Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress

Size: px
Start display at page:

Download "Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress"

Transcription

1 3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Patients With Pulmonary Arterial Hypertension (PAH) M AW Traditional Hypothesis Stress Resident Pulmonary Artery Cell Activation However, rapidly accumulating experimental evidence suggests an important role of NON-RESIDENT cells in vascular remodeling (and specifically in perivascular / adventitial areas) 1. Robust accumulation of Inflammatory cells CD68 Modulation of Resident Cell Phenotype Proliferation, Migration, Matrix deposition 2. Accumulation of cells expressing Progenitor Markers Structural Vascular Remodeling CD133 CD34 ckit (CD117) 1

2 3/1/212 Complimentary Hypothesis Traditional Hypothesis Resident PA Cell Activation Stress Circulating / Resident Inflammatory & Progenitor Cell Recruitment / Activation Vascular Remodeling and Vascular Inflammation Are Common Characteristics of PH in Various Mammalian Species, Yet to a Different Degree Vascular Remodeling (α-sm-actin) Mouse (5wk Hypoxic) Rat (4wk Hypoxic) Calf (2wk Hypoxic) Human with PH Modulation of Cell Phenotype Direct & Indirect Contribution to Cell Proliferation, Differentiation, Fibrosis Pulmonary Vascular Remodeling Vascular Inflammation (CD45) Vascular Inflammation Vascular Remodeling Animal Models to Study Human PAH: Chronically Hypoxic Calves Perivascular Accumulation of Mononuclear Phagocytes is Closely Associated With Remodeling and Fibrosis in PH Human infant with PAH Calf with hypoxia-induced PAH Inflammation M M AW AW Fibrosis Control Hypoxic 2

3 3/1/212 Increased Numbers of Progenitor-like (ckit+) Cells are Observed in the PA Adventitia of Hypoxic Calves Normoxic Calf Hypoxic Calf Question: What is the cellular link between mononuclear phagocyte accumulation and fibrosis in PH? Davie et al. Am. J. Physiol., 24 Fibrocytes A subset of circulating leukocytes with a dual phenotype that co-express leukocytic and mesenchymal markers and: Are rapidly recruited to the site of tissue injury; Transition into fibroblasts / myofibroblasts; Produce extracellular matrix proteins; Secrete inflammatory, growth, pro-angiogenic factors Fibrocytes (CD45+ / Collagen+) Comprise Up to 4% of the Recruited Leukocytes in the Remodeled PA Wall Chonically hypoxic calf - PA (Bucala et al. 1994; 25; Abe et al. 21; Hartlapp et al. 21; Yang et al. 22; Schmidt et al. 23; Metz 23, etc.) 3

4 3/1/212 Accumulation of Alternatively Activated (M2) Macrophages (CD163+, CD26+) in the Adventitia and Media of Calves With Severe PH Expression of Markers on Monocytes, Macrophages, Fibrocytes, and Fibroblasts: M2 Macrophage and Fibrocyte Similarities CD26 CD163 Pilling et al. PLoS., 29 Potential Origins of the Mesenchymal and Endothelial Precursors in the Remodeled Vessels Bone Marrow / Circulation Resident Vascular Progenitors Two Distinct Experimental Approaches Demonstrate That Fibrocytes in the Hypoxic Vessel Wall Originate from Circulation / Bone Marrow. Approach 1: In vivo DiI-labeling of monocytes in circulation via DiI-liposomes DiI+ cells Approach 2: Using Freemartin calf (a natural bovine XY / XX chimera), identify Y-chromosome+ BM cells recruited to hypoxic PA wall. Normoxia M Lung parenchyma Adv. Hypoxia Frid et al. Am. J. Pathol., 26 M Lung parenchyma Adv 4

5 3/1/212 Fibrocyte-like Cells (termed R -cells Due to Their Rhomboidal morphology in culture) Can be Isolated From the PA Media of Hypoxic Calves SMC In Culture, Fibrocyte-like Cells Transition / Differentiate into Myofibroblasts (α-sm-actin+) CD11b CD11b αsma DAPI SMC R -cells Frid et al. Am. J. Physiol., 29 R -cells CD11b procoll-1 Similarity with in vivo observation by confocal microscopy: Fibrocyte-like (CD11b+/Coll+) R -cells Frid et al. Am. J. Pathol., 26 Fibrocyte-like R -Cells Express mrna for Progenitor- Associated Markers and Inflammatory Mediators CEACAM1 Fibrocyte-like R -Cells Produce Potent Pro-Mitogenic Activity for Resident Vascular Cells (SMCs & Fibs) CEACAM 1 or else? Frid et al. Am. J. Physiol., 29 Frid et al. Am. J. Physiol., 29 5

6 3/1/212 What are the Cellular Mechanisms Inducing Recruitment, Retention and Activation of Circulating Pro-Inflammatory Cells (including Fibrocytes and Mesenchymal Progenitor Cells) to the Pulmonary Artery Wall? Hypothesis: Fibroblasts Orchestrate the Initiation and Perpetuation of Inflammation in the Vessel Wall Cytokines & Hormones (Ang II, TNFα, TGFβ-1, IL-1, ET-1) Mechanical Forces (stretch, injury) TLR Integrins Activated Adventitial Fibroblast Hypoxia, Ischemia Leukocytes / Lymphocytes Vasa Vasorum Adhesion Molecules / Chemokines / Cytokines Medial SMC A Cytokines B Adventitial Fibroblasts from Hypertensive Calves Express a Pro-Inflammatory Phenotype Chemokines & Costimulatory Molecules C Adhesion Molecule(s) IL-1β CCL2/MCP CCR7 GM-CSF VCAM-1 IL CO-Fibs CXCL12/SDF CD4L CCR2 n.s TNFα n.s. CCL5/RANTES CO-Fibs CXCR4 CD4 Protein Expression Adventitial Fibroblasts from Hypertensive Calves () Induce Increased Migration, Adhesion and Pro-Inflammatory Activation of Monocytes 1. Monocyte Transwell Migration 2. Monocyte Adhesion to Fibroblasts Fold Change Relative Number of Migrated THP CO-Fib-CM PH-Fib-CM IL-1β % Bound THP-1 Cells % Bound Cells (relative to control) CO-Fibs 3. Monocyte Pro-Inflammatory Activation CCL2/MCP-1 Type I Collagen CO-Fib-CM -CM CO-Fib-CM PH-Fib-CM CO-Fib-CM PH-Fib-CM

7 3/1/212 Conditioned Media From (not CO-Fibs) Induce Bovine Bone-Marrow Derived Macrophages to Express CD163 and Mannose Receptor (markers of M2 activation) Relative Expression of CD163 (normalized to unstimulated) Relative Expression of MR (normalized to unstimulated) Epigenetic Gene Silencing May Hold Key to Fatal Lung Vascular Disease Science Daily (June 7, 21) A rare but fatal disease of blood vessels in the lung may be caused in part by aberrant silencing of genes rather than genetic mutation, new research reports. S.A. Archer. Unx CO-CM PH-CM. blank CO-CM PH-CM Potential Mechanisms? Hypothesis: Pro-Inflammatory Fibroblast Phenotype is due to Abnormal Activity of Histone Modifying Enzymes (i.e. HDACs) Adventitial Fibroblast 1. Alterations in HDAC Activity 3. Monocyte recruitment Vasa Vasorum Fibroblasts from Hypertensive Calves () Exhibit Increased HDAC Activity and Protein Expression a. b. Class I HDAC Catalytic Activity (fluorescence X 1 3 ) CO-Fibs + Apicidin 2. Chemokines / Cytokines c. HDAC1 HDAC2 HDAC Histone Histone deacetylases (HDACs) are are a class a of enzymes that modify DNA-binding histones and and chromatin chromatin structure, structure, thus thus playing playing an important role role in in regulation of gene expression, and and in in epigenetics

8 3/1/212 Adventitial Fibroblasts as Cellular Targets: Inhibition of HDACs in results in attenuation of pro-inflammatory phenotype Inhibition of Class I HDACs Attenuates Pro-Inflammatory Phenotype of 23 IL-6 2 CCL2/MCP-1 2 CXCL12/SDF-1 Apicidin = Class I HDACi SAHA = pan HDACi; 1 um Untreated +SAHA +Apicidin Untreated + SAHA + Apicidin Untreated +SAHA +Apicidin 25 GM-CSF 16 VCAM CCL5/RANTES Untreated +SAHA +Apicidin Untreated +SAHA +Apicidin Untreated +SAHA +Apicidin M. Li et al J. Immunol 211 Inhibition of Class I HDACs Attenuates Capability of to Induce Monocyte Migration and Pro-Inflammatory Activation Relative Number of Cells Migrated Monocyte Migration PH-Fib-CM + Apicidin Monocyte Pro-Inflammatory Activation CCL2/MCP-1 PH-Fib-CM + Apicidin 35 IL-1β PH-Fib-CM + Apicidin Class 1 HDAC Activity is Increased in Tissue Derived Fibrocytes (R-cells) Copy/1 copies of HPRT CO-SMC "R" Cells 8

9 3/1/212 HDAC Inhibitors Attenuate Fibrocyte Activation ckit CO-SMC "R"Cells # +VPA (5mM) +SAHA (1µM) PDGFb # 7.5. CO-SMC "R"Cells +VPA (5mM) # +SAHA (1µM) S1A4 CO-SMC "R"Cells # +VPA (5mM) # +SAHA (1µM) "R"Cells "R"Cells "R"Cells 2.5 MCP CO-SMC "R"Cells +VPA +SAHA (5mM) (1µM) 1. SDF CO-SMC "R"Cells +VPA +SAHA (5mM) (1µM) IL-6 CO-SMC "R"Cells +VPA +SAHA (5mM) (1µM) "R"Cells "R"Cells "R"Cells Class I HDAC Inhibition Suppresses Hypoxia- Induced Pulmonary Arterial Medial Thickening Class I HDAC Inhibition Suppresses Multiple Pathological Pathways in the RV 9

10 3/1/212 Conclusion: Better understanding of the mechanisms leading to inflammation / progenitor cell recruitment, retention and activation, including epigenetic alterations in control of protein expression, may lead to alternative therapeutic strategies in pulmonary hypertension Acknowledgments Developmental Lung Biology M. Frid M. Li A. Flockton D. Brown D. Burke M. Yeager K. Colvin E. Gerasimovskaya H. Nijmeh E. Grayck S. Riddle N. Davie CVP Research S. Majka S. Walchak Cardiology T. McKinsey Renal M. Weiser-Evans R. Nemenoff 1

Role of Inflammation in Pulmonary Hypertension

Role of Inflammation in Pulmonary Hypertension Role of Inflammation in Pulmonary Hypertension K. R. Stenmark University of Colorado Denver, USA Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Infants With Pulmonary Arterial

More information

Immunological Lung Diseases

Immunological Lung Diseases Emphysema and Fibrosis Universitätsklinik für Pneumologie Prof. Thomas Geiser Head Div. of Pulmonary Medicine and Laboratory of Lung Research, MU50 thomas.geiser@insel.ch The healthy lung: The pathway

More information

Pulmonary hypertension contributes to the morbidity and

Pulmonary hypertension contributes to the morbidity and Reviews Hypoxia-Induced Pulmonary Vascular Remodeling Cellular and Molecular Mechanisms Kurt R. Stenmark, Karen A. Fagan, Maria G. Frid Downloaded from http://circres.ahajournals.org/ by guest on July

More information

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues

Chapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

Pathology of Coronary Artery Disease

Pathology of Coronary Artery Disease Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

DECLARATION OF CONFLICT OF INTEREST. No disclosures

DECLARATION OF CONFLICT OF INTEREST. No disclosures DECLARATION OF CONFLICT OF INTEREST No disclosures micrornas: Role in progression of atherosclerosis Christian Weber Institute for Cardiovascular Prevention (IPEK) Ludwig-Maximilians-University Munich

More information

Contribution of microglia to tissue injury and repair in MS

Contribution of microglia to tissue injury and repair in MS Contribution of microglia to tissue injury and repair in MS MS disease course histologic features Courtesy of Samuel Ludwin I ACUTE CHRONIC s ACTIVE CHRONIC Clinical Course Intra CNS Extra CNS Imaging

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

IL-24 AND ITS ROLE IN WOUND HEALING

IL-24 AND ITS ROLE IN WOUND HEALING IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

Hypoxic pulmonary hypertension (HPH) is still a lifethreating

Hypoxic pulmonary hypertension (HPH) is still a lifethreating mirna and Pulmonary Hypertension mir-29a-3p Attenuates Hypoxic Pulmonary Hypertension by Inhibiting Pulmonary Adventitial Fibroblast Activation Ying Luo, Hai-Ying Dong, Bo Zhang, Zhao Feng, Yi Liu, Yu-Qi

More information

Large Vessel Stiffening and Pulmonary Hypertension: Contribution of Extracellular Proteins and Inflammation

Large Vessel Stiffening and Pulmonary Hypertension: Contribution of Extracellular Proteins and Inflammation 6/21/213 Large Vessel Stiffening and Pulmonary Hypertension: Contribution of Extracellular Proteins and Inflammation RV Failure is the Proximate Cause of Death in Patients With Pulmonary Hypertension K.

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation

PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Romanian Academy Institute of Cellular Biology and Pathology "Nicolae Simionescu" PhD THESIS Epigenetic mechanisms involved in stem cell differentiation Coordinator: Acad. Maya Simionescu PhD Student:

More information

basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA

basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA http://www.kidney-international.org & 213 International Society of Nephrology basic research OPEN see commentary on page 234 Adventitial transduction of lentivirus-shrna-vegf-a in arteriovenous fistula

More information

Part III Innate and Adaptive Immune Cells: General Introduction

Part III Innate and Adaptive Immune Cells: General Introduction Innate and Adaptive Immune Cells: General Introduction Iván López-Expósito As an organ specialized in food digestion and nutrient absorption, the intestinal mucosa presents a huge surface area (almost

More information

vi Preface Table 2 Association of Fibrosis With Types of Injury: Representative Examples

vi Preface Table 2 Association of Fibrosis With Types of Injury: Representative Examples Fibrosis or scar, defined pathologically as inappropriate repair by connective tissue, is increasingly recognized as an important feature of many chronic diseases (Table 1), and as such, represents an

More information

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Tissue renewal and Repair. Nisamanee Charoenchon, PhD   Department of Pathobiology, Faculty of Science Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?

More information

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9 Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis

More information

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest DECLARATION OF CONFLICT OF INTEREST No conflicts of interest University Heart Centre Tübingen Angiogenic actions of platelets Meinrad Gawaz, MD, FESC Tübingen, Germany ESC 2011 Paris GPIb GPIb GPVI TxA2

More information

Hypoxia-Dependent Epigenetic Modifications in the Pulmonary Vasculature

Hypoxia-Dependent Epigenetic Modifications in the Pulmonary Vasculature Hypoxia-Dependent Epigenetic Modifications in the Pulmonary Vasculature I have no financial disclosures or conflicts of interest Sheila Krishnan, D.O. 10th International Conference Neonatal & Childhood

More information

Mechanisms of hepatic fibrogenesis in chronic liver disease

Mechanisms of hepatic fibrogenesis in chronic liver disease Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Dyslipidemia Endothelial dysfunction Free radicals Immunologic

Dyslipidemia Endothelial dysfunction Free radicals Immunologic ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and

More information

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte

More information

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017

Lymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017 Lymphoid architecture & Leukocyte recirculation Thursday Jan 26th, 2017 Topics The life of immune cells Where are they born? Where are they educated? Where do they function? How do they get there? The

More information

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret

ROLE OF INFLAMMATION IN HYPERTENSION. Dr Barasa FA Physician Cardiologist Eldoret ROLE OF INFLAMMATION IN HYPERTENSION Dr Barasa FA Physician Cardiologist Eldoret Outline Inflammation in CVDs the evidence Basic Science in Cardiovascular inflammation: The Main players Inflammation as

More information

VWF other roles than hemostasis. Summary 1: VWF & hemostasis synthesis 11/4/16. Structure/function relationship & functions kDa.

