev: 5 AGCTCCCTCTTGTTGTGGAA 3 mil-1b For: 5 TGCCACCTTTTGACAGTGAT 3 Rev: 5 TGTCCTCATCCTGGAAGGTC 3 mtnfa For: 5 CCGATGGGTTGTACCTTGTC 3 Rev: 5 CGGACTCCGCAAAGTCTAAG 3 mcxcl-9 For: 5 AGTGTGGAGTTCGAGGAACC 3 Rev: 5 GAGTCCGGATCTAGGCAGG 3 mcxcl-11 For: 5 AGCTGCTCAAGGCTTCCTTA 3 Rev: 5 AGTAACAATCACTTCAACTTTGTCG 3 mcsf-1 For: 5 TCACAACCTCATCCTTCTGCG 3 Rev: 5 GACCCAGTTAGTGCCCAGTGA 3 mmmp-9 For: 5 TGAGTCCGGCAGACAATCCT 3 Rev: 5 CCCTGGATCTCAGCAATAGCA 3 mtgfb For: 5 GCTGAACCAAGGAGACGGAAT 3 Rev: 5 GCCTTAGTTTGGACAGGATCTG 3 9of9