Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
|
|
|
- Tabitha Kelly
- 5 years ago
- Views:
Transcription
1 IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA _AAVDYQK(ac)VVR_ b Pre-immu After-immu Flag- WT K81R WT K81R / Flag ratio 1..3 Flag Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. (a) Identification of acetylated MAT IIα peptide by mass spectrometry. (b) K81R mutant decreases MAT IIα acetylation. Flag-tagged wild type or K81R mutant of MAT IIα was transfected into HEK293T cells and acetylation of the purified proteins was detected using antibody or pre-immune serum.
2 Relative Protein Relative Protein Relative MAT2A mrna a Huh7 MG132 Folate (mg/l) / ratio / ß-actin ratio Normalized against Normalized against ß-actin b HEK 293T MG TSA / ß-actin ratio NS - TSA c 293T H1299 U937 MG / ß-actin ratio d TSA CHX (h) n Hour * * ** TSA - TSA + e TSA MG CHX (h) Hour * MG132 - MG132 + Supplementary Figure 2. Folate-Deprivation Promotes MAT IIα K81 Acetylation and Proteasomal Degradation. (a) Folate-deprivation increases K81 acetylation of MAT IIα and decreases its protein level. Huh7 cells were cultured upon the indicated condition. Cell lysates were analyzed by western blotting. K81 acetylation levels were normalized against MAT IIα, and MAT IIα protein levels were normalized against β-actin. (b) MG132 restores the level of MAT IIα protein reduced by TSA treatment. HEK293T cells were treated
3 as indicated and cell lysates were analyzed by western blotting. MAT2A mrna was analyzed by qpcr and normalized against β-actin. Error bars represent ±SD of triplicate experiments. The two-tailed student t-test was used. NS denotes no significance. (c) MG132 leads to accumulation of MAT IIα protein. HEK293T, H1299 and U937 cells were treated with either DMSO (solvent) or 1μM MG132. Cell lysates were analyzed by western blotting. (d) TSA destabilizes endogenous MAT IIα. HEK293T cells were treated with TSA (1μM for 18h) and CHX (1μg/ml) as indicated. Endogenous MAT IIα protein levels were analyzed by western blotting and normalized against β-actin (left panel). The right panel showcases relative protein amounts of different groups. Error bars represent ±SD of triplicate experiments. The two-tailed student t-test was used. * denotes p <.5; ** denotes p <.1; denotes p <.1. (e) MG132 stabilizes endogenous MAT IIα. HEK293T cells were treated as indicated. MAT IIα protein levels were determined by western blotting and normalized against β-actin (left panel). The right panel showcases relative protein amounts of different groups. Error bars represent ±SD of triplicate experiments. The two-tailed student t-test was used. * denotes p <.5; denotes p <.1.
4 Relative UBR4 mrna Folate (mg/l) 1 MG siubr / ß-actin ratio / ß-actin ratio / ratio Normalized against ß-actin Normalized against MAT IIα Scramb siubr4 Supplementary Figure 3. UBR4 is the E3 Ligase Mediating MAT IIα Degradation. UBR4 knockdown increases MAT IIα protein level and its acetylation level. HEK293T cells were transfected with siubr4 or control and treated as indicated. MAT IIα protein and its acetylation levels were determined by western blotting (left panel). The efficiency of UBR4 knockdown was validated by qpcr (right panel). Error bars represent ±SD of triplicate experiments. The two-tailed student t-test was used. denotes p <.1.
5 Input IP: Flag Flag-MAT IIα WT Flag-MAT IIα K81R Flag-MAT IIα K81Q Flag-P3 Pan-Ac Flag / Flag- ratio Flag-P3 Flag-MAT IIα 3kDa Supplementary Figure 4. P3 Acetylates MAT IIα. P3 acetylates wild-type MAT IIα but not K81R/Q mutant. HEK293T cells were transfected with indicated plasmids and acetylation of flag-mat IIα was determined with pan-acetylation antibody.
6 Input IP: Flag Flag HA-HDAC Pan-Ac/ Flag ratio Pan-Ac Flag HA-HDAC3 HA-HDAC4 Flag 13kDa Supplementary Figure 5. HDAC3 Deacetylates MAT IIα Over-expression of HDAC3, but not HDAC4, decreases the acetylation level of MAT IIα. HA-tagged HDAC3 and 4 were co-transfected respectively with flag-tagged MAT IIα into HEK293T cells and the acetylation levels of MAT IIα were determined by western blotting.
7 Relative SAM/SAH Ratio Relative SAM/SAH Ratio 5-mC% OD 49nm OD 49nm OD 49nm a b HepG2 MTT Assay Day MTT Assay Vec shmat2a (vs Vec) * (vs Vec) (vs Vec) Normal WT K81R K81Q Day Day Folate Deprivation WT K81R K81Q * * (vs WT) (vs WT) (vs WT) (vs WT) c e Normal WT K81R K81Q Folate Deprivation WT K81R K81Q d Whole Genome Methylation Assay Normal Folate Deprivation WT K81R K81Q Day p (WT vs K81R) p (WT vs K81Q) p (K81R vs K81Q) f #H52 #H55 #H63 #H66 #H7 #H74 #H #H15251 MAT IIα #H #H15358 #H1536 #15367 #H15392 #H15394 #H15319 # MAT IIα # # # # #15339 #15332 # # MAT IIα
8 g HDAC3 ß - actin #H5 #H53 #H6 #H15323 #H15317 # # # #H52 #H55 #H63 #H66 #H7 #H74 #H #H15251 HDAC3 ß - actin #H #H15358 #H15364 #15367 #H15392 #H15394 #H15319 # HDAC3 ß - actin # # # # #15339 #15332 # # HDAC3 ß - actin Supplementary Figure 6. K81 Mutation Promotes Tumor Cell Growth in vitro and in vivo. (a) Knockdown MAT2A results in growth arrest in HepG2 stable cells. HepG2 stable cells expressing scramble or shmat2a were cultured in normal or folate-deprived medium. MTT assays were performed every 24 hours. Error bars represent cell numbers ± SD for triplicate experiments. The two-tailed student t-test was used. * denotes p <.5; denotes p <.1. (b) K81R and K81Q mutations reverse the proliferative disadvantage of HepG2 cells upon folate-deprivation. HepG2 stable cells were cultured in normal or folate-deprived medium. MTT assays were performed every 24 hours. Error bars represent cell numbers ± SD for triplicate experiments. The two-tailed student t-test was used. * denotes p <.5; denotes p <.1. (c) Folate-deprivation reduces SAM/SAH ratio in wild-type MAT IIα-expressing stable cells. HepG2 stable cells were cultured with or without folate for 48h before harvest and weighed. The cell pellets were added with.4 M perchloric acid (1 μl per 3 mg pellet), mixed vigorously and centrifuged. ph of supernatants were adjusted to 5-7 with 2.5 M K2HPO4 and kept on ice for 15 min allowing potassium perchlorate to precipitate. Samples were centrifuged twice and supernatants were analyzed by LC MS/MS. The statistical significance of difference among different groups was evaluated using two-tailed student t-test. denotes p <.1. (d) Folate-deprivation decreases genomic DNA methylation of HepG2 stable cells expressing wild-type MAT IIα but not K81 mutants. HepG2 stable cells were cultured with or without folate for 48h before harvest. Genomic DNA was isolated, and Methylated DNA quantification kit (Abnova co.) was used to detect total DNA methylation. The statistical significance of difference among different groups was evaluated using two-tailed studen t-test. denotes p <.1. (e) p values in figure 6c were shown. (f) The hepatocellular cancer clinical samples show an inverse correlation between MAT IIα protein and K81 acetylation. Human hepatocellular cancer samples each paired with cancerous tissue (designated as C) and adjacent normal tissue (designated as N) were lysed and directly subjected to western blotting. (g) HDAC3 expression is increased in 19 out 32 (about 59%) cases of HCC samples. For technical details, please refer to Figure legend of Fig. 6 in the main figures.