VWF other roles than hemostasis. Summary 1: VWF & hemostasis synthesis 11/4/16. Structure/function relationship & functions kDa. VWF other roles than hemostasis Len$ng PJ, Casari C et al JTH 2012 Summary 1: VWF & hemostasis synthesis Structure/function relationship & functions (HMWM) 20.000kDa multimerization propeptide FVIII GPIb

More information

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group

Chapter 2 (pages 22 33): Cells and Tissues of the Immune System. Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group Allergy and Immunology Review Corner: Cellular and Molecular Immunology, 8th Edition By Abul K. Abbas, MBBS; Andrew H. H. Lichtman, MD, PhD; and Shiv Pillai, MBBS, PhD. Chapter 2 (pages 22 33): Cells and

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy

Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Chapter 11 (pages 429-460): Dynamics of Adaptive Immunity prepared by Kelly von Elten, Walter Reed National Military Medical Center,

More information

2015 ICDM, 15-17, Jejudob Island, Korea Recent Advances in Diabetic Microvascular Complications. DPP-4 Inhibition and Diabetic Nephropathy

2015 ICDM, 15-17, Jejudob Island, Korea Recent Advances in Diabetic Microvascular Complications. DPP-4 Inhibition and Diabetic Nephropathy 2015 ICDM, 15-17, Jejudob Island, Korea Recent Advances in Diabetic Microvascular Complications DPP-4 Inhibition and Diabetic Nephropathy Daisuke Koya Department of Diabetology & Endocrinology Kanazawa

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation

Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway

More information

Oncolytic Virotherapy: Targeting Cancer Stem Cells

Oncolytic Virotherapy: Targeting Cancer Stem Cells Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:

More information

Heterotypy and Angiogenesis

Heterotypy and Angiogenesis Heterotypy and Angiogenesis Tumors are perpetual wounds 1. Normally stroma and epithelia converse at a distance. 2. Juxtaposition of stroma and epithelia is indicative of tissue damage. 4. Activate strategies

More information

cure research HIV & AIDS

cure research HIV & AIDS Glossary of terms HIV & AIDS cure research Antiretroviral Therapy (ART) ART involves the use of several (usually a cocktail of three or more) antiretroviral drugs to halt HIV replication. ART drugs may

More information

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Summary of Doctoral Thesis Hidenori Yasuda Graduate School of Veterinary

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Section Title. Subject Index

Section Title. Subject Index Section Title Subject Index Acute kidney injury definitions 287 289 hypoxia 287, 290 overview 286, 287 sublethal tubular injury adaptive responses 292, 293 combination of sublethal injuries 291, 292 detection

More information

Mesenchymal progenitor cells in intramuscular connective tissue development

Mesenchymal progenitor cells in intramuscular connective tissue development Mesenchymal progenitor cells in intramuscular connective tissue development Min Du, Ph.D. Professor and Endowed Chair Department of Animal Sciences Washington State University Pullman, WA Beef Quality:

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

Innate Immunity II. Integration. Lindsay Nicholson Advanced Immunology L2

Innate Immunity II. Integration. Lindsay Nicholson Advanced Immunology L2 Innate Immunity II Integration Lindsay Nicholson Advanced Immunology L2 l.nicholson@bristol.ac.uk Lecture 1 Defining Innate Immunity Recognition and effector mechanisms (I) Lecture 2 Recognition and effector

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

The significance of macrophage polarization subtypes for animal models of tissue fibrosis and human fibrotic diseases

The significance of macrophage polarization subtypes for animal models of tissue fibrosis and human fibrotic diseases Wermuth and Jimenez Clinical and Translational Medicine (2015) 4:2 DOI 10.1186/s40169-015-0047-4 REVIEW The significance of macrophage polarization subtypes for animal models of tissue fibrosis and human

More information

Inhibition of E-Selectin or E-selectin together with CXCR4 Re-sensitizes Multiple Myeloma to Treatment

Inhibition of E-Selectin or E-selectin together with CXCR4 Re-sensitizes Multiple Myeloma to Treatment Inhibition of E-Selectin or E-selectin together with CXCR4 Re-sensitizes Multiple Myeloma to Treatment 1, Ph.D. Henna Bazai 1, Anita Sekula 1, William Fogler 2, Ted Smith 2, John Magnani 2 and Abdel Kareem

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine

Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline! Consensus characteristics! Allergens:role in asthma! Immune/inflammatory basis! Genetic basis!

More information

Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.

Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA. Research article Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension, and its inhibition attenuates pathologic features of disease Wanli Ma, 1 Weihong Han, 1 Peter

More information

Journal Club Semmler Lorenz

Journal Club Semmler Lorenz Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to

More information

Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.

Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment

Small Molecule Inhibitor of the Wnt Pathway (SM04755) as a Potential Topical Scleroderma Treatment Small Molecule Inhibitor of the Wnt Pathway (SM755) as a Potential Topical Scleroderma Treatment Vishal Deshmukh, PhD, Allison Hood, Yusuf Yazici, MD Disclosures Vishal Deshmukh, Ph.D. o Financial disclosure:

More information

Four Types of Vertebrate Tissue

Four Types of Vertebrate Tissue BIO 121 Molecular Cell Biology Lecture Section IV A. Cells in the Context of Tissue, Organ and Organismal Architecture B. Wound Healing Four Types of Vertebrate Tissue 1.Epithelium 2.Connective Tissue

More information

Harkness, Louise M; Kanabar, Varsha; Sharma, Hari S; Westergren-Thorsson, Gunilla; Larsson Callerfelt, Anna-Karin

Harkness, Louise M; Kanabar, Varsha; Sharma, Hari S; Westergren-Thorsson, Gunilla; Larsson Callerfelt, Anna-Karin Pulmonary vascular changes in asthma and COPD. Harkness, Louise M; Kanabar, Varsha; Sharma, Hari S; Westergren-Thorsson, Gunilla; Larsson Callerfelt, Anna-Karin Published in: Pulmonary Pharmacology & Therapeutics

More information

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three

More information

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium

More information

are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran

are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran CXC chemokines CXCL1, CXCL9, CXCL10 and CXCL12 are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran Mojgan Noroozi Karimabad Molecular Medicine Research

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Cardiovascular Protection and the RAS

Cardiovascular Protection and the RAS Cardiovascular Protection and the RAS Katalin Kauser, MD, PhD, DSc Senior Associate Director, Boehringer Ingelheim Pharmaceutical Inc. Micardis Product Pipeline Scientific Support Ridgefield, CT, USA Cardiovascular

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine

More information

Invited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases

Invited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases Histol Histopathol (2000) 15: 557-571 Histology and Histopathology Cellular and Molecular Biology Invited Review Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular

More information

TITLE: Inhibitors of Histone Deacetylases for Radiosensitization of Prostate Cancer

TITLE: Inhibitors of Histone Deacetylases for Radiosensitization of Prostate Cancer AD Award Number: W81XWH-04-1-0170 TITLE: Inhibitors of Histone Deacetylases for Radiosensitization of Prostate Cancer PRINCIPAL INVESTIGATOR: Mira O. Jung, Ph.D. CONTRACTING ORGANIZATION: Georgetown University

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

Biology of Immune Aging

Biology of Immune Aging Biology of Immune Aging Jorg J. Goronzy Stanford University Immune deficiency Increase morbidity and mortality from infections Poor vaccine responses Cancer Immune Aging Chronic inflammation Coronary artery

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

The Immune Response in Time and Space

The Immune Response in Time and Space The Immune Response in Time and Space Chapters 14 & 4 Sharon S. Evans, Ph.D. Department of Immunology 845-3421 sharon.evans@roswellpark.org September 18 & 23, 2014 Inflammation Inflammation Complex response

More information

Professor Harvey White. Interventional Cardiologist Auckland

Professor Harvey White. Interventional Cardiologist Auckland Professor Harvey White Interventional Cardiologist Auckland Stem cells and the heart Harvey White Director of Coronary Care Unit and Cardiovascular Research Unit Green Lane Cardiovascular Service Auckland

More information

Diagnosis and Management of Fungal Allergy Monday, 9-139

Diagnosis and Management of Fungal Allergy Monday, 9-139 Diagnosis and Management of Fungal Allergy Monday, 9-139 13-2010 Alan P. Knutsen,, MD Director, Pediatric Allergy & Immunology Director, Jeffrey Modell Diagnostic Center for Primary Immunodeficiencies

More information

Treprostinil inhibits the recruitment of bone marrow-derived circulating fibrocytes in chronic hypoxic pulmonary hypertension

Treprostinil inhibits the recruitment of bone marrow-derived circulating fibrocytes in chronic hypoxic pulmonary hypertension Eur Respir J 21; 36: 132 1314 DOI: 1.1183/931936.289 CopyrightßERS 21 Treprostinil inhibits the recruitment of bone marrow-derived circulating fibrocytes in chronic hypoxic pulmonary hypertension V.S.

More information

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells

CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells CD34 + VEGFR-3 + progenitor cells have a potential to differentiate towards lymphatic endothelial cells Tan YZ et al. J Cell Mol Med. (2014 Mar;18(3):422-33) Denise Traxler-Weidenauer April 2014 Introduction

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome Page 1 Supplemental Data Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in Hermansky-Pudlak Syndrome Lisa R. Young, Peter M. Gulleman, Chelsi W. Short, Harikrishna Tanjore,

More information

Arteriosclerosis & Atherosclerosis

Arteriosclerosis & Atherosclerosis Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,

More information

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O

More information

Exploring the Reno-Cardiac Connection. Protect your kidneys save your heart

Exploring the Reno-Cardiac Connection. Protect your kidneys save your heart Exploring the Reno-Cardiac Connection Protect your kidneys save your heart Heart Failure: a major health care problem ~23 million people with heart failure worldwide Heart failure increases progressively

More information

Lecture name: blood 2 & The Circulatory System Edited by: Buthainah Al masaeed & Yousef Qandeel

Lecture name: blood 2 & The Circulatory System Edited by: Buthainah Al masaeed & Yousef Qandeel Lecture name: blood 2 & The Circulatory System Edited by: Buthainah Al masaeed & Yousef Qandeel Now we will take about A granulocytes : Lymphocyte Monocytes 1- Lymphocyte - The second major type of presence

More information

Pulmonary vascular remodelling: causes, mechanisms and consequences

Pulmonary vascular remodelling: causes, mechanisms and consequences Pulmonary vascular remodelling: causes, mechanisms and consequences Ralph Schermuly Department of Pulmonary Pharmacotherapy University of Giessen and Marburg Lung Center email: ralph.schermuly@ugmlc.de

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

Supplementary Material to Manuscript SREP A

Supplementary Material to Manuscript SREP A Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut

More information

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)

More information

Are you the way you are because of the

Are you the way you are because of the EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

More information

Mesenchymal Stem Cells

Mesenchymal Stem Cells Mesenchymal Stem Cells Science and therapeutic applications Dirk Büscher (Former VP-R&D Cellerix) GRIFOLS SA May 10 th, 2010 EMA 1 Discovery and Definition of Mesenchymal Stem Cells MSC must be plastic-adherent

More information

Adenovirus engineered human dendritic cell vaccine induces natural killer cell chemotaxis

Adenovirus engineered human dendritic cell vaccine induces natural killer cell chemotaxis Adenovirus engineered human dendritic cell vaccine induces natural killer cell chemotaxis via CXCL8/IL 8 and CXCL10/IP 10 chemokines Lazar Vujanović, Ph.D. Research Instructor P.I. Lisa H. Butterfield,

More information

Searching for Targets to Control Asthma

Searching for Targets to Control Asthma Searching for Targets to Control Asthma Timothy Craig Distinguished Educator Professor Medicine and Pediatrics Penn State University Hershey, PA, USA Inflammation and Remodeling in Asthma The most important

More information