mirna-guided regulation at the molecular level
|
|
|
- Arnold Bailey
- 5 years ago
- Views:
Transcription
1 molecular level Hervé Seitz IGH du CNRS, Montpellier, France March 3, 2016
2 microrna target prediction
3 . microrna target prediction mirna: target: N NNNNNNNNNNNNNN 3 NNNNNN the seed
4 microrna target prediction Computational programs for target prediction: look for seed matches in 3 UTRs, select the ones that were conserved in evolution.
5 microrna target prediction Computational programs for target prediction: look for seed matches in 3 UTRs, select the ones that were conserved in evolution. Such short matches are very frequent (60 % of human coding genes seem to be targeted: Friedman et al., 2009).
6 microrna target prediction Computational programs for target prediction: look for seed matches in 3 UTRs, select the ones that were conserved in evolution. Such short matches are very frequent (60 % of human coding genes seem to be targeted: Friedman et al., 2009). = mirnas are implicated in every physiological process in animals.
7 microrna target prediction Computational programs for target prediction: look for seed matches in 3 UTRs, select the ones that were conserved in evolution. Such short matches are very frequent (60 % of human coding genes seem to be targeted: Friedman et al., 2009). = mirnas are implicated in every physiological process in animals. mirna-mediated repression is very modest (usually < 2-fold): lower than well tolerated fluctuations in gene expression (e.g., haplosufficiency). Why have these sites been conserved if they are not functional?
8
9
10 Baek et al., 2008: quantification of mir-223-mediated repression in mouse neutrophils.
11 Blood collection Neutrophil isolation RNA extraction cdna labeling, array hybridization
12 Blood collection Neutrophil isolation RNA extraction cdna labeling, array hybridization Blood collection Pooled blood Split in 5 replicates Neutrophil isolation RNA extraction cdna labeling, array hybridization
13 Experimental details
14
15 For 150 out of 192: inter-individual fluctuations across 5 wild-type mice exceeds mirna-mediated regulation (p-value < 0.05).
16
17
18 USP9X mrna Mus musculus Homo sapiens Sus scrofa Bos taurus mir-134 site Sarcophilus harrisii Monodelphis domestica Gallus gallus Taeniopygia guttata Danio rerio
19 USP9X mrna Mus musculus Homo sapiens Sus scrofa Bos taurus Sarcophilus harrisii mir-134 site 5 3 GACAUAACCAGCAAUGAAGA-UUUU-AGUCUCA GGCAUGACACUG-AUUCAGG-AUUUCAGUCACA GGCAUGAC----AAUUCAGG-CGUUCAGUCACA GACAUGACCCUGAAUUCAGG-AGUUCAGUCACA AGCAUGACACUGAAUUCAGGAAUUUCAGUCACA Monodelphis domestica AGCAUGACACUGAAUUCAGGAAUUUCAGUCACA Gallus gallus GGCACUAUGCUGAGUUCUGGAACAACAGUCACA Taeniopygia guttata GGCACUAUGCUGAAUUCUGGAACAACAGUCACA Danio rerio GAUGUGACGCUGAAUUCUGAAGCCACAGUCACA : mir-134: 3 GGGGAGACCAGUUGGUCAGUGU 5 : conserved in 8 or 9 species out of 9 : conserved in 6 or 7 species out of 9 : conserved in less than 6 species out of 9
20 USP9X mrna mir-134 site mir-134 Mus musculus Homo sapiens Sus scrofa Bos taurus 5 3 GACAUAACCAGCAAUGAAGA-UUUU-AGUCUCA GGCAUGACACUG-AUUCAGG-AUUUCAGUCACA GGCAUGAC----AAUUCAGG-CGUUCAGUCACA GACAUGACCCUGAAUUCAGG-AGUUCAGUCACA Sarcophilus harrisii AGCAUGACACUGAAUUCAGGAAUUUCAGUCACA Monodelphis domestica AGCAUGACACUGAAUUCAGGAAUUUCAGUCACA Gallus gallus GGCACUAUGCUGAGUUCUGGAACAACAGUCACA Taeniopygia guttata GGCACUAUGCUGAAUUCUGGAACAACAGUCACA Danio rerio GAUGUGACGCUGAAUUCUGAAGCCACAGUCACA : mir-134: 3 GGGGAGACCAGUUGGUCAGUGU 5 : conserved in 8 or 9 species out of 9 : conserved in 6 or 7 species out of 9 : conserved in less than 6 species out of 9
21 Hominidae Catarrhini Boreoeutheria Euteleostomi
22 3 UTR seed matches: Proportion of over-conserved seed matches (n=10 mirna families) (n=14 mirna families) (n=14 mirna families) Hominidae Catarrhini Boreoeutheria (n=10 mirna families) Euteleostomi Hominidae Catarrhini Boreoeutheria Euteleostomi Clade-specific mirna families Comparison to prediction programs Effect of tree architecture
23 : revisiting mirna target definition
24 : revisiting mirna target definition Every measurable change in gene expression does not translate into a, evolutionarily selectable phenotype.
25 : revisiting mirna target definition Every measurable change in gene expression does not translate into a, evolutionarily selectable phenotype. A central feature of biological systems: their robustness to external insults. Hard to reconcile with the extreme sensitivity required for fine-tuning (the butterfly effect has probably been counter-selected).
26 Acknowledgements Anna Sergeeva: Laura Martinez: Blaise Li: Natalia Pinzo n: Isabelle Busseau: Delphine Maze :
27 Acknowledgements Anna Sergeeva: Laura Martinez: Blaise Li: Natalia Pinzo n: Isabelle Busseau: Delphine Maze : Jessy Presumey and Florence Apparailly (INM, Montpellier)
28 Acknowledgements Anna Sergeeva: Laura Martinez: Blaise Li: Natalia Pinzo n: Isabelle Busseau: Delphine Maze : Jessy Presumey and Florence Apparailly (INM, Montpellier)
29 : Mechanism of target repression Results: biological pathways mir-223 experiment: experimental details Over-conserved sites in prediction programs Published evidence for genome-wide targeting Issues with published pseudo-targets Absolute RNA quantification results RNA-Seq statistics : Pseudo-targets for other regulators? Propagation of gene expression perturbation
30 mirna target repression (adapted from Huntzinger and Izaurralde, 2011)
31 Biological robustness enzyme 1 enzyme 2 enzyme 3 Substrate Product 1 Product 2 Product 3
32 Experimental details Return
33 Experimental details Return
34 Experimental details Return
35 Experimental details p: probability that the difference between two individual mice is smaller than repression Return
36 Over-conservation in prediction programs Proportion of over-conserved seed matches Proportion of over-conserved seed matches Predictions by microt 5.0: Hominidae Catarrhini Boreoeutheria Euteleostomi Clade-specific mirna families Predictions by miranda (aug2010): Hominidae Catarrhini Boreoeutheria Euteleostomi Clade-specific mirna families Proportion of over-conserved seed matches Proportion of over-conserved seed matches Predictions by PicTar2: Hominidae Catarrhini Boreoeutheria Euteleostomi Clade-specific mirna families Predictions by TargetScan 7.0: Hominidae Catarrhini Boreoeutheria Euteleostomi Clade-specific mirna families Return
37 Effect of tree architecture Proportion of seed matches conserved outside clade of interest UTR seed matches: Non-seed hexamers Hominidae-specific seeds Catarrhini-specific seeds Boreoeutheria-specific seeds Euteleostomi-specific seeds 0.0 Hominidae Catarrhini Boreoeutheria Euteleostomi Clade of interest Return
38 Published evidence
39 Published evidence Targets for a given mirna often belong to the same biological pathways. mrna for gene 1 mirna mrna for gene 2 mrna for gene 3 mrna for gene 4
40 Published evidence Targets for a given mirna often belong to the same biological pathways. mrna for gene 1 mrna for gene 2 mrna for gene 3 mirna mrna for gene 4
41 Published evidence Expression domains for mirnas and their overlap at their boundaries. mirna mirna and mrna expression mrna sharp boundary of mrna activity domain spatial or temporal axis
42 Published evidence Expression domains for mirnas and their overlap at their boundaries. mrna mirna and mrna expression mirna sharp boundary of mirna activity domain spatial or temporal axis
43 Published evidence House-keeping genes are rarely predicted to be targeted. mirna avoidance mrna for tissue specific gene cell type 1 mrna for house keeping gene mirna mrna for tissue specific gene avoidance cell type 2 mrna for house keeping gene
44 Published evidence House-keeping genes are rarely predicted to be targeted. mirna avoidance mrna for tissue specific gene cell type 1 mrna for house keeping gene mirna mrna for tissue specific gene avoidance cell type 2 mrna for house keeping gene
45 Reported examples of pseudo-targets A proposed pseudo-target: PTENP1, that de-repressed PTEN (Poliseno et al., 2010).
46 Reported examples of pseudo-targets A proposed pseudo-target: PTENP1, that de-repressed PTEN (Poliseno et al., 2010). But PTENP1 mrna is 100 times less abundant than the PTEN mrna (Ebert and Sharp, 2010).
47 Reported examples of pseudo-targets PTEN mrna (NM_008960) nt: CDS sirnas against PTENP
48 Reported examples of pseudo-targets Proposed by Poliseno et al (2010): sirnas More probably: sirnas PTENP1 mrna PTEN mrna mirnas PTEN mrna
49 Reported examples of pseudo-targets sirna #2 against PTENP1: PTEN mrna (nt ): 5 3 UAAUAAUCAUCAUUCUGGC GUUAUUA----UAA-ACCU 3 5 sirna #2 against PTENP1: PTEN mrna (nt ): 5 3 UAAUAAUC-AUCAUUCUGGC : :: UUUAUUACUUGGAAAAAUUA 3 5 sirna #2 against PTENP1: PTEN mrna (nt ): 5 3 UAAUAAUCAUCAUUCUGGC : AUUAUUAUAUGUAUCGCGG 3 5 sirna #3 against PTENP1: PTEN mrna (nt ): 5 3 UCCUAUA--UGAUCUCUGAUG :: AGGAUAUUGACGUUAGACUGU 3 5 sirna #2 against PTENP1: PTEN mrna (nt ): 5 3 UAAUAAUCAUCAUUCUGGC AUUAUUACC-----GACCU 3 5
50 Reported examples of pseudo-targets sirnas against AFF1 sirnas against RBM9 PTEN mrna CDS (NM_008960) nt: sirnas against CNOT6L PTEN mrna CDS (NM_008960) nt: sirnas against DCBLD2 PTEN mrna CDS (NM_008960) nt: sirnas against JARID2 PTEN mrna CDS (NM_008960) nt: sirnas against TNRC6a PTEN mrna CDS (NM_008960) nt: sirnas against TNRC6b PTEN mrna CDS (NM_008960) nt: sirnas against ZEB2 PTEN mrna (NM_008960) CDS PTEN mrna (NM_008960) CDS nt: nt: sirnas against MBNL1 PTEN mrna (NM_008960) CDS nt:
51 mirna quantification fmol synthetic oligo M days of differentiation nt: (quantification of mir-1 and mir-206)
52 mirna quantification mirna abundance during C2C12 differentiation mirna molecules per cell mir 1 + mir 206 mir Day of differentiation
53 mrna quantification
54 mrna quantification Very deep sequencing: three time points (day 0, day 3, day 6) in triplicate; each replicate: between 267 and 333 million transcriptome-matching reads. Statistics
55 mrna quantification Very deep sequencing: three time points (day 0, day 3, day 6) in triplicate; each replicate: between 267 and 333 million transcriptome-matching reads. Statistics 27 synthetic spike-ins, for calibration.
56 mrna quantification Day 0, replicate 1 Read abundance (fpkm) Molecules per cell
57 mrna quantification Day 0, replicate 1 Read abundance (fpkm) mir-1/mir-206 sites mir-133 sites Molecules per cell
58 mrna quantification Molecules per cell mir-1 + mir Day
59 mrna quantification Molecules per cell mir-1 + mir fold excess of targets Day
60 mrna quantification Molecules per cell mir Day
61 mrna quantification Molecules per cell mir fold excess of targets Day
62 Deep-sequencing statistics Number of reads per kb (median transcript, excluding spike-ins): Replicate Day 0 Replicate Replicate Replicate Day 3 Replicate Replicate Replicate Day 6 Replicate Replicate Return
63 Pseudo-targets for other regulators? Transcription factors: experimentally identified binding sites are poorly conserved among vertebrates (Odom et al., 2007 and Schmidt et al., 2010).
64 Pseudo-targets for other regulators? Transcription factors: experimentally identified binding sites are poorly conserved among vertebrates (Odom et al., 2007 and Schmidt et al., 2010). RNA-binding proteins are poorly specific (thousands of experimentally validated targets for each analyzed protein: Hafner et al., 2010; Lebedeva et al., 2011 and Hafner et al., 2013).
65 Pseudo-targets for other regulators? Transcription factors: experimentally identified binding sites are poorly conserved among vertebrates (Odom et al., 2007 and Schmidt et al., 2010). RNA-binding proteins are poorly specific (thousands of experimentally validated targets for each analyzed protein: Hafner et al., 2010; Lebedeva et al., 2011 and Hafner et al., 2013). Real molecular events, which are neutral in evolutionary terms? Return
66 Propagation of gene expression perturbation + Gene Z1 mirna Gene Y1 Gene Z2 Gene Z3 Gene X Gene Y2 Gene Z4 Gene Z5 Gene Z6 Gene Z7 Gene Y3 Gene Z8 Gene Z9 Direct mirna target Indirect mirna targets
67 Propagation of gene expression perturbation log 2 (fold-change) (blue boxplot) Zfy overexpression Sept12 Tsarg2 Pebp4 Miwi Number of affected genes (red line) 0 0 Direct targets 13.5 dpp Indirect targets at 13.5 dpp Indirect targets at 15.5 dpp (in collaboration with H. Royo and J. Turner, MRC, London)
Bi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3073 LATS2 Binding ability to SIAH2 Degradation by SIAH2 1-160 161-402 403-480 -/ 481-666 1-666 - - 667-1088 -/ 1-0 Supplementary Figure 1 Schematic drawing of LATS2 deletion mutants and
Small RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
Supplementary Figure 1. CFTR protein structure and domain architecture.
A Plasma Membrane NH ₂ COOH Supplementary Figure. CFT protein structure and domain architecture. (A) Open state CFT homology model, ribbon representation from Serohijos et al. 8 PNAS 5:356. CFT domains
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes. Includes comparison of:
Benchmark study: Exiqon mircury LNA microrna arrays vs. Supplier A s DNA based capture probes Includes comparison of: I. II. III. Signal levels Relative quantification False differences For complete experimental
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
SUPPLEMENTARY MATERIAL
SYPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY MATERIAL Figure S1. Phylogenic studies of the mir-183/96/182 cluster and 3 -UTR of Casp2. (A) Genomic arrangement of the mir-183/96/182 cluster in vertebrates.
he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
SC-L-H shared(37) Specific (1)
A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific
MicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Prediction of micrornas and their targets
Prediction of micrornas and their targets Introduction Brief history mirna Biogenesis Computational Methods Mature and precursor mirna prediction mirna target gene prediction Summary micrornas? RNA can
DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary figure legends
Supplementary figure legends SUPPLEMENTRY FIGURE S1. Lentiviral construct. Schematic representation of the PCR fragment encompassing the genomic locus of mir-33a that was introduced in the lentiviral construct.
Package TargetScoreData
Title TargetScoreData Version 1.14.0 Author Yue Li Package TargetScoreData Maintainer Yue Li April 12, 2018 Precompiled and processed mirna-overexpression fold-changes from 84 Gene
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Small RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez
NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
A genome-scale screen reveals context-dependent ovarian cancer sensitivity to mirna overexpression
A genome-scale screen reveals context-dependent ovarian cancer sensitivity to mirna overexpression Benjamin B. Shields, Chad V. Pecot, Hua Gao, Elizabeth McMillan, Malia Potts, Christa Nagel, Scott Purinton,
Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering
Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene
MicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Bioinformation Volume 5
Mi-DISCOVERER: A bioinformatics tool for the detection of mi-rna in human genome Saadia Arshad, Asia Mumtaz, Freed Ahmad, Sadia Liaquat, Shahid Nadeem, Shahid Mehboob, Muhammad Afzal * Department of Bioinformatics,
CRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012
CRS4 Seminar series Inferring the functional role of micrornas from gene expression data CRS4 Biomedicine Bioinformatics Paolo Uva July 11, 2012 Partners Pharmaceutical company Fondazione San Raffaele,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/406/ra126/dc1 Supplementary Materials for The microrna mir-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral
Micro RNA Research. Ken Kosik. Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr.
Ken Kosik Harriman Professor, Department of Molecular, Cellular & Developmental Biology and Biomolecular Sciences & Engr. Program Co-Director, Neurosciences Research Institute Micro RNA Research Neuroscience
Inferring condition-specific mirna activity from matched mirna and mrna expression data
Inferring condition-specific mirna activity from matched mirna and mrna expression data Junpeng Zhang 1, Thuc Duy Le 2, Lin Liu 2, Bing Liu 3, Jianfeng He 4, Gregory J Goodall 5 and Jiuyong Li 2,* 1 Faculty
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
10/31/2017. micrornas and cancer. From the one gene-one enzyme hypothesis to. microrna DNA RNA. Transcription factors.
micrornas and cancer Cellular and Molecular Biology of Cancer (PATH G4500-001) November 1 st, 2017 -Katia Basso- Columbia University Katia Basso, PhD Office: ICRC RM506 E-mail: kb451@cumc.columbia.edu
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models. Yu Wu
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models Yu Wu Alzheimer s Disease (AD) Mouse models: APP/PS1, PS1δE9, APPswe, hps1 Wirths, O. et al, Acta neuropathologica
sirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12005 a S Ψ ΨΨ ΨΨ ΨΨ Ψ Ψ Ψ Ψ Ψ ΨΨ Ψ Ψ ΨΨΨΨΨΨ S1 (a.a. 1 751) S2 (a.a. 752 1353) S1 Fc S1 (a.a. 1-747) Fc b HCoV-EMC-S1-Fc SARS-CoV-S1-Fc HCoV-EMC-S1-Fc SARS-CoV-S1-Fc kda - 170 - - 130
MicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer
Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Cross species analysis of genomics data. Computational Prediction of mirnas and their targets
02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods
Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global regulator during meiosis
RNA BIOLOGY 2017, VOL. 14, NO. 2, 219 235 http://dx.doi.org/10.1080/15476286.2016.1270002 RESEARCH PAPER Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
Set the stage: Genomics technology. Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands
Set the stage: Genomics technology Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands Amendment to the latest consolidated version of the REACH legislation REACH Regulation 1907/2006:
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)
High-Throughput Sequencing Course
High-Throughput Sequencing Course Introduction Biostatistics and Bioinformatics Summer 2017 From Raw Unaligned Reads To Aligned Reads To Counts Differential Expression Differential Expression 3 2 1 0 1
Uninformative BRCA Tests. Rebecca Sutphen, M.D. Professor, USF College of Medicine Chief Medical Officer, InformedDNA
Uninformative RCA Tests Rebecca Sutphen, M.D. Professor, USF College of Medicine Chief Medical Officer, InformedDNA Uninformative RCA tests 1. R/OV cancer patient with normal results 2. Cancer-free person
Table S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
The Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
The value of Omics to chemical risk assessment
The value of Omics to chemical risk assessment Timothy W Gant There is a focus on transcriptomics in this talk but for example only. All omics are useful in risk assessment Outline What are we aiming to
The corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics:
Correction H3K4me3 readth Is Linked to Cell Identity and Transcriptional Consistency érénice A. enayoun, Elizabeth A. Pollina, Duygu Ucar, Salah Mahmoudi, Kalpana Karra, Edith D. Wong, Keerthana Devarajan,
TITLE: The Role Of Alternative Splicing In Breast Cancer Progression
AD Award Number: W81XWH-06-1-0598 TITLE: The Role Of Alternative Splicing In Breast Cancer Progression PRINCIPAL INVESTIGATOR: Klemens J. Hertel, Ph.D. CONTRACTING ORGANIZATION: University of California,
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
Metabolic programming. Role of micrornas. M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City
Metabolic programming. Role of micrornas M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City Outline Overview on micrornas (mirnas) Role of mirnas in metabolic programming
From reference genes to global mean normalization
From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization
SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
Research Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA - UPDATE
DEVELOPMENT OF AN INTERNATIONAL REFERENCE PREPARATION FOR HEPATITIS D VIRUS RNA - UPDATE SoGAT Clinical Diagnostics III 12-13 January 2011, London Michael Chudy Julia Kreß Micha Nübling Paul-Ehrlich-Institut
Synthetic microrna Reference Standards Genomics Research Group ABRF 2015
Synthetic microrna Reference Standards Genomics Research Group ABRF 2015 Don A. Baldwin, Ph.D. support@signalbiology.com Reference samples for Platform evaluation Protocol development Assay service improvement
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1
Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start
Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
Supplementary Data to: Marco Mariotti and Roderic Guigó
Supplementary Data to: Selenoprofiles: profile-based scanning of eukaryotic genome sequences for selenoprotein genes Marco Mariotti and Roderic Guigó Section S1: patterns used with SECISearch We report
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration
Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
Morphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER
Technology Transfer in Diagnostic Pathology. 6th Central European Regional Meeting. Cytopathology. Balatonfüred, Hungary, April 7-9, 2011. RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Philippe
Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
MicroRNAs control mrna fate by compartmentalization based on 3 UTR length in male germ cells
Zhang et al. Genome Biology (2017) 18:105 DOI 10.1186/s13059-017-1243-x RESEARCH MicroRNAs control mrna fate by compartmentalization based on 3 UTR length in male germ cells Ying Zhang 1, Chong Tang 1,
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
Gene-microRNA network module analysis for ovarian cancer
Gene-microRNA network module analysis for ovarian cancer Shuqin Zhang School of Mathematical Sciences Fudan University Oct. 4, 2016 Outline Introduction Materials and Methods Results Conclusions Introduction
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supporting Information
Supporting Information McCullough et al. 10.1073/pnas.0801567105 A α10 α8 α9 N α7 α6 α5 C β2 β1 α4 α3 α2 α1 C B N C Fig. S1. ALIX Bro1 in complex with the C-terminal CHMP4A helix. (A) Ribbon diagram showing
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
Transcriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
On the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles
On the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles Ying-Wooi Wan 1,2,4, Claire M. Mach 2,3, Genevera I. Allen 1,7,8, Matthew L. Anderson 2,4,5 *, Zhandong Liu 1,5,6,7 * 1 Departments of Pediatrics
Kirschner, 2005). Briefly, parallel MEF cultures were isolated from single littermate
SUPPLEMENTAL MATERIALS AND METHODS Generation of MEFs, osteoblasts and cell culture Prkar1a -/- and control MEFs were generated and cultured as described (Nadella and Kirschner, 2005). Briefly, parallel