Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
|
|
|
- Deirdre Reeves
- 5 years ago
- Views:
Transcription
1 Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1, Xin Qi 1, 2, Jing Li 1, 2, Dehai Li 1, 2, Qianqun Gu 1, 2, Tianjiao Zhu 1, 2, * 1, 2, *, and Ming Liu SI Tables Table S1. 13 C NMR data for compounds 1-5 (recorded in CDCl 3 ) 1 a 2 a 3 a 4 a 5 a position C, type C, type C, type C, type C, type , C 170.1, C 170.1, C 170.1, C 170.1, C , CH 53.6, CH 53.6, CH 53.7, CH 53.7, CH , CH 70.9, CH 70.9, CH 70.9, CH 70.9, CH , C 172.9, C 172.9, C 173.0, C 173.0, C , CH 50.1, CH 50.1, CH 50.1, CH 50.1, CH , CH 75.2, CH 75.2, CH 75.3, CH 75.3, CH , CH 74.8, CH 74.8, CH 74.8, CH 74.8, CH , CH , CH , CH , CH , CH , CH , CH , CH , CH , CH 3 1" 28.2, CH , CH , CH , CH , CH 2 2" 29.2, CH , CH , CH , CH , CH 2 3" 22.4, CH , CH , CH , CH , CH 2 4" 13.9, CH , CH , CH , CH , CH 2 5" 28.9, CH , CH , CH 2 6" 14.0, CH , CH , CH 3 1' 112.4, C 112.6, C 112.6, C 112.5, C 112.5, C 2' 150.5, C 150.5, C 150.5, C 150.5, C 150.5, C 3' 128.3, C 128.0, C 128.0, C 128.3, C 128.3, C 4' 124.1, CH 124.4, CH 124.4, CH 124.1, CH 124.1, CH 5' 118.9, CH 119.0, CH 119.0, CH 119.0, CH 119.0, CH 6' 119.6, CH 120.0, CH 120.0, CH 119.7, CH 119.7, CH 7' 169.5, C 169.3, C 169.3, C 169.4, C 169.4, C 8' 168.7, C 168.4, C 168.4, C 168.7, C 168.7, C 9' 24.9, CH , CH , CH , CH , CH 3 1"' 169.7, C 175.6, C 169.6, C 175.3, C 175.3, C 2"' 20.8, CH , CH 20.8, CH , CH 43.2, CH 2 3"' 18.9, CH , CH , CH 4"' 18.9, CH , CH , CH 3 5"' 16.8, CH , CH 3 a Spectra were recorded at 125 MHz for 13 C NMR using TMS as internal standard. 1
2 Table S2. 1 H NMR data for compounds 1-5 (recorded in CDCl 3 ) 1 a 2 a 3 a 4 a 5 a position H (J in Hz) H (J in Hz) H (J in Hz) H (J in Hz) H (J in Hz) , dd 5.28, dd (7.35, 5.28, dd (7.40, 5.28, dd (7.30, 5.28, dd (7.40, (5.90,7.50) 7.60) 7.65) 7.65) 7.60) , dq (6.80, 5.72,dq (6.80, 5.72, dq (6.75, 5.72, dq (6.80, 5.72, dq (6.85, 5.90) 7.35) 7.40) 7.30) 7.40) , m 2.53, dt (10.55, 2.70) 2.52, m 2.53, dt (10.55, 2.70) 2.51, dt (10.55, 2.70) , dd (9.80, 5.07, dd (9.85, 5.07, dd (9.85, 5.08, dd (9.85, 5.08, dd (9.85, 9.95) 10.55) 10.55) 10.55) 10.55) , m 4.98, m 4.98, m 4.98, m 4.98, m b 1.30 b 1.30 b 1.30 b 1.30 b b 1.32 b 1.32 b 1.31 b 1.31 b 1" 1.41, m; 1.70, m 1.22, m; 1. 70, m 1.22, m; 1.70, m 1.22, m; 1.70, m 1.22, m; 1.70, m 2" 1.25, m 1.25, m 1.25, m 1.24, m 1.24, m 3" 1.25, m 1.25, m 1.25, m 1.24, m 1.24, m 4" 0.85, t (6.90) 0.87, t (6.90) 1.25, m 1.24, m 1.24, m 5" 1.25, m 1.24, m 1.24, m 6" 0.87, t (6.60) 0.86, t (7.10) 0.87, t (6.80) 4' 8.51, d ( 7.90) 8.52, d (8.00) 8.52, d (8.00) 8.52, d (8.00) 8.53, d (8.00) 5' 6.90, t (8.00) 6.91, t (8.05) 6.91, t (8.05) 6.91, t (8.10) 6.91, t (8.10) 6' 7.21, d (7.90) 7.21, d (8.00) 7.21, d (8.00) 7.21, d (8.00) 7.21, d (8.00) 9' 2.23, s 2.24, s 2.24, s 2.24, s 2.23, s NH-3' 7.88, s 7.87, s 7.88, s 7.87, s 7.91, s NH , d (7.50) 7.08, d (7.60) 7.08, d (7.45) 7.08, d (7.65) 7.08, d (7.60) OH-2' 12.58, s 12.58, s 12.58, s 12.59, s 12.58, s 2"' 2.12, s 2.61, m 2.13, s 2.42, m 2.24, d (6.40) 3"' 1.20, d (1.70) 1.74, m, 1.50, m 2.13, m 4"' 1.20, d (1.70) 0.95, t (7.40) 0.98, d (6.55) 5"' 1.19, d (7.00) 0.98, d (6.55) a Spectra were recorded at 500 MHz for 1 H NMR using TMS as internal standard. b Signals that were overlapped. 2
3 Table S3. Cytotoxicity of the selected compounds against different cell lines. Compounds IC 50 (means ± SD, M) Siha K562 HL T ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.0 Cells were treated with the compounds for 72 h, and the inhibition rates were assayed by MTT methods. 3
4 Table S4. Cytotoxicity for different drugs against three cervical cancer cell lines. Compounds IC 50 (means ± SD, M) Siha CaSki HeLa Sorafenib 3.54 ± ± ± 0.16 Imatinib 9.44 ± ± ± 0.42 Cisplatin 4.59 ± ± ± 0.27 Taxol ± ± ± 0.13 NADA 0.23 ± ± ± Cells were treated with these drugs for 72 h, and the inhibition rates were assayed by MTT methods. 4
5 Table S5. Information for antibodies used in the article. Antibodies No. Company Bax 5023 Cell Signaling Technology (CST) Bak 6947S Cell Signaling Technology (CST) Bcl S Cell Signaling Technology (CST) Mcl S Cell Signaling Technology (CST) Bid 2002S Cell Signaling Technology (CST) survivin 2808S Cell Signaling Technology (CST) C-PARP 5625S Cell Signaling Technology (CST) C-cas S Cell Signaling Technology (CST) C-cas S Cell Signaling Technology (CST) Cas S Cell Signaling Technology (CST) Cas Cell Signaling Technology (CST) HPV-18 E7 GTX40864 GeneTex HPV-18 E6 GTX20070 GeneTex HPV-18 E6 (N-17) sc-1586 SANTA CRUZ p Cell Signaling Technology (CST) Rb 9309S Cell Signaling Technology (CST) cyclin D Cell Signaling Technology (CST) P-PI3k sc SANTA CRUZ PI3k sc-1637 SANTA CRUZ P-Erk 9101S Cell Signaling Technology (CST) Erk 9102S Cell Signaling Technology (CST) P-mTOR 2974S Cell Signaling Technology (CST) P-Akt 4060S Cell Signaling Technology (CST) Akt 9272S Cell Signaling Technology (CST) P-STAT EPITOMICS STAT EPITOMICS -actin EM21002 SANTA CRUZ 5
6 SI Figures Fig. S1. NADA does not decrease the mrna level of E6/E7. HeLa cells were treated with NADA (0-0.1 M) for 24 h and HPV16 E6/E7 mrna levels were measured by qpcr. qpcr reactions were performed by the ABI7500 system (Applied Biosystems, CA, USA) and SYBR green dye (Roche, Basle, Switzerland). The primer sequences were as follows: 5'-CAGGGCTGCTTTTAACTCTGGT-3'(forward) and 5'-CCTGGAAGATGGTGATGGGAT-3'(reverse) for GAPDH; 5'- CACAGGAGCGACCCAGAAAG-3'(forward) and 5'-GCATAAATCCCGAAAAGCAAAG -3'(reverse) for E6; 5'-CAGAGGAGGAGGATGAAATAGATG-3'(forward) and 5'- GCACAACCGAAGCGTAGAGTC-3'(reverse) for E7. Data represent means ± SD of relative mrna expression to the untreated cells. 6
7 Fig. S2. Histograms show the relative intensity of protein bands in Figure 6 a, b, c, d, and e, using gray analysis method. Values represent the means ± SD. * P < 0.05, ** P < 0.01 versus control group. C, control; D, DMSO. 7
8 Fig. S3. Histograms show the relative intensity of protein bands in Figure 8e using gray analysis method. Values represent the means ± SD. * P < 0.05, ** P < 0.01 versus the NADA group. 8
9 Fig. S4. To confirm the specificity effect on HPV oncoprotiens, we silenced HPV18 E6 in HeLa and examined its sensitivity to NADA. The results showed that HPV-18 E6 sirna (si18e6) could markedly downregulate E6 expression (a, b). The IC 50 value of NADA against this E6 low expressing HeLa cells were much larger than the wild-type HeLa cells, indicating HPV oncoprotiens downregulation could reduced the sensitivity of HeLa cells to NADA. (a) si18e6 downregulates the expression of E6. Cells were seeded into 6-well plates and reached 70% confluency before transfection. sirnas for HPV18 E6, and scramble sirna (sinc) were complexed with Lipofectamine 3000 (Invitrogen, Shanghai, China) according to the manufacturer s instructions and applied to each well, respectively. The transfection medium was removed and replaced with complete medium after 6 h. Then the expression level of E6 was assessed by western blotting after 24 h. sirnas were synthesized by GenePharma (Shanghai, China) and the sequences are as follows: si18e6 sense: 5 -CAUUUACCAGCCCGACGAGTT-3 and antisense:5 -CUCGUCGGGCUGGUAAAUGTT-3 ; sinc sense:5 -UUCUCCGAACGUGUACGUdTdT-3 and antisense: 5 -ACGUGACACGUUCGGAGAAdTdT-3. (b) Histogram shows the relative intensity of E6 protein bands using gray analysis method. Values represent the means ± SD. * P < 0.05, ** P < 0.01 versus the NADA group. (c) NADA shows less cytotoxicity against HeLa cells with E6 slienced. Transfected cells were treated with the indicated concentrations of NADA for 48 h, and the cell viability were assayed by MTT method. 9
10 Fig. S5. We compared the extracellular O 2 consumption rate of HeLa cells in the presence of compound 1, 2, 3, 6, 8, 10, and NADA. These tested compounds could inhibit the mitochondrial respiration of HeLa cells (a), and the inhibition activity had a positive correlation with their cytotoxicity. These compounds could also increase ROS generation (b and c), and the generation of ROS also had a positive correlation with their mitochondrial respiration inhibition and cytotoxicity. (a) Compound 1, 2, 3, 6, 8, 10 and NADA inhibit the extracellular O 2 consumption of HeLa cells. HeLa cells were seeded 40,000/well. After 24 h, the compounds (4 M) were added and the inhibition on the mitochondrial respiration was assayed using the extracellular O 2 consumption assay kit (Abcam, Cambridge, USA), according to the manufacture s protocols. (b) Compound 1, 2, 3, 6, 8, 10 and NADA increase ROS generation in HeLa cells. HeLa cells were treated these compounds (0.2 M) for 5 h, and the intracellular ROS levels were detected by flow cytometry using CM-H2DCFDA probes (Beyotime Biotechnology, Guangzhou, China). (c) Histogram shows the increase of the DCF fluorescence after treatment with these compounds. Values represent the means ± SD. * P < 0.05, ** P < 0.01 versus control. 10
11 Fig. S6. Compound 4 induces E6/E7 viral oncoproteins degradation in aconcentration dependent manner. HeLa cells were treated with the indicated concentrations of compound 4 for 24 h, and the expression levels of E6/E7 were assessed by western blotting. C, control group; D, DMSO vehicle control. 11
12 Fig. S7. HR-ESI-MS of antimycin E (1) 12
13 Fig. S8. 1 H-NMR spectrum (500 MHz) of antimycin E (1) in CDCl 3 13
14 Fig. S9. 13 C-NMR spectrum (125 MHz) of antimycin E (1) in CDCl 3 14
15 Fig. S10. DEPT spectrum (125 MHz) of antimycin E (1) in CDCl 3 15
16 Fig. S11. HSQC spectrum (500 MHz) of antimycin E (1) in CDCl 3 16
17 Fig. S12. 1 H- 1 H COSY spectrum (500 MHz) of antimycin E (1) in CDCl 3 17
18 Fig. S13. HMBC spectrum (500 MHz) of antimycin E (1) in CDCl 3 18
19 Fig. S14. NOESY spectrum (500 MHz) of antimycin E (1) in CDCl 3 19
20 Fig. S15. HR-ESI-MS of antimycin F (2) 20
21 Fig. S16. HR-ESI-MS of antimycin G (3) 21
22 Fig. S17. 1 H-NMR spectrum (500 MHz) of antimycin F (2) in CDCl 3 22
23 Fig. S18. 1 H-NMR spectrum (500 MHz) of antimycin G (3) in CDCl 3 23
24 Fig. S19. 1 H-NMR spectrum (500 MHz) of antimycins F (2) and G (3) in CDCl 3 24
25 Fig. S C-NMR spectrum (125 MHz) of antimycins F (2) and G (3) in CDCl 3 25
26 Fig. S21. DEPT spectrum (125 MHz) of antimycins F (2) and G (3) in CDCl 3 26
27 Fig. S22. HSQC spectrum (500 MHz) of antimycins F (2) and G (3) in CDCl 3 27
28 Fig. S23. 1 H- 1 H COSY spectrum (500 MHz) of antimycins F (2) and G (3) in CDCl 3. 28
29 Fig. S24. HMBC spectrum (500 MHz) of antimycins F (2) and G (3) in CDCl 3 29
30 Fig. S25. NOESY spectrum (500 MHz) of antimycins F (2) and G (3) in CDCl 3 30
31 Fig. S26. HR-ESI-MS of antimycin H (4) 31
32 Fig. S27. HR-ESI-MS of NADA (5) 32
33 Fig. S28. 1 H-NMR spectrum (500 MHz) of antimycin H (4) in CDCl 3 33
34 Fig. S29. 1 H-NMR spectrum (500 MHz) of NADA (5) in CDCl 3 34
35 Fig. S30. 1 H-NMR spectrum (500 MHz) of antimycin H (4) and NADA (5) in CDCl 3 35
36 Fig. S C-NMR spectrum (125 MHz) of antimycin H (4) and NADA (5) in CDCl 3 36
37 Fig. S32. DEPT spectrum (125 MHz) of antimycin H (4) and NADA (5) in CDCl 3 37
38 Fig. S33. HSQC spectrum (500 MHz) of antimycin H (4) and NADA (5) in CDCl 3 38
39 Fig. S34. 1 H- 1 H COSY spectrum (500 MHz) of antimycin H (4) and NADA (5) in CDCl 3. 39
40 Fig. S35. HMBC spectrum (500 MHz) of antimycin H (4) and NADA (5) in CDCl 3 40
41 Fig. S36. NOESY spectrum (500 MHz) of antimycin H (4) and NADA (5) in CDCl 3 41
2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
![2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein](/thumbs/86/94743397.jpg "2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein")
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
Supporting Information
Supporting Information A Systemic Study on the Biogenic Pathways of Yezo otogirins: Total Synthesis and Antitumor Activities of (±)-Yezo otogirin C and its Structural Analogues Wei Yang, Jingming Cao,
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Information
Supplementary Information New Highly Oxygenated Germacranolides from Carpesium divaricatum and their Cytotoxic Activity Tao Zhang, 1 Jin-Guang Si, 1, 2 Qiu-Bo Zhang, 1 Gang Ding, 1 and Zhong-Mei Zou 1*
SUPPORTING INFORMATION FOR
SUPPORTING INFORMATION FOR Cytotoxic bagremycins from Mangrove-derived Streptomyces sp. Q22 Lei Chen, Weiyun Chai, Wenling Wang, Tengfei Song, Xiao-Yuan Lian,*,, Zhizhen Zhang,*, *Corresponding Authors.
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Supporting Information
Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,
Supplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells
Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells
Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing
RESEARCH COMMUNICATION. sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells
RESEARCH COMMUNICATION sirna Mediated Silencing of NIN1/RPN12 Binding Protein 1 Homolog Inhibits Proliferation and Growth of Breast Cancer Cells Wei-Yi Huang, Dong-Hui Chen, Li Ning, Li-Wei Wang* Abstract
IMMP8-1. Different Mechanisms of Androg and IPAD on Apoptosis Induction in Cervical Cancer Cells
IMMP8-1 Different Mechanisms of Androg and IPAD on Apoptosis Induction in Cervical Cancer Cells Assanan Dokmaikaew* Tipaya Ekalaksananan** Dr.Chamsai Pientong** ABSTRACT Androg and IPAD are recently known
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava.
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Chuang-Jun Li, Jie Ma, Hua Sun, Dan Zhang, and Dong-Ming Zhang* State Key Laboratory
BIK BIM NOXA PUMA MCL-1. p53
HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
mir-187 inhibits the growth of cervical cancer cells by targeting FGF9
ONCOLOGY REPORTS 38: 1977-1984, 2017 mir-187 inhibits the growth of cervical cancer cells by targeting FGF9 Hua Liang, Ruoyu Luo, Xiaoqi Chen, Yuzi Zhao and Aili Tan Department of Obstetrics and Gynecology,
MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway
INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Acaulins A and B, Trimeric Macrodiolides from Acaulium. Table of Contents
Supporting Information Acaulins A and B, Trimeric Macrodiolides from Acaulium sp. H-JQSF Ting Ting Wang, Ying Jie Wei, Hui Ming Ge, Rui Hua Jiao, Ren Xiang Tan* * Corresponding author. E-mail: rxtan@nju.edu.cn
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63
68 Chin J Cancer Res 22(1):68-72, 2010 www.springerlink.com Original Article Effect of Survivin-siRNA on Drug Sensitivity of Osteosarcoma Cell Line MG-63 Jing-Wei Wang 1, Yi Liu 2, Hai-mei Tian 2, Wei
Supporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel
KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel R. Wei and J.-P. Zang Department of Respiratory Medicine, People s Hospital of Zhengzhou, Zhengzhou, China
Supporting Information
Supporting Information A single design strategy for dual sensitive ph probe with a suitable range to map ph in living cells Kang-Kang Yu, Ji-Ting Hou, Kun Li, * Qian Yao, Jin Yang, Ming-Yu Wu, Yong-Mei
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Chemical constituents from Agrimonia pilosa Ledeb. and their chemotaxonomic significance Wei-jie Liu, Xue-qian Hou, Hao Chen, Jing-yu Liang*, Jian-bo Sun** Department of Natural
The effect of elemene reversing the multidurg resistance of A549/DDP lung cancer cells
213 12 33 12 TUMOR Vol. 33, December 213 www.tumorsci.org 161 Basic Research DOI: 1.3781/j.issn.1-7431.213.12. 5 Copyright 213 by TUMOR A549/DDP 1, 2 2 1 3 4 1 1 1. 3619 2. 355 3. 3611 4. 361 elemene cisplatin
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
Supplementary Figure 1. HGL-DTG levels in uninduced and herbivory induced leaves. Total HGL-
Supplementary Figure 1. HGL-DTG levels in uninduced and herbivory induced leaves. Total HGL- DTG concentrations [F 1,4 = 36.88, P 0.0037; significant differences (threshold: P 0.05) between means (± SE)
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429 Qinglong Guo 1a, Lu Lu 1a, Yan Liao a, Xiaoping Wang a, Yi Zhang a, Yicheng Liu a, Shaoliang
Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
Guolin Hu 1,2 Jialu Zhang 1 Feifei Xu 1 Huan Deng 1 Weiwei Zhang 1 Shijun Kang 1 Weijiang Liang 1 1 INTRODUCTION ORIGINAL ARTICLE
Received: 12 December 2017 Revised: 27 February 2018 Accepted: 3 March 2018 DOI: 10.1111/cas.13563 ORIGINAL ARTICLE Stomatin-like protein 2 inhibits cisplatin-induced apoptosis through MEK/ERK signaling
ABSTRACT INTRODUCTION
/, 2017, Vol. 8, (No.50), pp: 87860-87877 Extracellular ATP, as an energy and phosphorylating molecule, induces different types of drug resistances in cancer cells through ATP internalization and intracellular
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo
Supporting Information A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo Yiming Li, a,b Hanbao Chong, a Xiangming Meng,* a Shuxin Wang, a Manzhou Zhu a and Qingxiang
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
ORIGINAL ARTICLE. Hang Huang 1,2, Lin-Jin Li 3, Hai-Bo Zhang 4, An-Yang Wei 4. Summary. Introduction
JBUON 2017; 22(1): 112-118 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Papaverine selectively inhibits human prostate cancer cell (PC-3) growth
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
Figures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina
Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina Jun Luo, Jun-Song Wang, Jian-Guang Luo, Xiao-Bing Wang, and Ling-Yi Kong* Department of
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
Supplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
THE JOURNAL OF ANTIBIOTICS. Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1. II. Structure Determination
THE JOURNAL OF ANTIBIOTICS Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1 II. Structure Determination ISAO MOMOSE, WEI CHEN, HIKARU NAKAMURA, HIROSHI NAGANAWA, HIRONOBU IINUMA and TOMIO
MiR-100 up-regulation enhanced cell autophagy. and apoptosis induced by cisplatin in osteosarcoma by targeting mtor
European Review for Medical and Pharmacological Sciences 2018; 22: 5867-5873 MiR-100 up-regulation enhanced cell autophagy and apoptosis induced by cisplatin in osteosarcoma by targeting mtor Z. YU, N.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
Supplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Silencing Dicer expression enhances cellular proliferative and invasive capacities in human tongue squamous cell carcinoma
ONCOLOGY REPORTS 31: 867-873, 2014 Silencing Dicer expression enhances cellular proliferative and invasive capacities in human tongue squamous cell carcinoma SHUGUANG ZENG 1*, JING YANG 1*, JIANJIANG ZHAO
Your Name: Question 1. Spectrum Prediction I: Ethyl Acetoacetate. (15 points) ppm ppm ppm ppm. J(A,D) = 8 Hz = 0.
Question 1. Spectrum Prediction I: Ethyl Acetoacetate. (15 points) A B C D 4.202 ppm 3.451 ppm 2.273 ppm 1.288 ppm J(A,D) = 8 Hz = 0.08 ppm (in CDCl 3 ) Draw the 100 MHz H-NMR spectrum to scale. Draw splitting
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
MOLECULAR MEDICINE REPORTS 14: , 2016
MOLECULAR MEDICINE REPORTS 14: 2685-2690, 2016 Resveratrol inhibits phosphorylation within the signal transduction and activator of transcription 3 signaling pathway by activating sirtuin 1 in SW1353 chondrosarcoma
microrna 181 promotes prostate cancer cell proliferation by regulating DAX 1 expression
1296 microrna 181 promotes prostate cancer cell proliferation by regulating DAX 1 expression SHI JUN TONG *, JUN LIU *, XIANG WANG and LIAN XI QU Department of Urologic Surgery, Huashan Hospital Affiliated
Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
Electronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Chemical inhibitors and stable knock-down of efflux
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor
Supporting Information For Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor Zhaochao Xu,*,, Kyung-Hwa Baek, Ha Na Kim, Jingnan
Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66
SUPPORTING INFORMATION belonging to the manuscript: Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66 by Changsheng Wu 1, 2, Gilles P. van Wezel 1, *, and Young Hae
Protein extraction and western blot analysis Protein extraction was performed as
ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,
Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12
SUPPLEMENTARY METHODS Cell cultures Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12 Ham with 25 mm HEPES and NaHCO 3 (1:1) and supplemented with 10% (v/v) FBS, 1.0
B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3
Berberine inhibits Wilms' tumor cell progression through upregulation of Wilms' tumor gene on the X chromosome
MOLECULAR MEDICINE REPORTS 8: 1537-1541, 2013 Berberine inhibits Wilms' tumor cell progression through upregulation of Wilms' tumor gene on the X chromosome YAN LIU 1 and SHENG LIU 2 1 Department of Pediatrics,
Supporting information
Supporting information Rhabdopeptide/Xenortide-like Peptides from Xenorhabdus innexi with Terminal Amines Showing Potent Anti-protozoal Activity Lei Zhao,, Marcel Kaiser,, Helge B. Bode *,, Molekulare
Characterizing fatty acids with advanced multinuclear NMR methods
Characterizing fatty acids with advanced multinuclear NMR methods Fatty acids consist of long carbon chains ending with a carboxylic acid on one side and a methyl group on the other. Most naturally occurring
Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted. residues are colored red. Numbers indicate the position of each residue.
Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted residues are colored red. Numbers indicate the position of each residue. Supplementary Figure 2. SDS-PAGE analysis of purified recombinant
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Mechanism of EGCG promoting apoptosis of MCF-7 cell line in human breast cancer
ONCOLOGY LETTERS 14: 3623-3627, 2017 Mechanism of EGCG promoting apoptosis of MCF-7 cell line in human breast cancer CHAO-YOU HUANG 1, ZHENG HAN 1, XI LI 2, HUI-HUA XIE 1 and SHAN-SHAN ZHU 1 1 Department
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/264/rs4/dc1 Supplementary Materials for A Systems Approach for Decoding Mitochondrial Retrograde Signaling Pathways Sehyun Chae, Byung Yong Ahn, Kyunghee Byun,
IJC International Journal of Cancer
IJC International Journal of Cancer Enhancement of chemotherapeutic agent-induced apoptosis by inhibition of NF-jB using ursolic acid Yunlong Li 1, Da Xing 1, Qun Chen 1 and Wei R. Chen 1,2 1 MOE Key Laboratory
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides
Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides Saúl Martínez-Montero, a,b Susana Fernández, a Yogesh S. Sanghvi, c Emmanuel A. Theodorakis,*
RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells
Med Oncol (2012) 29:311 317 DOI 10.1007/s12032-010-9808-5 ORIGINAL PAPER RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells Yang Lin Shuai
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to