9 Supplementary Figure 7. Full Scans of Western Blotting Data in Main Figures. Figure 1a IgG IP: Pan-Ac (293T) IP: Pan-Ac (Chang s) IgG IP: Flag (293T) IP: Flag (Chang s) Input: Flag (293T) Input: Flag (Chang s) Figure 1c IP: Pan-Ac Input: Flag IP: Flag Figure 1e
10 Figure 1f (Blocked by (Blocked by Acetylated Non-acetylated peptide) peptide) Figure 1g (293T) MAT IIα (293T) (Hela) MAT IIα (Hela) (HepG2) MAT IIα (HepG2)
11 Figure 2a β-actin Figure 2d Flag- WT Flag- K81R Flag- K81Q ( WT ) ( K81R ) ( K81Q ) Figure 2g (Folate+, MG132-)
12 Figure 2g β-actin (Folate+, MG132-) (Folate-, MG132-) (Folate-, MG132+) β-actin (Folate-, MG132-) β-actin (Folate-, MG132+) Figure 3a 1 Flag-UBR4(D) Figure 3b β-actin Figure 3c (siubr4 -) (siubr4 +)
13 Figure 3c siubr4 - siubr4 + Figure 4a IP: Pan-Acetylation IP: Flag 3kDa Input: Flag-P3, CBP 18kDa 13kDa Input: Flag-PCAF 5kDa Input: Myc-GCN5 Figure 4b 3kDa 18kDa 13kDa Flag-P3 Figure 4c
14 Figure 4c P3 3kDa 18kDa 13kDa Figure 4d 25kDa 3kDa 18kDa 13kDa 5kDa Flag-P3 Figure 4e
15 Figure 4f 3kDa 18kDa IP: P3 13kDa Input: Flag IP: Flag Figure 4g GST 3kDa P3 18kDa 13kDa Figure 5a IP: Pan-Ac 1 13kDa Input: Flag IP: Flag Figure 5b MAT IIα
16 Figure 5c MAT 25kDa HDAC3 β-actin Figure 5d (sihdac3-) (sihdac3+) β-actin (sihdac3-) β-actin (sihdac3+) Figure 5e Input: HDAC3 IP: HDAC3 IP: 25kDa Input: Figure 5f 3kDa 18kDa 13kDa 25kDa 11kDa P3 HDAC3 GST
17 Figure 6a Flag β-actin Figure 6e Flag β-actin Figure 6f #H5- #H5- MAT IIα #H5- actin #H53- #H53- MAT IIα #H53- actin
18 Figure 6f #H6- #H6- MAT IIα #H6- actin #H #H MAT IIα #H actin #H #H MAT IIα #H actin #H #H MAT IIα #H actin #H #H MAT IIα #H actin #H #H MAT IIα #H actin
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
A. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3073 LATS2 Binding ability to SIAH2 Degradation by SIAH2 1-160 161-402 403-480 -/ 481-666 1-666 - - 667-1088 -/ 1-0 Supplementary Figure 1 Schematic drawing of LATS2 deletion mutants and
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic density. Hippocampal neurons were transfected with mir124 (containing DsRed) or DsRed as a control. 2 d after transfection,
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Appendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Acetylation Regulates Gluconeogenesis by Promoting PEPCK1 Degradation via Recruiting the UBR5 Ubiquitin Ligase
Article Acetylation Regulates Gluconeogenesis by Promoting PEPCK1 Degradation via Recruiting the UBR5 Ubiquitin Ligase Wenqing Jiang, 1,2 Shiwen Wang, 1,2 Mengtao Xiao, 1,2 Yan Lin, 2 Lisha Zhou, 1,2 Qunying
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/398/rs12/dc1 Supplementary Materials for Quantitative phosphoproteomics reveals new roles for the protein phosphatase PP6 in mitotic cells Scott F. Rusin, Kate
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit
Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico
Acetylation Stabilizes ATP-Citrate Lyase to Promote Lipid Biosynthesis and Tumor Growth
Article Acetylation Stabilizes ATP-Citrate Lyase to Promote Lipid Biosynthesis and Tumor Growth Ruiting Lin, 1,2,3,7 Ren Tao, 4,7 Xue Gao, 1,2,3 Tingting Li, 1,2,3 Xin Zhou, 1,2,3 Kun-Liang Guan, 1,2,5
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature13418 Supplementary Results: USP30 opposes autophagic flux In HEK-293 cells, USP30 overexpression increased basal LC3-II levels, dependent on enzymatic activity,
Reviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering