0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type
|
|
|
- Jeffry Stewart
- 5 years ago
- Views:
Transcription
1 Fig S1 A B Tumors per mouse All T-lymph B-lymph Sarcomas Carcinomas Germ cell Tumor type -/- (n = 46) Q/- (n = 76) Q/Q (n = 31) Tumors per mouse /- (n = 46) S/- (n = 32) S/S (n = 20) All T-lymph B-lymph Sarcomas Carcinomas Germ cell Fig. S1. R248Q and G245S alleles display a modest broadening of tumor spectrum compared to p53 null allele. Tumors per mouse of the indicated tumor subtypes. The y-axis indicates the total number of tumors within a category (e.g. T-lymph) divided by the total number of mice within the indicated genotype. A, null, R248Q/- and R248Q/R248Q mice. B, null, G245S/- and G245S/G245S mice.
2 Fig S2 -/- A Hemangiosarcoma Fibrosarcoma Liposarcoma Q/- B Fibrosarcoma Undiff. sarcoma Germ cell tumor Multi-lineage mesenchymal tumor Undiff. carcinoma Broncho. carcinoma C Metastatic tumors -/- Q/- Fig. S2. Expression of R248Q results in a broader histological spectrum of tumor types. Similar results were seen in G245S mice. A. p53-null mice developed hemangiosarcoma, fibrosarcoma and rarely liposarcoma. B. Examples of p53r248q/- mice developing fibrosarcoma, undifferentiated sarcoma, abdominal germ cell tumor, multi-lineage mesenchymal tumor with areas of osteoid and pericyte differentiation, undifferentiated carcinoma with areas of glandular differentiation, and bronchoalveolar carcinoma of the lung. C. Left one p53 null mouse developed a large diffuse hemangiosarcoma of the heart that had seeded multiple tumor emboli to the lung. Right one R248Q/- mouse developed a large fibrosarcoma in the abdomen that generated multiple distant metastases into the lungs and numerous subcutaneous nodules on the back.
3 Table S1 Table S1. Histological types of all solid tumors that arose in the indicated genotypes. -/- Q/- Q/Q S/- S/S Hemangiosarcoma (3/6) Fibrosarcoma (3/12) Fibrosarcoma (3/4) Fibrosarcoma (2/6) Fibrosarcoma (3/6) Fibrosarcoma (2/6) Hemangiosarcoma (2/12) Undiff.carcinoma (1/4) Hemangiosarcoma (1/6) Undiff. Sarcoma (1/6) Liposarcoma (1/6) Undiff. Sarcoma (2/12) Germ cell tumor (2/6) Hemangiosarcoma (1/6) Germ Cell tumor (1/12) Mutlilineage mesenchym. tumor (1/12) Undiff. Carcinoma (1/6) Eccrine carcinoma (1/6) Lung carcinoma (1/12) Undiff. Carcinoma (1/12) In parenthesis are the number of tumors per total number of solid tumors of the indicated genotypes.
4 Fig S3 A Normal thymus -/- Thymic lymphomas -/- Q/- B Normal spleen CD4 B-lymphomas in spleens -/- Q/- CD19 CD8 -/- B220 Fig. S3. p53 -/- and R248Q/- T and B-cell lymphomas display similar surface phenotypes A. Left, Normal thymus and Right T-lymphomas from p53 -/- and R248Q/- mice, B. Left, Normal spleen and Right B-lymphomas from p53 -/- and R248Q/- mice, with leukemic populations circled. FACS analysis.
5 Fig S4 Chrom X Y null R248Q -/- Q/- Q/Q (Y;1)- (11/20) Deletion(del16) (11/20) Chromosomal structural abnormalities del(3)-(25/30) der(3)t(3;19)-(13/30) (9:12)- (14/20) t(2;x)- (18/20) t(14;x)- (20/20) t(4;16)-(17/20) Fig. S4. Both R248Q and p53 null T-lymphomas display extensive aneuploidy and contain clonal translocations. Top Chromosome ID displaying numerical aneuploidy in >50% of metaphases analyzed from two p53 null cell lines (blue) and three R248Q cell lines (red). Chromosomes in green are aneuploid in at least four of the five cell lines analyzed. Bottom Specific clonal translocations found within the cell lines analyzed. In parenthesis is the number of metaphases displaying the translocation over total number of metaphases analyzed for that cell line.
6 Fig S5 Q/Q Cell line #174A Fig. S5. R248Q/Q T-lymphoma displays extensive aneuploidy and contains clonal translocations. Metaphases from a homozygous R248Q/R248Q cell line at early passage exhibits extensive aneuploidy and a 9:12 translocation (boxed). Upper left Giemsa staining, upper right and bottom SKY analysis.
7 Fig S6 -/- Q/- p-akt Akt p-s6 S6 p53 MAPK Fig. S6. In culture T-lymphoma cell lines derived from -/- and Q/- mice display similar signaling through the Akt pathway. Protein lysates from T-lymphoma cell lines in tissue culture from -/- and Q/- mice were blotted for p-akt, total Akt, p-s6, total S-6, and MAPK.
8 Fig S7 Q/- Normal tissues Q/- Tumors thymus T-lymphoma spleen B-lymphoma liver Sarcoma colon Fig. S7. mutp53 R248Q protein becomes stabilized only in tumor tissues but not in normal tissues. Normal tissues left and different tumors right from R248Q/- mice were stained side by side for the presence of detectable p53 protein (brown) and counterstained by hematoxylin (blue).
9 Fig S8 A normal T-cells -/- cntrl -/- p53 Q/- cntrl Q/- p53 T-lymphoma line -/- cntrl -/- p53 Q/- cntrl Q/- p53 normal B-cells -/- cntrl -/- p53 Q/- dntrl Q/- p53 B Geometric MFI compared to null /+ Q/- 0 LSK IgM- IgM+ DN DP B-cells T-cells T- lymphoma Fig. S8. mutp53 R248Q protein becomes stabilized only in tumor tissues but not in normal tissues. A. Histograms of normal B-lymphocytes, T-lymphocytes and malignant T- lymphoma cells of the indicated genotypes with and without intracellular staining for p53. FACS analysis. B. Quantification of changes in geometric mean fluorescence intensity (MFI) measured in panel A for individual cell populations after correction for background staining in p53 -/- cells.
10 Fig S9 IP: Ig Flag p63 TAp TAp G245S + + R248Q + + TAp63 FlagTAp73 p53 Fig. S9. mutp53 R248Q and G245S do not differ in their binding to TAp63 and TAp73. HCT116 p53-/- cells were transfected with FlagTAp73 + G245S and R248Q or TAp63 + G245S and R248Q, respectively. Twenty-four hours post transfected cells were harvested and immunoprecipitated followed by immunoblotting as indicated.
11 Fig S10 A -/- Thymus R248Q/- B Bone marrow -/- R248Q/- CD8 CD25 DN3 DN4 DN2 DN1 CD4 DN3 DN4 DN2 DN1 B220 Side Scatter B cells R2 R4 Pre Pro B220 IgM R4 Pre B cells Pro R2 CD44 CD43 Fig. S10. Gating strategy for evaluating the differentiation of subpopulations of T and B lymphocytes. A. Top DP, CD8, CD4 and DN subpopulations from 4-5 week old thymi of p53 -/- and R248Q/- mice. Bottom DN1 (CD44+CD25-), DN2 (CD44+CD25+), DN3 (CD44-CD25+), and DN4 (CD44-CD25-) subpopulations from the DN (CD8-CD4-) subset of p53 -/- and R248Q/- mice. B. B-cell populations from bone marrow of 4-5 week old p53 -/- and R248Q/- mice, gating for top total B-cells (side scatter and B220+), middle mature (B220+IgM+) and immature (B220+IgM-) B-cells, and bottom pro (B220+IgM- CD43+) and pre (B220+IgM-CD43-) B-cells.
12 Fig S11 CD45 no antibody -/- + antibody Q/- + antibody Sca1 no antibody -/- + antibody Q/- + antibody CD11b no antibody -/- + antibody Q/- + antibody CD44 no antibody -/- + antibody Q/- + antibody CD29 no antibody -/- + antibody Q/- + antibody Fig. S11. Mesenchymal stem cells derived from p53-/- and R248Q/- mice express MSC markers and lack hematopoeitic markers. Adherent fibroblast colonies from the bone marrow of -/- and Q/- mice were probed for left expression of CD45 and CD11b (hematopoetic markers) and right expression of Sca1, CD44 and CD29 (MSC markers)..
13 Fig S12 p21 5 -CCTGGTGATGTCCGACCTG-3 5 -CGGGACCGAAGAGACAACG-3 PUMA 5 -AGCAGCACTTAGAGTCGCC-3 5 -CCTGGGTAAGGGGAGGAGT-3 HPRT 5'-GGGGGCTATAAGTTCTTTGC-3' 5'-TCCAACACTTCGAGAGGTCC-3' Fig. S12. Primers used in real-time qrt-pcr experiments for the indicated genes.
