SUPPLEMENTARY INFORMATION
|
|
- Brianne Hutchinson
- 5 years ago
- Views:
Transcription
1 DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer Mcmilln Pulishers Limited. All rights reserved
2 logfc SUPPLEMENTARY INFORMATION FACS purifiction for SCs & progenitors of emryo, dult nd tumour E E7 P Live Singlets Live Singlets d SCC mirna Signture: more thn FC in SCCs compred to Norml SCs mir- mir-3 mir- mir-9 mir- mir-3 mir-9 mir-7 mir-3 let-7i mir- mir-79 mir- mir-7 mir-9 mir- mir- mir-9 mir-93 mir-39 mir-33 mir- mir- mir-7 e Reltive mrna level DAPI CD3, CD7 DAPI Sc CD. GFP Linege Neg Lhx Live Epi HF Pdzrn3 E7 SSC-W GFP P SSC-W CD3 p3 FSC-W FSC-W Integrin α Lhx Epi Singlets HF-SC ORS Pdzrn3 P Sc DAPI CD3, CD7 DAPI CD3, CD7, CD CD CD CD3 Linege Neg Live Linege Neg Lhx Adult Sc SSC-W GFP Tumor SSC-W Integrin β Integrin α FSC-W FSC-W Integrin α c CSC / HF-SC Epi... Singlets Suprsl SC specfic mrkers in emryo & dult SC specfic mrkers in tumours HF-SCs epi-scs SCC-BC enriched SCC-BC depleted Fold Chne: SCC/HF-SC.. mir- mir-3 mir-9 mir- mir-7 mir- mir-c let-7c HF Ccnd Vlidtion of SCC signture mirs Bsl mir-c DAPI Cd CD3, CD7 CD mir-7 K Sc Integrin α Vim Tumor SSC-W GFP K FSC-W Epi HF HF-SCs nd progenitors epi-scs nd progenitors ORS (out root sheet) SCC-sl SCC-suprsl Lhx Nftc SCC UP sig mir- mir-3 mir-9 mir- mir-7 mir- SCC DOWN sig mir-c let-7c mir-c mir-7 f UP-regulted in SCCs DOWN-regulted in SCC-s In situ hyridiztion of skin/scc undnt mirnas Emryo Adult Ppillom SCC mir- mir-3 mir- mir mir-9 mir- mir-3 mir-7 mir-3 mir-3 mir- mir-97 mir- mir- mir-7 mir- mir- mir-7 mir- mir- mir- mir- mir- mir- mir-99 mir- mir- mir-99 mir-3 mir- mir-9 mir-9 mir-3 mir-3 let-7c mir- mir- mir-33 mir-99 mir-3 mir- mir-7 mir- mir- mir- mir- mir-339 mir- mir-3 mir-9 mir-9 mir- mir- mir- mir- mir-c mir-3 mir-93 mir- mir- mir-3 mir-3 mir-9 mir-9 mir- mir- mir-7 mir- mir-3 mir-33 mir- mir- mir-7 mir-3c mir-7 mir- mir-3 mir- mir-3 mir- mir-3 mir- mir-77 mir-c mir-93 mir-93 mir-3 mir Supplementry Figure mirna profiling of skin progenitors from different stges of development, homeostsis nd tumourigenesis., FACS scheme for norml stem cells nd progenitors t different stges of skin development, nd for ppillom nd SCC progenitors nd their progenies t different stges of mlignnt progression. Plese refer to Methods for detiled gtes. -c, Quntittive PCR to quntify the reltive mrna levels for group of cell-type specific mrkers to vlidte the purity of FACS isolted popultions: Lhx nd Pdzrn3 for HF progenitors (E7, P), Cd3 nd Lhx for dult HF stem cells, Trp3 for E7 Epiderml progenitors, Sc for P nd dult epiderml progenitors; Ccnd, Cd, Krt nd Vim for SCC-SC upregulted mrkers nd Krt, Lhx nd Nftc for SCC-SC downregulted mrkers compred to HF-SCs. Pired t-tests were used. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. P<.. d, SCC signture mirnas (cut off RRMM) tht re conserved etween mouse nd humn nd exhiit X chnge in sl cells (BCs) of SCCs reltive to norml SCs (DEseq P vlue <.). e, qpcrs confirmed suset of mirna signtures discovered in mirna profiling. Pired t-tests were used. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. P<.. f, mirna in situ hyridiztions of known nd SCC-relted mirnas in development nd mlignnt trnsformtion. These results showed tht mir-, n essentil mirna known to govern skin epithelium homeostsis, is rodly nd undntly expressed throughout skin development nd trnsformtion; mir-3, known to promote skin strtifiction nd suppress metstsis, is specificlly enriched in the suprsl lyers t ll stges; mir- known to mintin norml SC self-renewl nd drive skin tumourigenesis is trnsiently upregulted during erly stge of enign tumourigenesis; mir- 7 is rodly expressed during emryogenesis nd lter ecomes more restricted to suprsl lyers during dult nd tumour development. At lest three iologicl replictes were performed; shown re representtive imges. Scle r = µm. Mcmilln Pulishers Limited. All rights reserved
3 Reltive Luciferse ctivity # of reds per reds SUPPLEMENTARY INFORMATION Genomic mir- locus RNA Pol II driven mir- mir- Drosh: mirna iogenesis SA-miR design SA-miR- HBGFP PGK U mir- mture sequence TAGCTTATCAGACTGATGTTGA 3 mir- mture sequence CAACAGCAGTCGATGGGCTGTC 3 SA-miR design SA-miR- HBGFP PGK U mirna trgeting TAGCTTATCAGACTGATGTTGA 3 CAACAGCAGTCGATGGGCTGTC 3 mir- trgets mir- trgets c.... % % % SA-miR Control mir- mir-9 mir-scr mir- mir-3(-) mir-7 Control SH-miR Vector N.S Scr 3'UTR mir- Sensor Accurte processing of mir end with SA-miR Enhnced trget sensitivity with SA-miR Reported ckone: SH-miR Control SA-miR Next genertion ckone: SA-miR Vector N.S p3 3'UTR mir-3 sensor Vector Scr 3'UTR mir- Sensor 3 Vector p3 3'UTR mir-3 Sensor Supplementry Figure Design nd chrcteriztion of lentivirl SAmiRNA expression vectors., Schemtic to show differences in mir- nd mir- sequences nd the corresponding strnd-specific SA-miRs., SA-miRNAs re pooled nd pckged into lentivirus to trnsduce cultured mouse SCC cells. Cells were isolted dys post infection, sorted with endogenous GFP, nd sujected to deep sequencing. The normlized reds for position nd isomirs were plotted to demonstrte fithful end processing using SA-miRNA system. Grey r represents control cells trnsduced with SA vector driving the expression of scrmled sequence lone, reflecting endogenous isomir levels. A different Scrmled sequence ws used from the shown in the grph. c, To compre the efficcy of our SA-miRs with oft-used SH-miRs (pentr/psm (U), Addgene 737), we performed luciferse reporter ssys to exmine the effects of mir- nd mir-3 on their estlished trget genes Scr nd p3,, respectively, expressed in either the SH-miR or the SA-miR ckone. All vectors were co-trnsfected with mir mimics t equl concentrtion in controls nd experiments. Similr sensor-medited inhiition (chieved y nti-sense sequences of mir- or mir-3) ws oserved from oth, ut stronger trget inhiition ws oserved only from SA-miRNA medited mir- nd mir-3 expression when using 3 UTR reporters. Pired t-tests were used to compre SH-miR to SHcontrol, nd SA-miR to SA-control, respectively. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<.. N.S. Not Significnt. 3 Mcmilln Pulishers Limited. All rights reserved
4 SA-miR Tumour deth & prolifertion Cspse 3 Ki7 Ki7 quntifiction: or SA-miR tumours Ki7+ nuclei % SA-miR Clonl dominnce y mirs (DNA sequencing, cont. Fig. 3d) mir- Tumor () MIR- mir-99 Tumor () MIR-99 mir-c Tumor (3) MIR-c mir- Tumor () MIR- mir- Tumor () mir- Tumor () MIR- MIR- mir- Tumor () MiR- mir- Tumor () MiR- Supplementry Figure 3 More cndidte oncomirs in skin SCCs identified from in vivo pooled screen with SA-miRNA lirry., Cspse 3 nd Ki7 stining of tumours show unchnged poptosis nd heightened mitosis, respectively, in oncogenic HRs tumours derived from the SAmiRNA lirry trnsduced cohort compred to tht of lirry. Scle r = µm. At lest five iologicl replictes were performed; shown re representtive imges. Ki7 positive nuclei s percentge of totl nuclei ws quntified nd shown. Pired t-tests were used to compre SA-miR to. Shown re men ± s.d. n = independent experiments. P<.)., Trgeted deep sequencing of SA-miRNA inserts in the tumours emerging from nimls trnsduced with the SA-miR lirry showed tht three different mirna fmilies hd mirs tht were overrepresented in tumours. OncomiRs mir- nd mir- were lso cptured. Clonl dominnce ws not oserved in regions of the ckskin djcent to the tumour (shown) or in E. or P skin (see Fig. 3). Numers of tumours re shown in prentheses. The frequency of clonl dominnce in these tumours ws significntly less thn tht seen for mir- nd mir- (see Fig. 3). Mcmilln Pulishers Limited. All rights reserved
5 In vivo epidermis: restricted expression of selected strnd with SA-miR Signl specificity shown with wounded mouse ckskin Scrmle mir- mir- Reltive mirna level mir- mir- SA-miR- SA-miR- mir- +/- mir- -/- c K K Scr Colony formtion ssy: HF-SCs mir- mir- Holoclone # d % EdU+ 7 3 Scr mir- mir- Anoikis in culture: MKs % AnnexinV+ 3 Scr mir- mir- mir-/ Supplementry Figure Vlidtion of mir- in driving SCC progression in vivo., Strnd-specific expression of SA-miR- nd SA-miR- vectors in vivo. Note tht SA-miR- elevted mir- ut did not ffect mir- levels; SA-miR- elevted mir-, ut did not ffect mir- levels in the skin epidermis 3 dys fter infection. Pired t-tests were used to compre SA-miR to. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<., P<.., In situ hyridiztions on dy 7 post-wound mouse ckskin, showing specific mir- nd mir- proe signls in heterozygous ut not mir--/- skin. MiR- locus ws trnscriptionlly ctivted during wounding nd hs een proposed to e regulted y numer of trnscription fctors in the context of norml skin nd cncer,3. Scle r = µm. c, SCs purified from the ulge of HFs from WT skin nd then trnsduced with either, SA-miR- or SA-miR- were sujected to colony formtion ssys in culture. Colonies were stined with Rhodmine B, weeks fter seeding t the concentrtions indicted t left. Numers of holoclones (defined y clones >µm in dimeter nd typicl of stem cells) re shown in the grph elow. Note elevtion in the numer of stem cells, prticulrly when mir- is elevted. d, SA-miR overexpression of mir- or mir- in kertinocytes resulted in their incresed prolifertion (top grph) nd decresed poptosis in suspension cultures (ottom grph). Pired t-tests were used to compre SA-miRs to. At lest three iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. If not ssocited with pssenger strnd mir, denotes sttisticl significnce. P<., P<.. Mcmilln Pulishers Limited. All rights reserved
6 Gel digestion: Crispr edited mouse SCCs sgrna Scr mir 7 p p p Supplementry Figure CRISPR/CAS strtegy to knockout mir- locus. Surveyor ssy: the CRISPR/CAS-edited mir- locus is mplified y PCR from ΔSCC genomic DNA nd then digested y n endonuclese enzyme tht only cuts the non-mtched DNA position (introduced y CRISPR editing). If editing is successful, the 7 p PCR product is cleved into nd p smller nds. Mcmilln Pulishers Limited. All rights reserved
7 Normlized reds c d 7 3 Reltive mrna level mir nd mir expression in mouse nd humn SCCs mouse SCC humn HNSCC mir- mir- mir-3 mir-3 mir- mir- Normlized reds 3 mir- mir- mir-3 mir-3 mir- mir- SA-miR driven mir expression in humn cells FDu HCT 3 SA-miR- SA-miR- Reltive mrna level SA-miR- SA-miR- CRISPR/CAS trgeting of mir- locus in humn SCC cells GTACCACCTTGTCGGG TAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 (+) 3 CATGGTGGAACAGCCCATCGAATAGTCTGACTACAACTGACAACTTAGAGTACCGTTGTGGTCAGCTACCCGACAGACTGTAAAACCATA (-) PAM Trget (p) GTACCACCT GCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 GTACC GACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT 3 G ATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTC TGACATTTTGGTAT GATGGGCTGTC TGACATTTTGGTAT 3 GTACC CTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACATTTTGGTAT 3 ATTCACATGG CAS9 mir- mir- sgrna (+) (-) mir- mir- Scrmle In situ hyridiztion: mir-/ expression in humn Norml Skin HNSCC Grde HNSCC Grde e Gel digestion: Crispr edited humn SCCs sgrna Scr mir 7 p 3 p p Tumour Vol (mm3) f 3 Humn SCCs pscc mir/ SCC p <. 3 Weeks post trnsplnt Supplementry Figure mir- expression nd CRIPSR/CAS in humn SCCs., mirna sequencing dt of SCCs show tht mir- ut not mir- 3 or mir- is stilized in mouse skin SCCs nd humn HNSCCs, even though ll of these mir guide counterprts re undnt in these tumours. Shown re men ± s.d. n = 3 independent experiments., In situ hyridiztion of mir- nd mir- in prffin-fixed humn tissue rrys with HNSCCs nd norml tissues. Note tht hyridiztions re not s elegnt s with frozen sections (see min Figures) ut the dt re still cler. Scle r = µm. c, Demonstrtion tht the SA-miR vectors used to drive mir- nd mir- chieve elevted expression in humn FDu nd HCT cells. At lest five iologicl replictes were performed; shown re men ± s.d. n = 3 independent experiments. P<., P<.. N.S. Not Significnt. Pired t-tests were used to compre SA-miRs to. d-f, CRISPR/CAS edited humn A3 SCC cells, surveyor ssy, nd deficiency in tumourigenesis. For oth mouse nd humn SCCs, top three predicted off-trget sites were sequenced nd no muttions were detected in the three clones tested (see Methods) Shown re men ± s.d. n = 3 independent experiments. Two-wy ANOVA with repeted mesurement ws performed. 7 Mcmilln Pulishers Limited. All rights reserved
8 CAPN FKPM RGMA FKPM CAPN FKPM 3 - mir- cndidte trget expression in HNSCCs vs. Norml tissues p <. p <. p <. p <. HNSCC Norml HNSCC Norml p <. p =. p =.3 p <. ROR FKPM - HNSCC Norml HNSCC Norml FAM7A FKPM SSBP FKPM 3 HNSCC Norml Cndidte trget expression correltion with mir- in HNSCC p =.3 p =.39 p =. p =. 3 FAM7A FKPM LCA FKPM LCA FKPM HNSCC Norml - HNSCC Norml High Low High Low High Low High Low PPML FKPM PPML FKPM TIMP FKPM - HNSCC Norml FHL FKPM ROBO FKPM FHL FKPM mir- cndidte trget expression in HNSCCs vs. Norml tissues p <. p <. p =.33 PDCD FKPM HNSCC Norml HNSCC Norml HNSCC Norml p =.9 UBL3 FKPM p =.9 - HNSCC Norml HNSCC Norml HNSCC Norml Cndidte trget expression correltion with mir- in HNSCC PDCD FKPM p =.7 High Low High Low PAIPB FKPM PAIPB FKPM p <. YOD FKPM p <. p =.99 High Low RGMA FKPM - p =. p <. p =.3 p =. 3. ROR FKPM SSBP FKPM - -. High Low High Low High Low High Low TIMP FKPM..... ROBO FKPM 3 - p =. p =.9 UBL3 FKPM High Low High Low YOD FKPM High p =. Low c Puttive mir- trget Puttive mir- trgets Low RGMA level correltes with poor survivl in humn HNSCC Low PDCD level correltes with poor survivl in humn HNSCC Low YOD level correltes with poor survivl in humn HNSCC P vlue=.9e- P vlue=.3e- P vlue=.99e-3 Supplementry Figure 7 More mir- nd mir- puttive trgets in SCCs., of mir- nd of mir- predicted trgets re downregulted in HNSCCs compred to norml tissues. Shown re men ± s.d. n = 3 for norml tissues nd n = 3 for tumours. Unpired t-test ws used to compre norml to tumour smples., Predicted trgets tht inversely correlte with mir- or mir- levels in tumours, respectively. Shown re men ± s.d. n = for tumour smples. Pired t-test ws used to compre low to high expression tumour smples. c, In ddition to mir- trget PHACTR (see min text), RGMA (mir- trget), PDCD(miR- trget) nd YOD(miR- trget) expression levels inversely correlted with poor prognosis in HNSCCs n = 7~33 tumour smples. Log-rnk test method ws used to compre ptient survivl etween high nd low expression smples. Mcmilln Pulishers Limited. All rights reserved
9 SA-miR-.. pscc- SCC-SA-miR- Phctr αtu Vector WT PP Phctr αtu Supplementry Figure mir- trgets Phctr in SCCs. - Western lot showing suppressed levels of Phctr resulting from SA-miR- overexpression (), nd Phctr levels from WT or PP mutnt expression (). In, the numers indicte densitometry vlues normlized ginst α-tuulin nd mesured y ImgeJ. At lest three iologicl replictes were performed; shown re representtive imges. 9 Mcmilln Pulishers Limited. All rights reserved
10 Phctr Western Blot (Suppl Figure 7d) SCC-SA-miR- pscc- SA-miR- Phctr Western Blot (Suppl Figure 7e) SCC-SA-miR- pscc- Control WT Phctr PP Phctr SA-miR- R Western Blot (Figure f) shphctr shscr SA-miR- Supplementry Figure 9 Whole Western Blot gel scn. Mcmilln Pulishers Limited. All rights reserved
11 Supplementry References Cmpeu, E. et l. A verstile virl system for expression nd depletion of proteins in mmmlin cells. PLoS ONE, e9 (9). Yi, R., Poy, M. N., Stoffel, M. & Fuchs, E. A skin microrna promotes differentition y repressing stemness. Nture, 9 (). Ahmed, M. I., Mrdryev, A. N., Lewis, C. J., Shrov, A. A. & Botchkrev, N. V. MicroRNA- is n importnt downstrem component of BMP signlling in epiderml kertinocytes. Cell Sci., (). 3 Snd, M. et l. Microrry nlysis of microrna expression in cutneous squmous cell crcinom. J. Dermtol. Sci., 9 (). Supplementry Tle Legends Supplementry Tle : SCC signture mirs -- fold chnge (FC) of expression in SCC compred to their control SCs; whether lso cptured s pp-bc signture. Supplementry Tle : SA-miRNA lirry oligo sequences. Supplementry Tle 3: Counts of tumors with clonl dominnce cptured in screen. Supplementry Tle : 77 genes re more thn fold chnged in hed & neck SCCs compred to norml tissue. Supplementry Tle : genes re predicted to e mir- nd/or mir- trgets. Supplementry Tle : Puttive mir cndidtes correlte with ptient prognosis. Supplementry Tle 7: Brcodeded sequencing primers for SA-miRNA lirry. Supplementry Tle : Primers nd oligos used. Mcmilln Pulishers Limited. All rights reserved
SUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSupplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.
Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More information11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationSupplementary Figure 1 a
% DAPI + Are Supplementry Figure 1 MOI 1 MOI.5 MOI.25 5 4 3 MOPC MOPC, LCMV reltive VL4 expression 2 1 d1 d2 d3 MOI.125 MOI.625 untreted Supplementry Figure 1: LCMV replictes in MOPC without ffecting cell
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationDefective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationA rt i c l e s. a Events (% of max)
Continuous requirement for the TCR in regultory T cell function Andrew G Levine 1,, Aron Arvey 1,,4, Wei Jin 1,,4 & Alexnder Y Rudensky 1 3 14 Nture Americ, Inc. All rights reserved. Foxp3 + regultory
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationNdfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationUnique roles of the unfolded protein response pathway in fungal. development and differentiation. Kwang Woo Jung, Yee Seul So, & Yong Sun Bahn *
Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationCRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus
CRISPR/Cs9: An inexpensive, efficient loss of function tool to screen humn disese genes in Xenopus Frgment nlysis to test the efficcy of CRISPR Cs9 protein is more effective nd less toxic CRISPR/Cs9 provides
More informationMERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1849 neurotoxic insults cute synptic dysfunctions chronic cognitive deficits epigenetic lockde of gene trnscription e.g. Bdnf IV, synptophysin neurotoxic insults Aβ H 2 O 2 Cdk5/p25 P GR1
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationPhosphorylated p70s6k in noninvasive low grade urothelial carcinoma of the bladder: correlation with tumor recurrence
(2014) 16, 611 617 2014 AJA, SIMM & SJTU. All rights reserved 1008-682X www.sindro.com; www.jndrology.com Mle Helth Open Access ORIGINAL ARTICLE Phosphorylted p70s6k in noninvsive low grde urothelil crcinom
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationJournal of Hainan Medical University.
132 Journl of Hinn Medicl University 2017; 23(11): 132-136 Journl of Hinn Medicl University http://www.hnykdxxb.com Assessment of the efficcy nd sfety of bronchil rtery perfusion chemotherpy combined with
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationSupplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationAxl Promotes Cutaneous Squamous Cell Carcinoma Survival through Negative Regulation of Pro-Apoptotic Bcl-2 Family Members
ORIGINAL ARTICLE Axl Promotes Cutneous Squmous Cell Crcinom Survivl through Negtive Regultion of Pro-Apoptotic Bcl-2 Fmily Memers Emmnouil S. Ppdkis 1, Monik A. Cichoń 1, Jshmin J. Vys 1, Nkul Ptel 1,
More informationFoxP3 + regulatory CD4 T cells control the generation of functional CD8 memory
Received Fe Accepted 6 Jul Pulished 7 Aug DOI:.8/ncomms99 FoxP + regultory CD T cells control the genertion of functionl memory M.G. de Goër de Herve,,, S. Jfour,,, M. Vllée, & Y. Toufik, During the primry
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationLETTERS. Interferon modulation of cellular micrornas as an antiviral mechanism
Vol 449 18 Octoer 27 doi:1.138/nture625 LETTERS Interferon modultion of cellulr micrornas s n ntivirl mechnism Irene M. Pedersen 1, Guofeng heng 3, Stefn Wielnd 3, Stefno Volini 4, rlo M. roce 4, Frncis
More informationChemically Modified Synthetic microrna-205 Inhibits the Growth of Melanoma Cells In Vitro and In Vivo
originl rticle The Americn Society of Gene & Cell Therpy Chemiclly Modified Synthetic microrna-25 Inhibits the Growth of Melnom Cells In Vitro nd In Vivo Shunsuke Noguchi 1, Juny Iwski 1,2, Minmi Kumzki
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationCD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator
CD16 inhiits ctivtion of humn CD4 + T cells through interction with herpesvirus entry meditor Guifng Ci, Anuknth Anumnthn, Juli A Brown, Edwrd A Greenfield, Bogong Zhu & Gordon J Freemn CD16, glycosylphosphtidylinositol-nchored
More informationmir-124 acts through CoREST to control onset of Sema3A sensitivity in navigating retinal growth cones
cts through CoREST to control onset of Sem3A sensitivity in nvigting retinl growth cones Mrie-Lure Budet 1, Krishn H Zivrj 1, Cei Areu-Goodger 2, Alistir Muldl 1, Jvier Armisen 3, Cherie Blenkiron 3, Leonrd
More informationA combinatorial extracellular matrix platform identifies cell-extracellular matrix interactions that correlate with metastasis
Received 1 Jul 1 Accepted 6 Sep 1 Pulished 9 Oct 1 DOI: 1.138/ncomms18 A comintoril extrcellulr mtrix pltform identifies cell-extrcellulr mtrix interctions tht correlte with metstsis Nthn E. Reticker-Flynn
More informationSUPPLEMENTARY INFORMATION
Supplementry Informtion Supplementry Figure legends Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. The hrored domins, their puttive cytologicl functions, nd
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationOvercoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme
Cittion: Moleculr Therpy Nucleic Acids (214) 3, e15; doi:1.138/mtn.214.3 214 The Americn Society of Gene & Cell Therpy All rights reserved 2162-2531/14 www.nture.com/mtn Overcoming T79M-sed Tyrosine Kinse
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationCritical role of c-kit in beta cell function: increased insulin secretion and protection against diabetes in a mouse model
Dietologi (1) 55:14 5 DOI 1.17/s15-1-5-5 ARTICLE Criticl role of c-kit in et cell function: incresed insulin secretion nd protection ginst dietes in mouse model Z. C. Feng & J. Li & B. A. Turco & M. Riopel
More informationButyrate inhibits pro-proliferative mir-92a by diminishing c-myc-induced mir-17-92a cluster transcription in human colon cancer cells
Hu et l. Moleculr Cncer (25) 4:8 DOI.86/s2943-5-45-x RESEARCH Open Access inhiits pro-prolifertive mir-92 y diminishing -induced mir-7-92 cluster trnscription in humn colon cncer cells Shien Hu, Ln Liu
More informationHistone H2AX is integral to hypoxia-driven neovascularization
Histone H2AX is integrl to hypoxi-driven neovsculriztion Mtin Economopoulou 1,5, Hrld F Lnger 1,5, Arkdy Celeste 1, Vleri V Orlov 1, Eun Young Choi 1, Mingcho M 2, Athnssios Vssilopoulos 3, Els Cllen 1,
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationTargeting mir-21 for the Therapy of Pancreatic Cancer
originl rticle The Americn Society of Gene & Cell Therpy Trgeting mir-21 for the Therpy of Pncretic Cncer Flvie Sicrd 1,2, Mrion Gyrl 1,2, Huert Lulk 1,2, Louis Buscil 1,2 nd Pierre Cordelier 1,2 1 INSERM
More informationORIGINAL ARTICLE ABSTRACT INTRODUCTION
ORIGINAL ARTICLE LOSS OF EPCAM STAINING CORRELATES WITH POOR OUTCOME IN CRC, Wng et l. Reduction in membrnous immunohistochemicl stining for the intrcellulr domin of epithelil cell dhesion molecule correltes
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSignificance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues
Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto
More informationARTICLE. Identification of essential genes for cancer immunotherapy
doi:1.138/nture23477 Identifiction of essentil genes for cncer immunotherpy Shshnk J. Ptel 1,2 *, Neville E. Snjn 3,4 *, Rigel J. Kishton 1, Arsh Eidizdeh 1, Sumn K. Vodnl 1, Mggie Cm 1, Jred J. Grtner
More informationDownregulation of Notch regulated Ankyrin Repeat Protein Exerts Antitumor Activities against Growth of Thyroid Cancer
Originl Article Downregultion of Notch regulted Ankyrin Repet Protein Exerts Antitumor Activities ginst Growth of Thyroid Cncer Bing Feng Chu 1,2, Yi Yu Qin 3, Sheng Li Zhng 2, Zhi Wei Qun 2, Ming Di Zhng
More information