The Role of Microenvironment in the Control of Tumor Angiogenesis

Size: px
Start display at page:

Download "The Role of Microenvironment in the Control of Tumor Angiogenesis"

Transcription

1 The Role of Microenvironment in the Control of Tumor Angiogenesis

2

3 Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis

4 Domenico Ribatti Department of Basic Medical Sciences, Neurosciences and Sensory Organs University of Bari Medical School Bari, Italy National Cancer Institute Giovanni Paolo II Bari, Italy ISBN DOI / ISBN (ebook) Library of Congress Control Number: Springer International Publishing Switzerland 2016 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. Printed on acid-free paper This Springer imprint is published by SpringerNature The registered company is Springer International Publishing AG Switzerland

5 Acknowledgments This work was supported by European Union Seventh Framework Programme (FPT7/ ) under grant agreement n to DR. v

6

7 Contents 1 Tumor Microenvironment Metastatic Cascade Epithelial-Mesenchymal Transition The Extracellular Matrix Tumor Blood Vessels and Tumor Endothelial Cells Tumor Basement Membrane Tumor Pericytes Tumor Angiogenesis Sprouting Angiogenesis Vascular Co-option Vasculogenic Mimicry Intussusceptive Microvascular Growth Inflammatory Cells in Tumor Microenvironment Neutrophils Eosinophils and Dendritic Cells Lymphocytes and Platelets Mast Cells Macrophages Tie-2 Expressing Monocytes (TEMs) Fibroblasts Osteoblasts and Osteoclasts Cancer Stem Cells (CSCs) Circulating Endothelial Cells and Endothelial Precursor Cells Multipotent Adult Progenitor Cells (MAPCs) and Myeloid-Derived Suppressor Cells (MDSCs) vii

8 viii Contents 5 Therapeutic Strategies, the Concept of Normalization and the Role of VEGF Inhibition References Index... 85

9 List of Abbreviations ALDH1 Aldehyde dehydrogenase 1 AML Acute myeloid leukemia ANG-1 Angiopoietin-1 APL Acute promyelocytic leukemia A-SMA Alpha smooth actin ATRA All trans retinoic acid BM Bone marrow BMP Bone morphogenetic protein CAM Chorioallantoic membrane CCL5 Chemokine (C-C motif) ligand-5 COX-2 Cycloxygenase-2 CSC Cancer stem cell CSF Colony stimulating factor CSF-1R CSF-1 receptor CXCL Chemokine (C-X-C motif) ligand DLBCL Diffuse large B-cell lymphoma ECs Endothelial cells ECM Extracellular matrix EDG-1 Endothelial differentiation gene-1 EGF Epidermal growth factor EMT Epithelial mesenchymal transition enos Endothelial nitric oxide synthase EPCs Endothelial precursor or progenitor cells ESA Epidermal surface antigen FAP Fibroblast activating protein FDA Food and Drug Administration FGF-2 Fibroblast growth factor-2 FSP-1 Fibroblast specific protein-1 GCSF Granulocyte colony stimulating factor GFP Green fluorescent protein ix

10 x GIST GM-CSF GSC HCs HGF HIFs HPCs HPV HRG HSCs ICAM IFN IGF-1 IL IMG inos LT-CSC M-CSF mtor MAPCs MCP MDSCs MET MGUS MIP-2 MM MMP-9 MSCs MT1-MMP mtor NAID NECA NG2 NGF NK NOD-SCID NSAIDs NSCLS OPN PlGF-1 PA PAR PC PDGF PDGFR List of Abbreviations Gastrointestinal stroma tumors Granulocyte macrophage colony stimulating factor Glioblastoma stem-like cells Hematopoietic Cells Hepatocyte growth factor Hypoxia inducible factors Hematopoietic precursor cells Human papilloma virus Histidine-rich glycoprotein Hematopoietic stem cells Intercellular cellular adhesion molecule Interferon Insulin-like growth factor-1 Interleukin Intussusceptive microvascular growth Inducible nitric oxide synthase Long term CSC Macrophage-colony stimulating factor Mammalian target of rapamycin Multipotent adult progenitor cells Monocyte chemotactic protein Myeloid derived suppressor cells Mesenchymal epithelial transition Monoclonal gammopathy of undetermined significance Macrophage inflammatory protein-2 Multiple myeloma Matrix metalloproteinase-9 Mesenchymal stem cells Membrane type-1-mmp Mammalian target of rapamycin Nonsteroidal anti-inflammatory drugs N-methyl carboxamide adenosine Nerve/glial antigen-2 Nerve growth factor Natural killer Non obese diabetic/severe combined immunodeficiency Non-steroidal anti-inflammatory drugs Non small cell lung cancer Osteopontin Placental growth factor-1 Plasminogen activator Protease activated receptor Pericytes Platelet derived growth factor Platelet derived growth factor receptor

11 List of Abbreviations xi PGE2 Prostaglandin E2 PSMA Prostate specific membrane antigen PTX-3 Pantraxin-3 PyMT Polyoma middle-t RA Retinoic acid RNI Reactive nitrogen intermediate ROS Reactive oxygen species RTKIs Receptor tyrosine kinase inhibitors SCF Stem cell factor SDF-1 Stromal cell derived factor 1 ST-CSC Short term CSC TAF Tumor angiogenesis factor TAFs Tumor associated fibroblast TAM Tumor associated macrophages TEMs Tie2-expressing monocytes TGF-β Transforming growth factor beta TIMP-3 Tissue inhibitor of matrix metalloproteinase-3 TNF-α Tumor necrosis factor alpha TRAMP Transgenic adenocarcinoma of the mouse prostate Treg T regulatory TSP-1 Thrombospondin-1 VCAM Vascular cellular adhesion molecule VE-cadherin Vascular endothelia cadherin VEGF Vascular endothelial growth factor VEGFR1 Vascular endothelial growth factor receptor 1 VVO Vesciculo vacuolar organelles VWF Von Willebrand factor

Angiogenesis and Anti-Angiogenesis in Hematological Malignancies

Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Angiogenesis and Anti-Angiogenesis in Hematological Malignancies Domenico Ribatti Angiogenesis and Anti-Angiogenesis in Hematological Malignancies 1 3 Domenico Ribatti Department of Basic Medical Sciences

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

Current Therapy and Surgery for Urogenital Tuberculosis

Current Therapy and Surgery for Urogenital Tuberculosis Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Current Therapy and Surgery for Urogenital Tuberculosis Ekaterina Kulchavenya Research TB Institute Novosibirsk Medical University

More information

Practical Case Studies in Hypertension Management. Series editor Giuliano Tocci Rome, Italy

Practical Case Studies in Hypertension Management. Series editor Giuliano Tocci Rome, Italy Practical Case Studies in Hypertension Management Series editor Giuliano Tocci Rome, Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

Practical Case Studies in Hypertension Management. Series editor: Giuliano Tocci Rome Italy

Practical Case Studies in Hypertension Management. Series editor: Giuliano Tocci Rome Italy Practical Case Studies in Hypertension Management Series editor: Giuliano Tocci Rome Italy The aim of the book series Practical Case Studies in Hypertension Management is to provide physicians who treat

More information

Seeds and soil theory by Stephen Paget at the end of the XIX century.

Seeds and soil theory by Stephen Paget at the end of the XIX century. Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete

More information

Heterotypy and Angiogenesis

Heterotypy and Angiogenesis Heterotypy and Angiogenesis Tumors are perpetual wounds 1. Normally stroma and epithelia converse at a distance. 2. Juxtaposition of stroma and epithelia is indicative of tissue damage. 4. Activate strategies

More information

SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY. Gerhard Bauer Joseph S. Anderson. Gene Therapy for HIV From Inception to a Possible Cure

SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY. Gerhard Bauer Joseph S. Anderson. Gene Therapy for HIV From Inception to a Possible Cure SPRINGER BRIEFS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY Gerhard Bauer Joseph S. Anderson Gene Therapy for HIV From Inception to a Possible Cure 123 SpringerBriefs in Biochemistry and Molecular Biology For

More information

SpringerBriefs in Applied Sciences and Technology

SpringerBriefs in Applied Sciences and Technology SpringerBriefs in Applied Sciences and Technology Computational Intelligence Series Editor Janusz Kacprzyk, Systems Research Institute, Polish Academy of Sciences, Warsaw, Poland SpringerBriefs in Computational

More information

Louise Grech Alan Lau Editors. Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis. From Hospital to Community

Louise Grech Alan Lau Editors. Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis. From Hospital to Community Louise Grech Alan Lau Editors Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis From Hospital to Community Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Louise Grech

More information

Measures of Positive Psychology

Measures of Positive Psychology Measures of Positive Psychology Kamlesh Singh Mohita Junnarkar Jasleen Kaur Measures of Positive Psychology Development and Validation 123 Kamlesh Singh Department of Humanities and Social Sciences Indian

More information

Handbook of Insulin Therapies

Handbook of Insulin Therapies Handbook of Insulin Therapies Winston Crasto Janet Jarvis Melanie J. Davies Handbook of Insulin Therapies Winston Crasto George Eliot Hospital NHS Trust, Nuneaton United Kingdom Janet Jarvis Leicester

More information

Desmond P. Kidd. Neuro-Ophthalmology. Illustrated Case Studies

Desmond P. Kidd. Neuro-Ophthalmology. Illustrated Case Studies Neuro-Ophthalmology Desmond P. Kidd Neuro-Ophthalmology Illustrated Case Studies Desmond P. Kidd Department of Clinical Neurosciences Royal Free Hospital London UK ISBN 978-1-4471-2409-2 DOI 10.1007/978-1-4471-2410-8

More information

SpringerBriefs in Cancer Research

SpringerBriefs in Cancer Research SpringerBriefs in Cancer Research For further volumes: http://www.springer.com/series/10786 Natalia Aptsiauri Angel Miguel Garcia-Lora Teresa Cabrera MHC Class I Antigens In Malignant Cells Immune Escape

More information

Cell-Derived Inflammatory Mediators

Cell-Derived Inflammatory Mediators Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Medical and Surgical Complications of Sickle Cell Anemia

Medical and Surgical Complications of Sickle Cell Anemia Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Medical and Surgical Complications of Sickle Cell Anemia Ahmed Al-Salem Department of Surgery Dar A lalafia Medical Company Qatif

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Sami Shousha Editor. Breast Pathology. Problematic Issues

Sami Shousha Editor. Breast Pathology. Problematic Issues Breast Pathology Editor Breast Pathology Problematic Issues Editor Charing Cross Hospital Imperial College Healthcare NHS Trust & Imperial College London United Kingdom ISBN 978-3-319-28653-2 ISBN 978-3-319-28655-6

More information

In Clinical Practice

In Clinical Practice In Clinical Practice Taking a practical approach to clinical medicine, this series of smaller reference books is designed for the trainee physician, primary care physician, nurse practitioner and other

More information

Radiation Therapy for Gastrointestinal Cancers

Radiation Therapy for Gastrointestinal Cancers Radiation Therapy for Gastrointestinal Cancers Theodore Hong Prajnan Das Editors Radiation Therapy for Gastrointestinal Cancers Editors Theodore Hong Massachusetts General Hospital Harvard Medical School

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

Characterisation of bone marrow progenitor cells in disease

Characterisation of bone marrow progenitor cells in disease Characterisation of bone marrow progenitor cells in disease A thesis submitted for the degree of Doctor of Philosophy Imperial College London Leukocyte Biology Kate Hayley Christine Gowers 2012 ~ 1 ~ Acknowledgements

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

The Cleveland Clinic Manual of Dynamic Endocrine Testing

The Cleveland Clinic Manual of Dynamic Endocrine Testing The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin A. Laurence Kennedy Manjula K. Gupta Amir H. Hamrahian The Manual of Dynamic Endocrine Testing Ahmet Bahadir Ergin Department of Endocrinology,

More information

White Coat Hypertension

White Coat Hypertension White Coat Hypertension Giuseppe Mancia Guido Grassi Gianfranco Parati Alberto Zanchetti White Coat Hypertension An Unresolved Diagnostic and Therapeutic Problem Giuseppe Mancia Emeritus Professor University

More information

Inflammation and Lung Cancer

Inflammation and Lung Cancer Inflammation and Lung Cancer Steven M. Dubinett Editor Inflammation and Lung Cancer 1 3 Editor Steven M. Dubinett David Geffen School of Medicine at UCLA Los Angeles California USA ISBN 978-1-4939-2723-4

More information

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression

Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?

More information

Clinician s Manual on Restless Legs Syndrome

Clinician s Manual on Restless Legs Syndrome Clinician s Manual on Restless Legs Syndrome Mark J. Buchfuhrer Clinician s Manual on Restless Legs Syndrome Second Edition Mark J. Buchfuhrer PIH Health Hospital - Downey Downey, CA USA ISBN 978-3-319-31372-6

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Tissue renewal and Repair. Nisamanee Charoenchon, PhD   Department of Pathobiology, Faculty of Science Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration

More information

Therapeutic rtms in Neurology

Therapeutic rtms in Neurology Therapeutic rtms in Neurology Thomas Platz Editor Therapeutic rtms in Neurology Principles, Evidence, and Practice Recommendations Editor Thomas Platz BDH-Klinik Greifswald Ernst-Moritz-Arndt Universität

More information

Differential Diagnosis of Movement Disorders in Clinical Practice

Differential Diagnosis of Movement Disorders in Clinical Practice Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Peter Hedera Differential Diagnosis of Movement Disorders in Clinical Practice Abdul Qayyum Rana Parkinson's Clinic

More information

Tumor Microenvironment and Immune Suppression

Tumor Microenvironment and Immune Suppression Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation

More information

Congenital Hip Disease in Adults

Congenital Hip Disease in Adults Congenital Hip Disease in Adults George Hartofilakidis George C. Babis Kalliopi Lampropoulou-Adamidou Congenital Hip Disease in Adults George Hartofilakidis, MD, FACS Orthopaedic Department Medical School

More information

SpringerBriefs in Psychology. Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle

SpringerBriefs in Psychology. Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle SpringerBriefs in Psychology Series Editors Daniel David Raymond A. DiGiuseppe Kristene A. Doyle Epidemiological studies show that the prevalence of mental disorders is extremely high across the globe

More information

Epigenetic Advancements in Cancer

Epigenetic Advancements in Cancer Epigenetic Advancements in Cancer Manoj K. Mishra Kumar S. Bishnupuri Editors Epigenetic Advancements in Cancer Editors Manoj K. Mishra Department of Biological Sciences Alabama State University Montgomery,

More information

Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders

Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders Genetic Influences on Response to Drug Treatment for Major Psychiatric Disorders Janusz K. Rybakowski Alessandro Serretti Editors Genetic Influences on Response to Drug Treatment for Major Psychiatric

More information

Chromosomal Translocations and Genome Rearrangements in Cancer

Chromosomal Translocations and Genome Rearrangements in Cancer Chromosomal Translocations and Genome Rearrangements in Cancer Janet D. Rowley Michelle M. Le Beau Terence H. Rabbitts Editors Chromosomal Translocations and Genome Rearrangements in Cancer Editors Janet

More information

!!! Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014

!!! Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014 Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014 Department of Cancer Genetics Masashi Muramatsu, Ph.D. About Exam First, think and understand the concepts.

More information

Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication

Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Huang-Ge Zhang Editor Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication 2123 Editor Huang-Ge Zhang University of Louisville

More information

Tumor Associated Macrophages as a Novel Target for Cancer Therapy

Tumor Associated Macrophages as a Novel Target for Cancer Therapy Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations

More information

Advances in Experimental Medicine and Biology

Advances in Experimental Medicine and Biology Advances in Experimental Medicine and Biology Volume 938 Editorial Board IRUN R. COHEN, The Weizmann Institute of Science, Rehovot, Israel N.S. ABEL LAJTHA, Kline Institute for Psychiatric Research, Orangeburg,

More information

Editor Journal of Allergy and Therapy

Editor Journal of Allergy and Therapy Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the

More information

Contribution of Interstitial Valve Cells to Aortic Valve Calcification

Contribution of Interstitial Valve Cells to Aortic Valve Calcification UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,

More information

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.

CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins

More information

Wound Management in Urgent Care

Wound Management in Urgent Care Wound Management in Urgent Care Brittany Busse Wound Management in Urgent Care Brittany Busse, MD Med 7 Urgent Care Folsom, CA, USA ISBN 978-3-319-27426-3 DOI 10.1007/978-3-319-27428-7 ISBN 978-3-319-27428-7

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

Cognitive, Conative and Behavioral Neurology

Cognitive, Conative and Behavioral Neurology Cognitive, Conative and Behavioral Neurology Michael Hoffmann Cognitive, Conative and Behavioral Neurology An Evolutionary Perspective Michael Hoffmann MD, PhD Professor of Neurology Orlando VA Medical

More information

SpringerBriefs in Criminology

SpringerBriefs in Criminology SpringerBriefs in Criminology Policing Series editor M.R. Haberfeld City University of New York John Jay College of Criminal Justice New York, NY, USA More information about this series at http://www.springer.com/series/11179

More information

Mark W.J. Strachan Brian M. Frier. Insulin Therapy. A Pocket Guide

Mark W.J. Strachan Brian M. Frier. Insulin Therapy. A Pocket Guide Insulin Therapy Mark W.J. Strachan Brian M. Frier Insulin Therapy A Pocket Guide Mark W.J. Strachan, MD, FRCP (Ed) Metabolic Unit Western General Hospital Edinburgh United Kingdom Brian M. Frier, MD,

More information

Iatrogenic Effects of Orthodontic Treatment

Iatrogenic Effects of Orthodontic Treatment Iatrogenic Effects of Orthodontic Treatment Roberto Justus Iatrogenic Effects of Orthodontic Treatment Decision-Making in Prevention, Diagnosis, and Treatment Roberto Justus Department of Orthodontics

More information

Progress in Social Psychiatry in Japan

Progress in Social Psychiatry in Japan Progress in Social Psychiatry in Japan Yoshibumi Nakane Progress in Social Psychiatry in Japan An Approach to Psychiatric Epidemiology Yoshibumi Nakane Department of Neuropsychiatry Nagasaki University

More information

THE TUMOR MICROENVIRONMENT: INSIGHT INTO FIBROBLASTS PATHOPHYSIOLOGICAL FUNCTIONS

THE TUMOR MICROENVIRONMENT: INSIGHT INTO FIBROBLASTS PATHOPHYSIOLOGICAL FUNCTIONS DOTTORATO DI RICERCA IN SCIENZE BIOMEDICHE INDIRIZZO IN BIOCHIMICA E BIOLOGIA APPLICATA CICLO XXVI COORDINATORE Prof. Dello Sbarba Persio THE TUMOR MICROENVIRONMENT: INSIGHT INTO FIBROBLASTS PATHOPHYSIOLOGICAL

More information

Neurobiological Bases of Abnormal Aggression and Violent Behaviour

Neurobiological Bases of Abnormal Aggression and Violent Behaviour Neurobiological Bases of Abnormal Aggression and Violent Behaviour . József Haller Neurobiological Bases of Abnormal Aggression and Violent Behaviour József Haller Department of Behavioral Neurobiology

More information

Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia!

Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance

More information

Radiation Therapy for Extranodal Lymphomas

Radiation Therapy for Extranodal Lymphomas Radiation Therapy for Extranodal Lymphomas Keisuke Sasai Masahiko Oguchi Editors Radiation Therapy for Extranodal Lymphomas Editors Keisuke Sasai Department of Radiation Oncology Juntendo University Faculty

More information

Esthetic and Functional Management of Diastema

Esthetic and Functional Management of Diastema Esthetic and Functional Management of Diastema Ugur Erdemir Esra Yildiz Editors Esthetic and Functional Management of Diastema A Multidisciplinary Approach Editors Ugur Erdemir Faculty of Dentistry University

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

Low and Lower Fertility

Low and Lower Fertility Low and Lower Fertility Ronald R. Rindfuss Minja Kim Choe Editors Low and Lower Fertility Variations across Developed Countries Editors Ronald R. Rindfuss Department of Sociology and Carolina Population

More information

Pediatric Endodontics

Pediatric Endodontics Pediatric Endodontics Anna B. Fuks Benjamin Peretz Editors Pediatric Endodontics Current Concepts in Pulp Therapy for Primary and Young Permanent Teeth Editors Anna B. Fuks Department of Pediatric Dentistry

More information

Donald E. Wesson. Editor. Metabolic Acidosis. A Guide to Clinical Assessment and Management

Donald E. Wesson. Editor. Metabolic Acidosis. A Guide to Clinical Assessment and Management Metabolic Acidosis Donald E. Wesson Editor Metabolic Acidosis A Guide to Clinical Assessment and Management Editor Donald E. Wesson, MD, MBA Baylor Scott and White Health Department of Internal Medicine

More information

Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders

Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders Lee-Jun C. Wong Editor Next Generation Sequencing Based Clinical Molecular Diagnosis of Human Genetic Disorders

More information

Social Control of Sex Offenders

Social Control of Sex Offenders Social Control of Sex Offenders D. Richard Laws Social Control of Sex Offenders A Cultural History D. Richard Laws Pacific Behavioural Assessment Victoria, British Columbia, Canada ISBN 978-1-137-39125-4

More information

Morphological Aspects of Inner Ear Disease

Morphological Aspects of Inner Ear Disease Morphological Aspects of Inner Ear Disease Yasuya Nomura Morphological Aspects of Inner Ear Disease Yasuya Nomura President The Society for Promotion of International Oto-Rhino-Laryngology Tokyo, Japan

More information

Musculoskeletal Health in Women

Musculoskeletal Health in Women Musculoskeletal Health in Women Elinor Mody Elizabeth Matzkin Editors Musculoskeletal Health in Women Editors Elinor Mody, MD Department of Rheumatology Gretchen and Edward Fish Center for Women s Health

More information

Osteoarthritic Knee Joint Painted by Artist: Mika Katsuta (Japan)

Osteoarthritic Knee Joint Painted by Artist: Mika Katsuta (Japan) Osteoarthritis Osteoarthritic Knee Joint Painted by Artist: Mika Katsuta (Japan) Mohit Kapoor Nizar N. Mahomed Editors Osteoarthritis Pathogenesis, Diagnosis, Available Treatments, Drug Safety, Regenerative

More information

Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis

Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis Louise Grech Alan Lau Editors Pharmaceutical Care Issues of Patients with Rheumatoid Arthritis From Hospital to Community Editors Louise

More information

The Role of Bacteria in Urology

The Role of Bacteria in Urology The Role of Bacteria in Urology Dirk Lange Ben Chew Editors The Role of Bacteria in Urology Editors Dirk Lange Basic Science Research The Stone Centre at Vancouver General Hospital Vancouver British Columbia

More information

A Guide to Gastrointestinal Motility Disorders

A Guide to Gastrointestinal Motility Disorders A Guide to Gastrointestinal Motility Disorders Albert J. Bredenoord André Smout Jan Tack A Guide to Gastrointestinal Motility Disorders Albert J. Bredenoord Gastroenterology and Hepatology Academic Medical

More information

A New Approach to Cancer Therapy: The Tumor Microenvironment as Target

A New Approach to Cancer Therapy: The Tumor Microenvironment as Target Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2014 A New Approach to Cancer Therapy: The Tumor Microenvironment as Target

More information

Oncolytic Virotherapy: Targeting Cancer Stem Cells

Oncolytic Virotherapy: Targeting Cancer Stem Cells Oncolytic Virotherapy: Targeting Cancer Stem Cells Cancer Stem Cells (CSCs) or Cancer Initiating Cells (CICs) A consensus of five defining criteria has been established to affirm the existence of CICs:

More information

The Many Faces of Social Attention

The Many Faces of Social Attention The Many Faces of Social Attention Aina Puce Bennett I. Bertenthal Editors The Many Faces of Social Attention Behavioral and Neural Measures 1 3 Editors Aina Puce Psychological and Brain Sciences Indiana

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs

Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Atlas of Lymphatic Anatomy in the Head, Neck, Chest and Limbs Wei-Ren Pan Department of Anatomy Xuzhou Medical College Xuzhou Jiangsu

More information

Recurrent Erosion Syndrome and Epithelial Edema

Recurrent Erosion Syndrome and Epithelial Edema Recurrent Erosion Syndrome and Epithelial Edema Helena M. Tabery Recurrent Erosion Syndrome and Epithelial Edema In Vivo Morphology in the Human Cornea Helena M. Tabery, MD Malmö Sweden helena.tabery@telia.com

More information

Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,

Cytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins, Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under

More information

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Bases for Immunotherapy in Multiple Myeloma

Bases for Immunotherapy in Multiple Myeloma Bases for Immunotherapy in Multiple Myeloma Paola Neri, MD, PhD Associate Professor of Medicine University of Calgary, Arnie Charbonneau Cancer Institute Disclosures Paola Neri MD, PhD Grants/research

More information

Surgical Techniques for Kidney Cancer

Surgical Techniques for Kidney Cancer Surgical Techniques for Kidney Cancer Rakesh V. Khanna Gennady Bratslavsky Robert J. Stein Editors Surgical Techniques for Kidney Cancer 123 Editors Rakesh V. Khanna Department of Urology SUNY Upstate

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

Diseases of the Spinal Cord

Diseases of the Spinal Cord Diseases of the Spinal Cord Elke Hattingen Stefan Weidauer Matthias Setzer Johannes C. Klein Frank Vrionis Editors Diseases of the Spinal Cord Novel Imaging, Diagnosis and Treatment Editors Elke Hattingen

More information

Polymyalgia Rheumatica and Giant Cell Arteritis

Polymyalgia Rheumatica and Giant Cell Arteritis Polymyalgia Rheumatica and Giant Cell Arteritis Jozef Rovenský Burkhard Leeb Viera Štvrtinová Richard Imrich Editors Polymyalgia Rheumatica and Giant Cell Arteritis Third Edition Editors Josef Rovenský

More information

SpringerBriefs in Environmental Science

SpringerBriefs in Environmental Science SpringerBriefs in Environmental Science More information about this series at http://www.springer.com/series/8868 Daniel Żarski Ákos Horváth Gergely Bernáth Sławomir Krejszeff János Radóczi Katarzyna Palińska-Żarska

More information

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.

BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr. BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:

More information

Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov. Breast Ultrasound

Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov. Breast Ultrasound Breast Ultrasound Alexander N. Sencha Elena V. Evseeva Mikhail S. Mogutov Yury N. Patrunov Breast Ultrasound Alexander N. Sencha Department of Ultrasound Diagnostics Yaroslavl Railway Clinic Yaroslavl

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

Sinus Headache, Migraine, and the Otolaryngologist

Sinus Headache, Migraine, and the Otolaryngologist Sinus Headache, Migraine, and the Otolaryngologist Mark E. Mehle Editor Sinus Headache, Migraine, and the Otolaryngologist A Comprehensive Clinical Guide 123 Editor Mark E. Mehle Private Practice ENT and

More information

Myeloid-derived suppressor cell

Myeloid-derived suppressor cell JJIAO 30 4 : 271 278, 2012 Myeloid-derived suppressor cell 1 1 Myeloid-derived suppressor cells MDSC MDSC T MDSC MDSC MDSC MDSC MDSC myeloid-derived suppressor cells MDSC MDSC, myeloid-derived suppressor

More information

Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis

Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis Processing of VEGF-C and -D by the Proprotein Convertases: Importance in Angiogenesis, Lymphangiogenesis, and Tumorigenesis ii Colloquium Digital Library of Life Sciences This e-book is an original work

More information

Evidence-Based Forensic Dentistry

Evidence-Based Forensic Dentistry Evidence-Based Forensic Dentistry Balwant Rai Jasdeep Kaur Evidence-Based Forensic Dentistry Authors Balwant Rai Earth and Life Sciences Vrije Universiteit Amsterdam and ILEWG Amsterdam The Netherlands

More information