Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
|
|
- Cecil Summers
- 5 years ago
- Views:
Transcription
1 Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm Time, h
2 Figure S2. Specific target down-modulation by HER3 (EZN-392) and β-catenin (EZN-3889 and EZN-3892) LNA-ONs in SW48 cells. A B 16 3 μm 14 1 μm μm 12 1 μm β-catenin mrna, %Control HER3 mrna, %Control 2 2 Untreated EZN-392 EZN-3889 Untreated EZN-3889 EZN-392
3 Figure S3. In vitro cell uptake of FAM-conjugated EZN PC3 SK-BR3 A min 5 min 1 h 24 h e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e HCC LNCap Rv e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4
4 Figure S4. Nuclear localization of FAM-EZN-392 in HCC827 but not DLD-1 cells A HCC827 with 5 μm FAM-392 DLD-1 with 5 μm FAM-392 B 12 C 14 HER R3 mrna, %Con ntrol HER R3 mrna, %Con ntrol EZN-392, μm EZN-392, μm
5 Figure S5. FAM-EZN-392 was stable in 15PC3 cell culture FAM EZ ZN 392 in culture medium, RLU With cells Without cells %Contro ol Time, hour [FAM EZN 392], μm FAM EZN 392 With cells Without cells (μm) A B Average ratio A B Average ratio
6 Figure S6. EZN-3889 specifically down-modulated β-catenin in 15PC3 cells β-catenin HER3 β-tubulin
7 Figure S7. LNA-ASO failed to inhibit synthesis of HER3-Lumio in an in vitro transcription and translation assay A 7 RFU 6 5 Control EZN-415,.1 μm EZN-392,.1 μm HER3-Lumio, C Time, min HER3-Lumio HER3-Lumio
8 Figure S8. Down-modulation of mrna in liver and tumors at different time points after one bolus dose HE ER3 mrna, %Control Liver Tumor Time, Day
9 Table S1. Relative sensitivity of cells to LNA treatment in mrna down-modulation Cell Lines Tumor Type Knockdown Efficiency UMUC-3 Bladder ++++ BT-474 Breast ++ JIMT Breast +++ T47D Breast +++ MDA-MB-361 Breast +++ MDA-MB-453 MB Breast ++++ SKBR3 Breast HCT-116 Colorectal ++ DLD-1 Colorectal ++ SW48 Colorectal +++ H18 Fibrosarcoma U87MG Glioma ++++ Huh-7 Hepatoma + A549 Lung ++ H46 Lung ++ H1975 Lung ++ H1581 Lung ++++ A427 Lung ++++ Calu-6 Lung HCC827 Lung HCC827R Lung A2 Melanoma +++ BxPC3 Pancreatic RV1 Prostate + DU-145 Prostate ++ PC3 Prostate +++ LNCaP Prostate PC3 Prostate % mrna down-modulation at 5 μm within 72 hrs , 8, < 1; ++++, 6, < 8; +++, 4, < 6; ++, 2, < 4; +,, < 2.
10 Figure S1. Time-dependent down-modulation of HER3 by EZN PC3 (plated at approximately 5,/cm 2 ) were treated with 2 μm of EZN-392 and measured for HER3 mrna levels at different time points as indicated. A corresponding control (Saline) was included for each time point. Data are shown as means ± SE (n = 3). Figure S2. Specific target down-modulation of HER3 (EZN-392) and β-catenin (EZN- 3889) LNA-ONs in SW48 colorectal cancer cells. LNA-ONs were added to tissue culture media at the indicated concentrations and incubated with SW48 cells (plated at approximately 2/cm 2 ). Down-modulation of β-catenin (A) or HER3 (B) mrna after treatment for 6 days was determined by RT-qPCR with TaqMan gene expression assay. Data are shown as mean ± SD of duplicates. Figure S3. In vitro cell uptake of FAM-conjugated EZN-392. Cells cultured (plated at approximately 5,/cm 2 ) in multi-well plates were treated with 4 μm FAM-EZN-392 for designated time. The cultured cells were washed, trypsinized, and re-suspended in medium, and then analyzed using Guava EasyCyte instrument with the Expression Plus module. Figure S4. Nuclear localization of LNA-ONs correlated with mrna down-modulation. (A) HCC827 and DLD-1 cells (plated at approximately 2,/cm 2 )were treated with 5 -FAM-EZN- 392 for 24 h and examined under the microscope for FAM and Hoechst signals (as described in Methods). From left to right: FAM, superimposed FAM and Hoechst, Normarski Differential Interference Contrast (B) HCC827 (left) and DLD-1 (right) were treated with different concentrations of EZN-392 and HER3 mrna levels determined after 24 h. Figure S5. FAM-EZN-392 was stable in 15PC3 cell culture. 15PC3 cells were plated at /well in 6-well plates and maintained in a 37 C incubator for 24 h. FAM-EZN-392 was added to the 2 ml culture to form final concentrations of 1, 5 and 1 μm. At the indicated time points, medium was collected into Eppendorf tubes and centrifuged. Ten μl of supernatant were injected to an HPLC equipped with a UV detector to determine the relative amount of FAM- EZN-392 (blue line). A parallel experiment also was conducted in 6-well plates without cells to show linearity of the signal in proportion to the input amount of FAM-EZN-392 (red line). The study was performed in duplicate. The relative amount of compound and ratios in one μm input are shown in the table. The insert shows the stability of FAM-EZN-392 in culture medium over 24 h. Figure S6. EZN-3889 specifically down-modulated β-catenin in SW48 cells. SW48 cells (plated at approximately 2,/cm 2 ) were treated with 3 or 5 μm EZN-3889 and analyzed for β- catenin and HER3 protein levels by immunoblotting on day 5. Figure S7. LNA-ON failed to inhibit protein synthesis through steric blocking. The Expressway Lumio Cell-Free Expression System (Invitrogen) was used for in vitro protein synthesis. The gene segment encoding partial human HER3 (amino acid residues 2-814) was cloned from 15PC3 cell by RT-PCR and inserted into the vector pexp3-dest. The resulting expression vector is predicted to direct synthesis of N-terminal lumio tagged HER3 223 amino acid residues in the cell-free expression system (Invitrogen). In vitro transcription and translation was conducted based on the manufacturer-recommended conditions. Briefly, the reaction solution (5 μl) contained the following components: 2 μl Escherichia coli slyd extract, 2.5 μl
11 reaction mix, 3 μl amino acids solution, 2 μl methionine solution, 1 μl T7 enzyme mix and 1 μg of circular DNA template, 1 μl Lumio green detection reagent, and nuclease-free water with or without.1 μm EZN-392 or EZN-415. The reaction was conducted at 37 C for 1-2 h in a Gemini XS spectrofluorometer (Molecular Devices), where the amount of lumio-tag synthesized was monitored real-time (Ex = 5 nm, Em = 535 nm)(a). The fusion protein product was recovered by cold acetone and analyzed by SDS-PAGE (B). Figure S8. Down-modulation of mrna in liver and tumors at different time points after one bolus dose. Tumor-bearing mice were dosed on day with 1 mg/kg EZN-392. Liver and tumors were harvested on day1, 2, 4, and 7. Total RNA was extract from liver and tumor tissues and HER3 mrna levels determined by real-time PCR. TaqMan gene expression assays specific for mouse and human HER3 were used for liver and tumor samples, respectively.
Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System
Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSpecies Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-2 Mouse urinary bladder carcinoma C57BL/6 2
America, Hershey, PA Australia, Melbourne, VIC Europe, Munich info@vivopharm.com www.vivopharm.com Tissue Bladder Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationAmerica, Hershey, PA Australia, Melbourne, VIC Europe, Munich
America, Hershey, PA Australia, Melbourne, VIC Europe, Munich info@vivopharm.com www.vivopharm.com Bladder MB-9-luc 2 Mouse urinary bladder carcinoma yes yes yes C57BL/6 2 Bone UMR-106 Rat osteosarcoma
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationCANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationFigure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
More informationGalactose Assay Kit. Catalog Number KA assays Version: 04. Intended for research use only.
Galactose Assay Kit Catalog Number KA1669 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationSupplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures
Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/12/e1601756/dc1 Supplementary Materials for Syrosingopine sensitizes cancer cells to killing by metformin Don Benjamin, Marco Colombi, Sravanth K. Hindupur, Charles
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4
INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationInhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationMolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.
Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com
More informationThe mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationAntitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationLipoprotein Lipase Activity Assay Kit (Fluorometric)
Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
More informationA protocol for enhancement of the AAV-mediated expression of transgenes
A protocol for enhancement of the AAV-mediated expression of transgenes Hiroaki Mizukami, Takeharu Kanazawa, Takashi Okada, and Keiya Ozawa Division of Genetic Therapeutics, Center for Molecular Medicine,
More informationAnnexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationPhospholipid Assay Kit
Phospholipid Assay Kit Catalog Number KA1635 100 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationProduct Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..
INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationAscorbic Acid Assay Kit
Ascorbic Acid Assay Kit Catalog Number KA1660 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3 General
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSingle Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationPhospholipid Assay Kit
Phospholipid Assay Kit Catalog Number KA1635 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationLipid Droplets Fluorescence Assay Kit
Lipid Droplets Fluorescence Assay Kit Item No. 500001 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationab SREBP-2 Translocation Assay Kit (Cell-Based)
ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic
More informationPinpoint Slide RNA Isolation System II Catalog No. R1007
INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationFigure S1. Figure S2. Figure S3.
Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)
More informationTotal Histone H3 Acetylation Detection Fast Kit (Colorimetric)
Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationBy: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
More informationRayBio Protein Carbonyl Content Assay Kit
RayBio Protein Carbonyl Content Assay Kit User Manual Version 1.0 Mar 25, 2013 RayBio Protein Carbonyl Content Assay (Cat#: 68CT-PrCarb-S100) RayBiotech, Inc. We Provide You With Excellent Support And
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSupplementary Figure 1
Supplementary Figure 1 A B HEC1A PTEN +/+ HEC1A PTEN -/- 16 HEC1A PTEN -/- 22 PTEN RAD51 % Cells with RAD51 foci 40 -IR +IR 30 20 10 * *! TUBULIN 0 HEC1A PTEN+/+ HEC1A PTEN-/- 16 HEC1A PTEN-/- 22 C D 1.0
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationEpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)
More informationEPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)
More informationSupplemental Methods LC-MS Assay for NAD Concentration
Supplemental Methods LC-MS Assay for NAD Concentration The concentration of NAD in cells was determined by a non-validated liquid chromatography tandem mass spectrometry (LC-MS/MS) assay using 13 C 5 -NAD
More information~Lentivirus production~
~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationMulti-Parameter Apoptosis Assay Kit
Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationSolid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma
Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationMidi Plant Genomic DNA Purification Kit
Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationFluorescence Microscopy
Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized
More informationComparative study of multicellular tumor spheroid formation methods and implications for drug screening
Supporting Information Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Maria F. Gencoglu, Lauren E. Barney, Christopher L. Hall, Elizabeth A. Brooks,
More informationSupplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer
Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,
More informationD-Mannitol Assay Kit (Colorimetric)
D-Mannitol Assay Kit (Colorimetric) Catalog Number KA3760 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationFree Fatty Acid Assay Kit
Free Fatty Acid Assay Kit Catalog Number KA1667 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationSupplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
More informationWork-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:
Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample
More informationRayBio Phenylalanine Fluorometric Assay Kit
RayBio Phenylalanine Fluorometric Assay Kit User Manual Version 1.0 June 25, 2014 RayBio Phenylalanine Fluorometric (Cat#: 68-Phenyl-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service
More informationLavaCell. Fluorescent Cell Stain. (version A) Catalog No
LavaCell Fluorescent Cell Stain (version A) Catalog No. 15004 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263
More informationEXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids
DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationMonitoring intracellular activity of Arylsulfatase B on its natural substrates in a functional bioassay using LIF-CZE
Monitoring intracellular activity of Arylsulfatase B on its natural substrates in a functional bioassay using LIF-CZE Erno Pungor Jr; Charles M. Hague; Ginger Chen; Jeffrey F. Lemontt; William S. Prince
More informationSupplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.
Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan
More informationProtocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More information