The Role of Microenvironment in the Control of Tumor Angiogenesis
|
|
- Kory Rice
- 5 years ago
- Views:
Transcription
1 The Role of Microenvironment in the Control of Tumor Angiogenesis
2
3 Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis
4 Domenico Ribatti Department of Basic Medical Sciences, Neurosciences and Sensory Organs University of Bari Medical School Bari, Italy National Cancer Institute Giovanni Paolo II Bari, Italy ISBN DOI / ISBN (ebook) Library of Congress Control Number: Springer International Publishing Switzerland 2016 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. Printed on acid-free paper This Springer imprint is published by SpringerNature The registered company is Springer International Publishing AG Switzerland
5 Acknowledgments This work was supported by European Union Seventh Framework Programme (FPT7/ ) under grant agreement n to DR. v
6
7 Contents 1 Tumor Microenvironment Metastatic Cascade Epithelial-Mesenchymal Transition The Extracellular Matrix Tumor Blood Vessels and Tumor Endothelial Cells Tumor Basement Membrane Tumor Pericytes Tumor Angiogenesis Sprouting Angiogenesis Vascular Co-option Vasculogenic Mimicry Intussusceptive Microvascular Growth Inflammatory Cells in Tumor Microenvironment Neutrophils Eosinophils and Dendritic Cells Lymphocytes and Platelets Mast Cells Macrophages Tie-2 Expressing Monocytes (TEMs) Fibroblasts Osteoblasts and Osteoclasts Cancer Stem Cells (CSCs) Circulating Endothelial Cells and Endothelial Precursor Cells Multipotent Adult Progenitor Cells (MAPCs) and Myeloid-Derived Suppressor Cells (MDSCs) vii
8 viii Contents 5 Therapeutic Strategies, the Concept of Normalization and the Role of VEGF Inhibition References Index... 85
9 List of Abbreviations ALDH1 Aldehyde dehydrogenase 1 AML Acute myeloid leukemia ANG-1 Angiopoietin-1 APL Acute promyelocytic leukemia A-SMA Alpha smooth actin ATRA All trans retinoic acid BM Bone marrow BMP Bone morphogenetic protein CAM Chorioallantoic membrane CCL5 Chemokine (C-C motif) ligand-5 COX-2 Cycloxygenase-2 CSC Cancer stem cell CSF Colony stimulating factor CSF-1R CSF-1 receptor CXCL Chemokine (C-X-C motif) ligand DLBCL Diffuse large B-cell lymphoma ECs Endothelial cells ECM Extracellular matrix EDG-1 Endothelial differentiation gene-1 EGF Epidermal growth factor EMT Epithelial mesenchymal transition enos Endothelial nitric oxide synthase EPCs Endothelial precursor or progenitor cells ESA Epidermal surface antigen FAP Fibroblast activating protein FDA Food and Drug Administration FGF-2 Fibroblast growth factor-2 FSP-1 Fibroblast specific protein-1 GCSF Granulocyte colony stimulating factor GFP Green fluorescent protein ix
10 x GIST GM-CSF GSC HCs HGF HIFs HPCs HPV HRG HSCs ICAM IFN IGF-1 IL IMG inos LT-CSC M-CSF mtor MAPCs MCP MDSCs MET MGUS MIP-2 MM MMP-9 MSCs MT1-MMP mtor NAID NECA NG2 NGF NK NOD-SCID NSAIDs NSCLS OPN PlGF-1 PA PAR PC PDGF PDGFR List of Abbreviations Gastrointestinal stroma tumors Granulocyte macrophage colony stimulating factor Glioblastoma stem-like cells Hematopoietic Cells Hepatocyte growth factor Hypoxia inducible factors Hematopoietic precursor cells Human papilloma virus Histidine-rich glycoprotein Hematopoietic stem cells Intercellular cellular adhesion molecule Interferon Insulin-like growth factor-1 Interleukin Intussusceptive microvascular growth Inducible nitric oxide synthase Long term CSC Macrophage-colony stimulating factor Mammalian target of rapamycin Multipotent adult progenitor cells Monocyte chemotactic protein Myeloid derived suppressor cells Mesenchymal epithelial transition Monoclonal gammopathy of undetermined significance Macrophage inflammatory protein-2 Multiple myeloma Matrix metalloproteinase-9 Mesenchymal stem cells Membrane type-1-mmp Mammalian target of rapamycin Nonsteroidal anti-inflammatory drugs N-methyl carboxamide adenosine Nerve/glial antigen-2 Nerve growth factor Natural killer Non obese diabetic/severe combined immunodeficiency Non-steroidal anti-inflammatory drugs Non small cell lung cancer Osteopontin Placental growth factor-1 Plasminogen activator Protease activated receptor Pericytes Platelet derived growth factor Platelet derived growth factor receptor
11 List of Abbreviations xi PGE2 Prostaglandin E2 PSMA Prostate specific membrane antigen PTX-3 Pantraxin-3 PyMT Polyoma middle-t RA Retinoic acid RNI Reactive nitrogen intermediate ROS Reactive oxygen species RTKIs Receptor tyrosine kinase inhibitors SCF Stem cell factor SDF-1 Stromal cell derived factor 1 ST-CSC Short term CSC TAF Tumor angiogenesis factor TAFs Tumor associated fibroblast TAM Tumor associated macrophages TEMs Tie2-expressing monocytes TGF-β Transforming growth factor beta TIMP-3 Tissue inhibitor of matrix metalloproteinase-3 TNF-α Tumor necrosis factor alpha TRAMP Transgenic adenocarcinoma of the mouse prostate Treg T regulatory TSP-1 Thrombospondin-1 VCAM Vascular cellular adhesion molecule VE-cadherin Vascular endothelia cadherin VEGF Vascular endothelial growth factor VEGFR1 Vascular endothelial growth factor receptor 1 VVO Vesciculo vacuolar organelles VWF Von Willebrand factor
Angiogenesis and Anti-Angiogenesis in Hematological Malignancies
Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Domenico Ribatti Angiogenesis and Anti-Angiogenesis in Hematological Malignancies 1 3 Domenico Ribatti Department of Basic Medical Sciences
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationCurrent Therapy and Surgery for Urogenital Tuberculosis
Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Research TB Institute Novosibirsk Medical University
More informationPractical Case Studies in Hypertension Management. Series editor Giuliano Tocci Rome, Italy
Practical Case Studies in Hypertension Management Series editor Giuliano Tocci Rome, Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat
More informationEffects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
More informationPractical Case Studies in Hypertension Management. Series editor: Giuliano Tocci Rome Italy
Practical Case Studies in Hypertension Management Series editor: Giuliano Tocci Rome Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat
More informationSeeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
More informationHeterotypy and Angiogenesis
Heterotypy and Angiogenesis Tumors are perpetual wounds 1. Normally stroma and epithelia converse at a distance. 2. Juxtaposition of stroma and epithelia is indicative of tissue damage. 4. Activate strategies
More informationSPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY. Gerhard Bauer Joseph S. Anderson. Gene Therapy for HIV From Inception to a Possible Cure
SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY Gerhard Bauer Joseph S. Anderson Gene Therapy for HIV From Inception to a Possible Cure 123 SpringerBriefs in Biochemistry and Molecular Biology For
More informationSpringerBriefs in Applied Sciences and Technology
SpringerBriefs in Applied Sciences and Technology Computational Intelligence Series Editor Janusz Kacprzyk, Systems Research Institute, Polish Academy of Sciences, Warsaw, Poland SpringerBriefs in Computational
More informationLouise Grech Alan Lau Editors. Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis. From Hospital to Community
Louise Grech Alan Lau Editors Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis From Hospital to Community Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Louise Grech
More informationMeasures of Positive Psychology
Measures of Positive Psychology Kamlesh Singh Mohita Junnarkar Jasleen Kaur Measures of Positive Psychology Development and Validation 123 Kamlesh Singh Department of Humanities and Social Sciences Indian
More informationHandbook of Insulin Therapies
Handbook of Insulin Therapies Winston Crasto Janet Jarvis Melanie J. Davies Handbook of Insulin Therapies Winston Crasto George Eliot Hospital NHS Trust, Nuneaton United Kingdom Janet Jarvis Leicester
More informationDesmond P. Kidd. Neuro-Ophthalmology. Illustrated Case Studies
Neuro-Ophthalmology Desmond P. Kidd Neuro-Ophthalmology Illustrated Case Studies Desmond P. Kidd Department of Clinical Neurosciences Royal Free Hospital London UK ISBN 978-1-4471-2409-2 DOI 10.1007/978-1-4471-2410-8
More informationSpringerBriefs in Cancer Research
SpringerBriefs in Cancer Research For further volumes: http://www.springer.com/series/10786 Natalia Aptsiauri Angel Miguel Garcia-Lora Teresa Cabrera MHC Class I Antigens In Malignant Cells Immune Escape
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationMedical and Surgical Complications of Sickle Cell Anemia
Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Department of Surgery Dar A lalafia Medical Company Qatif
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationSami Shousha Editor. Breast Pathology. Problematic Issues
Breast Pathology Editor Breast Pathology Problematic Issues Editor Charing Cross Hospital Imperial College Healthcare NHS Trust & Imperial College London United Kingdom ISBN 978-3-319-28653-2 ISBN 978-3-319-28655-6
More informationIn Clinical Practice
In Clinical Practice Taking a practical approach to clinical medicine, this series of smaller reference books is designed for the trainee physician, primary care physician, nurse practitioner and other
More informationRadiation Therapy for Gastrointestinal Cancers
Radiation Therapy for Gastrointestinal Cancers Theodore Hong Prajnan Das Editors Radiation Therapy for Gastrointestinal Cancers Editors Theodore Hong Massachusetts General Hospital Harvard Medical School
More informationBiomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
More informationCharacterisation of bone marrow progenitor cells in disease
Characterisation of bone marrow progenitor cells in disease A thesis submitted for the degree of Doctor of Philosophy Imperial College London Leukocyte Biology Kate Hayley Christine Gowers 2012 ~ 1 ~ Acknowledgements
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationThe Cleveland Clinic Manual of Dynamic Endocrine Testing
The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin A. Laurence Kennedy Manjula K. Gupta Amir H. Hamrahian The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin Department of Endocrinology,
More informationWhite Coat Hypertension
White Coat Hypertension Giuseppe Mancia Guido Grassi Gianfranco Parati Alberto Zanchetti White Coat Hypertension An Unresolved Diagnostic and Therapeutic Problem Giuseppe Mancia Emeritus Professor University
More informationInflammation and Lung Cancer
Inflammation and Lung Cancer Steven M. Dubinett Editor Inflammation and Lung Cancer 1 3 Editor Steven M. Dubinett David Geffen School of Medicine at UCLA Los Angeles California USA ISBN 978-1-4939-2723-4
More informationCytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression
Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?
More informationClinician s Manual on Restless Legs Syndrome
Clinician s Manual on Restless Legs Syndrome Mark J. Buchfuhrer Clinician s Manual on Restless Legs Syndrome Second Edition Mark J. Buchfuhrer PIH Health Hospital - Downey Downey, CA USA ISBN 978-3-319-31372-6
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationHematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne
Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationTissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science
Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration
More informationTherapeutic rtms in Neurology
Therapeutic rtms in Neurology Thomas Platz Editor Therapeutic rtms in Neurology Principles, Evidence, and Practice Recommendations Editor Thomas Platz BDH-Klinik Greifswald Ernst-Moritz-Arndt Universität
More informationDifferential Diagnosis of Movement Disorders in Clinical Practice
Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Peter Hedera Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Parkinson's Clinic
More informationTumor Microenvironment and Immune Suppression
Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation
More informationCongenital Hip Disease in Adults
Congenital Hip Disease in Adults George Hartofilakidis George C. Babis Kalliopi Lampropoulou-Adamidou Congenital Hip Disease in Adults George Hartofilakidis, MD, FACS Orthopaedic Department Medical School
More informationSpringerBriefs in Psychology. Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle
SpringerBriefs in Psychology Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle Epidemiological studies show that the prevalence of mental disorders is extremely high across the globe
More informationEpigenetic Advancements in Cancer
Epigenetic Advancements in Cancer Manoj K. Mishra Kumar S. Bishnupuri Editors Epigenetic Advancements in Cancer Editors Manoj K. Mishra Department of Biological Sciences Alabama State University Montgomery,
More informationGenetic Influences on Response to Drug Treatment for Major Psychiatric Disorders
Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders Janusz K. Rybakowski Alessandro Serretti Editors Genetic Influences on Response to Drug Treatment for Major Psychiatric
More informationChromosomal Translocations and Genome Rearrangements in Cancer
Chromosomal Translocations and Genome Rearrangements in Cancer Janet D. Rowley Michelle M. Le Beau Terence H. Rabbitts Editors Chromosomal Translocations and Genome Rearrangements in Cancer Editors Janet
More information!!! Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014
Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014 Department of Cancer Genetics Masashi Muramatsu, Ph.D. About Exam First, think and understand the concepts.
More informationEmerging Concepts of Tumor Exosome Mediated Cell Cell Communication
Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Huang-Ge Zhang Editor Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication 2123 Editor Huang-Ge Zhang University of Louisville
More informationTumor Associated Macrophages as a Novel Target for Cancer Therapy
Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations
More informationAdvances in Experimental Medicine and Biology
Advances in Experimental Medicine and Biology Volume 938 Editorial Board IRUN R. COHEN, The Weizmann Institute of Science, Rehovot, Israel N.S. ABEL LAJTHA, Kline Institute for Psychiatric Research, Orangeburg,
More informationEditor Journal of Allergy and Therapy
Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the
More informationContribution of Interstitial Valve Cells to Aortic Valve Calcification
UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,
More informationCYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
More informationWound Management in Urgent Care
Wound Management in Urgent Care Brittany Busse Wound Management in Urgent Care Brittany Busse, MD Med 7 Urgent Care Folsom, CA, USA ISBN 978-3-319-27426-3 DOI 10.1007/978-3-319-27428-7 ISBN 978-3-319-27428-7
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p
More informationCognitive, Conative and Behavioral Neurology
Cognitive, Conative and Behavioral Neurology Michael Hoffmann Cognitive, Conative and Behavioral Neurology An Evolutionary Perspective Michael Hoffmann MD, PhD Professor of Neurology Orlando VA Medical
More informationSpringerBriefs in Criminology
SpringerBriefs in Criminology Policing Series editor M.R. Haberfeld City University of New York John Jay College of Criminal Justice New York, NY, USA More information about this series at http://www.springer.com/series/11179
More informationMark W.J. Strachan Brian M. Frier. Insulin Therapy. A Pocket Guide
Insulin Therapy Mark W.J. Strachan Brian M. Frier Insulin Therapy A Pocket Guide Mark W.J. Strachan, MD, FRCP (Ed) Metabolic Unit Western General Hospital Edinburgh United Kingdom Brian M. Frier, MD,
More informationIatrogenic Effects of Orthodontic Treatment
Iatrogenic Effects of Orthodontic Treatment Roberto Justus Iatrogenic Effects of Orthodontic Treatment Decision-Making in Prevention, Diagnosis, and Treatment Roberto Justus Department of Orthodontics
More informationProgress in Social Psychiatry in Japan
Progress in Social Psychiatry in Japan Yoshibumi Nakane Progress in Social Psychiatry in Japan An Approach to Psychiatric Epidemiology Yoshibumi Nakane Department of Neuropsychiatry Nagasaki University
More informationTHE TUMOR MICROENVIRONMENT: INSIGHT INTO FIBROBLASTS PATHOPHYSIOLOGICAL FUNCTIONS
DOTTORATO DI RICERCA IN SCIENZE BIOMEDICHE INDIRIZZO IN BIOCHIMICA E BIOLOGIA APPLICATA CICLO XXVI COORDINATORE Prof. Dello Sbarba Persio THE TUMOR MICROENVIRONMENT: INSIGHT INTO FIBROBLASTS PATHOPHYSIOLOGICAL
More informationNeurobiological Bases of Abnormal Aggression and Violent Behaviour
Neurobiological Bases of Abnormal Aggression and Violent Behaviour . József Haller Neurobiological Bases of Abnormal Aggression and Violent Behaviour József Haller Department of Behavioral Neurobiology
More informationMechanisms of Gene Regulation and Signal! Transduction in Hypoxia!
Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance
More informationRadiation Therapy for Extranodal Lymphomas
Radiation Therapy for Extranodal Lymphomas Keisuke Sasai Masahiko Oguchi Editors Radiation Therapy for Extranodal Lymphomas Editors Keisuke Sasai Department of Radiation Oncology Juntendo University Faculty
More informationEsthetic and Functional Management of Diastema
Esthetic and Functional Management of Diastema Ugur Erdemir Esra Yildiz Editors Esthetic and Functional Management of Diastema A Multidisciplinary Approach Editors Ugur Erdemir Faculty of Dentistry University
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationLow and Lower Fertility
Low and Lower Fertility Ronald R. Rindfuss Minja Kim Choe Editors Low and Lower Fertility Variations across Developed Countries Editors Ronald R. Rindfuss Department of Sociology and Carolina Population
More informationPediatric Endodontics
Pediatric Endodontics Anna B. Fuks Benjamin Peretz Editors Pediatric Endodontics Current Concepts in Pulp Therapy for Primary and Young Permanent Teeth Editors Anna B. Fuks Department of Pediatric Dentistry
More informationDonald E. Wesson. Editor. Metabolic Acidosis. A Guide to Clinical Assessment and Management
Metabolic Acidosis Donald E. Wesson Editor Metabolic Acidosis A Guide to Clinical Assessment and Management Editor Donald E. Wesson, MD, MBA Baylor Scott and White Health Department of Internal Medicine
More informationNext Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders
Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders Lee-Jun C. Wong Editor Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders
More informationSocial Control of Sex Offenders
Social Control of Sex Offenders D. Richard Laws Social Control of Sex Offenders A Cultural History D. Richard Laws Pacific Behavioural Assessment Victoria, British Columbia, Canada ISBN 978-1-137-39125-4
More informationMorphological Aspects of Inner Ear Disease
Morphological Aspects of Inner Ear Disease Yasuya Nomura Morphological Aspects of Inner Ear Disease Yasuya Nomura President The Society for Promotion of International Oto-Rhino-Laryngology Tokyo, Japan
More informationMusculoskeletal Health in Women
Musculoskeletal Health in Women Elinor Mody Elizabeth Matzkin Editors Musculoskeletal Health in Women Editors Elinor Mody, MD Department of Rheumatology Gretchen and Edward Fish Center for Women s Health
More informationOsteoarthritic Knee Joint Painted by Artist: Mika Katsuta (Japan)
Osteoarthritis Osteoarthritic Knee Joint Painted by Artist: Mika Katsuta (Japan) Mohit Kapoor Nizar N. Mahomed Editors Osteoarthritis Pathogenesis, Diagnosis, Available Treatments, Drug Safety, Regenerative
More informationPharmaceutical Care Issues of Patients with Rheumatoid Arthritis
Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Louise Grech Alan Lau Editors Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis From Hospital to Community Editors Louise
More informationThe Role of Bacteria in Urology
The Role of Bacteria in Urology Dirk Lange Ben Chew Editors The Role of Bacteria in Urology Editors Dirk Lange Basic Science Research The Stone Centre at Vancouver General Hospital Vancouver British Columbia
More informationA Guide to Gastrointestinal Motility Disorders
A Guide to Gastrointestinal Motility Disorders Albert J. Bredenoord André Smout Jan Tack A Guide to Gastrointestinal Motility Disorders Albert J. Bredenoord Gastroenterology and Hepatology Academic Medical
More informationA New Approach to Cancer Therapy: The Tumor Microenvironment as Target
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2014 A New Approach to Cancer Therapy: The Tumor Microenvironment as Target
More informationOncolytic Virotherapy: Targeting Cancer Stem Cells
Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:
More informationThe Many Faces of Social Attention
The Many Faces of Social Attention Aina Puce Bennett I. Bertenthal Editors The Many Faces of Social Attention Behavioral and Neural Measures 1 3 Editors Aina Puce Psychological and Brain Sciences Indiana
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationAtlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs
Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Department of Anatomy Xuzhou Medical College Xuzhou Jiangsu
More informationRecurrent Erosion Syndrome and Epithelial Edema
Recurrent Erosion Syndrome and Epithelial Edema Helena M. Tabery Recurrent Erosion Syndrome and Epithelial Edema In Vivo Morphology in the Human Cornea Helena M. Tabery, MD Malmö Sweden helena.tabery@telia.com
More informationCytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
More informationQuestion 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationBases for Immunotherapy in Multiple Myeloma
Bases for Immunotherapy in Multiple Myeloma Paola Neri, MD, PhD Associate Professor of Medicine University of Calgary, Arnie Charbonneau Cancer Institute Disclosures Paola Neri MD, PhD Grants/research
More informationSurgical Techniques for Kidney Cancer
Surgical Techniques for Kidney Cancer Rakesh V. Khanna Gennady Bratslavsky Robert J. Stein Editors Surgical Techniques for Kidney Cancer 123 Editors Rakesh V. Khanna Department of Urology SUNY Upstate
More informationHealing & Repair. Tissue Regeneration
Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)
More informationDiseases of the Spinal Cord
Diseases of the Spinal Cord Elke Hattingen Stefan Weidauer Matthias Setzer Johannes C. Klein Frank Vrionis Editors Diseases of the Spinal Cord Novel Imaging, Diagnosis and Treatment Editors Elke Hattingen
More informationPolymyalgia Rheumatica and Giant Cell Arteritis
Polymyalgia Rheumatica and Giant Cell Arteritis Jozef Rovenský Burkhard Leeb Viera Štvrtinová Richard Imrich Editors Polymyalgia Rheumatica and Giant Cell Arteritis Third Edition Editors Josef Rovenský
More informationSpringerBriefs in Environmental Science
SpringerBriefs in Environmental Science More information about this series at http://www.springer.com/series/8868 Daniel Żarski Ákos Horváth Gergely Bernáth Sławomir Krejszeff János Radóczi Katarzyna Palińska-Żarska
More informationBL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
More informationAlexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov. Breast Ultrasound
Breast Ultrasound Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov Breast Ultrasound Alexander N. Sencha Department of Ultrasound Diagnostics Yaroslavl Railway Clinic Yaroslavl
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationSinus Headache, Migraine, and the Otolaryngologist
Sinus Headache, Migraine, and the Otolaryngologist Mark E. Mehle Editor Sinus Headache, Migraine, and the Otolaryngologist A Comprehensive Clinical Guide 123 Editor Mark E. Mehle Private Practice ENT and
More informationMyeloid-derived suppressor cell
JJIAO 30 4 : 271 278, 2012 Myeloid-derived suppressor cell 1 1 Myeloid-derived suppressor cells MDSC MDSC T MDSC MDSC MDSC MDSC MDSC myeloid-derived suppressor cells MDSC MDSC, myeloid-derived suppressor
More informationProcessing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis
Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis ii Colloquium Digital Library of Life Sciences This e-book is an original work
More informationEvidence-Based Forensic Dentistry
Evidence-Based Forensic Dentistry Balwant Rai Jasdeep Kaur Evidence-Based Forensic Dentistry Authors Balwant Rai Earth and Life Sciences Vrije Universiteit Amsterdam and ILEWG Amsterdam The Netherlands
More information