14 Fig S13 Thymocyte stain Cell populations p53 staining 1. CD4-PE DP APC- PE + FITC + CD8-FITC DN APC- PE + FITC - TER119-APC CD19-APC Mac1-APC 2. CD4-APC DN1 APC- PE+ FITC- CD8-APC DN2 APC- PE+ FITC+ TER119-APC DN3 APC- PE- FITC+ CD19-APC DN4 APC- PE- FITC- Mac-1-APC CD25-FITC CD44-PE Bone marrow stain Cell populations 1. CD19-PE LSK PE- APC + FITC + B220-PE Mac1-PE Gr1-PE ckit-apc Sca1-FITC 2. B220-PE Total B-cells PE+ CD19-PE Pro PE+ APC+ CD43-APC Pre PE+ APC- IgM-FITC Immature PE+ FITC+ Mature PE+ FITC- Thymocyte stain Cell populations 1. CD4-PE DP PE+ FITC+ CD8-FITC DN PE- FITCp53-AlexaR647 Bone marrow stain Cell populations 1. B220-PE LSK PE- PerCP+ FITC + Mac1-PE Gr1-PE CD3-PE TER119-PE ckit-percp-efluor710 Sca1-FITC p53-alexar B220-PE Total B-cells PE+ IgM-FITC Immature PE+ FITCp53-AlexaR647 Mature PE+ FITC+ Spleen stain Cell population 1. B220-PE Total B-cells PE+ CD19-PE Pro PE+ APC+ CD43-APC Pre PE+ APC- IgM-FITC Immature PE+ FITC+ Mature PE+ FITC- 2. IgM-FITC IgM + IgD + FITC + PE + IgD- PE Fig. S13. Antibodies used and gating strategies for indicated subpopulations in lymphocyte development experiments (Fig. 8 and Fig. S9).
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Development of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki
a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
FLOW CYTOMETRY PRINCIPLES AND PRACTICE. Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018
FLOW CYTOMETRY PRINCIPLES AND PRACTICE Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018 Aims and Objectives Principles of flow cytometry Preparation Steps involved
Supporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
Supplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Imtiyaz et al., Fig. S1
. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
Chronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site
POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization
Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
VUmc Basispresentatie
Clinical diagnostic cytometry Gerrit J Schuurhuis Dept of Hematology VU University Medical Center Amsterdam, Netherlands Use of immunophenotyping at diagnosis to trace residual disease after therapy 1.
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
T cell development October 28, Dan Stetson
T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Defensive mechanisms include :
Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU
Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM
CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CANCER RESEARCH CENTRE, UNIVERSITY AND UNIVERSITY HOSPITAL OF SALAMANCA (SPAIN)( Sao Paulo, 18th of April, 2009 IDENTIFICATION OF HPC (I) 1.- In vivo
Ras proteins are critical signal transduction regulators which
Functional Redundancy of Sos1 and Sos2 for Lymphopoiesis and Organismal Homeostasis and Survival Fernando C. Baltanás, a Martín Pérez-Andrés, b Alicia Ginel-Picardo, a David Diaz, c David Jimeno, a Pilar
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
MBL in Blood Donors: An Extended Immunophenotypic Analysis of CLL-like, CD5+ MBL.
1 th Canadian CLL Meeting Winnipeg, Manitoba Inn at the Forks September 18-19, 214 MBL in Blood Donors: An Extended Immunophenotypic Analysis of CLL-like, CD5+ MBL. Fatima Abbasi 1, Justin Meskas 2, Ryan
x Lymphocyte count /µl CD8+ count/µl 800 Calculated
% Lymphocyte in CBC A. 50 40 30 20 10 Lymphocyte count /µl B. x10 3 2.5 1.5 C. 50 D. 1000 % CD3+CD8+ Cells 40 30 20 Calculated CD8+ count/µl 800 600 400 200 10 0 #61 #63 #64 #65 #68 #71 #72 #75 Figure
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Supplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Kerdiles et al - Figure S1
Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a)
GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute
GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Monocyte subsets in health and disease. Marion Frankenberger
Monocyte subsets in health and disease Marion Frankenberger main cellular components: Leukocytes Erythrocytes Composition of whole blood Monocytes belong to the cellular components of peripheral blood
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Development of Natural Killer Cells from Lymphohematopoietic Progenitors of Murine Fetal Liver
Development of Natural Killer Cells from Lymphohematopoietic Progenitors of Murine Fetal Liver YUKHI AIBA, MAKIO OGAWA Ralph H. Johnson Department of Veterans Affairs Medical Center, Department of Medicine,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplemental Information. IRF-5 Promotes Cell Death in CD4 T Cells. during Chronic Infection
Cell Reports, Volume 24 Supplemental Information IRF-5 Promotes Cell Death in T Cells during Chronic Infection Aymeric Fabié, Linh Thuy Mai, Xavier Dagenais-Lussier, Akil Hammami, Julien van Grevenynghe,
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
Cancer model Liver metastasis I
Cancer model Liver metastasis I H. Suemizu, M. Monnai, Y. Ohnishi, M. Ito, N. Tamaoki, and M. Nakamura. 2007. Identification of a key molecular regulator of liver metastasis in human pancreatic carcinoma
Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Supporting Online Material for
www.sciencemag.org/cgi/content/full/313/5788/839/dc1 Supporting Online Material for Requirement for Coronin 1 in T Lymphocyte Trafficking and Cellular Homeostasis Niko Föger, Linda Rangell, Dimitry M.
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder