Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Size: px
Start display at page:

Download "Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h"

Transcription

1 Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm Time, h

2 Figure S2. Specific target down-modulation by HER3 (EZN-392) and β-catenin (EZN-3889 and EZN-3892) LNA-ONs in SW48 cells. A B 16 3 μm 14 1 μm μm 12 1 μm β-catenin mrna, %Control HER3 mrna, %Control 2 2 Untreated EZN-392 EZN-3889 Untreated EZN-3889 EZN-392

3 Figure S3. In vitro cell uptake of FAM-conjugated EZN PC3 SK-BR3 A min 5 min 1 h 24 h e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e HCC LNCap Rv e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4 1e 1e1 1e2 1e3 1e4

4 Figure S4. Nuclear localization of FAM-EZN-392 in HCC827 but not DLD-1 cells A HCC827 with 5 μm FAM-392 DLD-1 with 5 μm FAM-392 B 12 C 14 HER R3 mrna, %Con ntrol HER R3 mrna, %Con ntrol EZN-392, μm EZN-392, μm

5 Figure S5. FAM-EZN-392 was stable in 15PC3 cell culture FAM EZ ZN 392 in culture medium, RLU With cells Without cells %Contro ol Time, hour [FAM EZN 392], μm FAM EZN 392 With cells Without cells (μm) A B Average ratio A B Average ratio

6 Figure S6. EZN-3889 specifically down-modulated β-catenin in 15PC3 cells β-catenin HER3 β-tubulin

7 Figure S7. LNA-ASO failed to inhibit synthesis of HER3-Lumio in an in vitro transcription and translation assay A 7 RFU 6 5 Control EZN-415,.1 μm EZN-392,.1 μm HER3-Lumio, C Time, min HER3-Lumio HER3-Lumio

8 Figure S8. Down-modulation of mrna in liver and tumors at different time points after one bolus dose HE ER3 mrna, %Control Liver Tumor Time, Day

9 Table S1. Relative sensitivity of cells to LNA treatment in mrna down-modulation Cell Lines Tumor Type Knockdown Efficiency UMUC-3 Bladder ++++ BT-474 Breast ++ JIMT Breast +++ T47D Breast +++ MDA-MB-361 Breast +++ MDA-MB-453 MB Breast ++++ SKBR3 Breast HCT-116 Colorectal ++ DLD-1 Colorectal ++ SW48 Colorectal +++ H18 Fibrosarcoma U87MG Glioma ++++ Huh-7 Hepatoma + A549 Lung ++ H46 Lung ++ H1975 Lung ++ H1581 Lung ++++ A427 Lung ++++ Calu-6 Lung HCC827 Lung HCC827R Lung A2 Melanoma +++ BxPC3 Pancreatic RV1 Prostate + DU-145 Prostate ++ PC3 Prostate +++ LNCaP Prostate PC3 Prostate % mrna down-modulation at 5 μm within 72 hrs , 8, < 1; ++++, 6, < 8; +++, 4, < 6; ++, 2, < 4; +,, < 2.

10 Figure S1. Time-dependent down-modulation of HER3 by EZN PC3 (plated at approximately 5,/cm 2 ) were treated with 2 μm of EZN-392 and measured for HER3 mrna levels at different time points as indicated. A corresponding control (Saline) was included for each time point. Data are shown as means ± SE (n = 3). Figure S2. Specific target down-modulation of HER3 (EZN-392) and β-catenin (EZN- 3889) LNA-ONs in SW48 colorectal cancer cells. LNA-ONs were added to tissue culture media at the indicated concentrations and incubated with SW48 cells (plated at approximately 2/cm 2 ). Down-modulation of β-catenin (A) or HER3 (B) mrna after treatment for 6 days was determined by RT-qPCR with TaqMan gene expression assay. Data are shown as mean ± SD of duplicates. Figure S3. In vitro cell uptake of FAM-conjugated EZN-392. Cells cultured (plated at approximately 5,/cm 2 ) in multi-well plates were treated with 4 μm FAM-EZN-392 for designated time. The cultured cells were washed, trypsinized, and re-suspended in medium, and then analyzed using Guava EasyCyte instrument with the Expression Plus module. Figure S4. Nuclear localization of LNA-ONs correlated with mrna down-modulation. (A) HCC827 and DLD-1 cells (plated at approximately 2,/cm 2 )were treated with 5 -FAM-EZN- 392 for 24 h and examined under the microscope for FAM and Hoechst signals (as described in Methods). From left to right: FAM, superimposed FAM and Hoechst, Normarski Differential Interference Contrast (B) HCC827 (left) and DLD-1 (right) were treated with different concentrations of EZN-392 and HER3 mrna levels determined after 24 h. Figure S5. FAM-EZN-392 was stable in 15PC3 cell culture. 15PC3 cells were plated at /well in 6-well plates and maintained in a 37 C incubator for 24 h. FAM-EZN-392 was added to the 2 ml culture to form final concentrations of 1, 5 and 1 μm. At the indicated time points, medium was collected into Eppendorf tubes and centrifuged. Ten μl of supernatant were injected to an HPLC equipped with a UV detector to determine the relative amount of FAM- EZN-392 (blue line). A parallel experiment also was conducted in 6-well plates without cells to show linearity of the signal in proportion to the input amount of FAM-EZN-392 (red line). The study was performed in duplicate. The relative amount of compound and ratios in one μm input are shown in the table. The insert shows the stability of FAM-EZN-392 in culture medium over 24 h. Figure S6. EZN-3889 specifically down-modulated β-catenin in SW48 cells. SW48 cells (plated at approximately 2,/cm 2 ) were treated with 3 or 5 μm EZN-3889 and analyzed for β- catenin and HER3 protein levels by immunoblotting on day 5. Figure S7. LNA-ON failed to inhibit protein synthesis through steric blocking. The Expressway Lumio Cell-Free Expression System (Invitrogen) was used for in vitro protein synthesis. The gene segment encoding partial human HER3 (amino acid residues 2-814) was cloned from 15PC3 cell by RT-PCR and inserted into the vector pexp3-dest. The resulting expression vector is predicted to direct synthesis of N-terminal lumio tagged HER3 223 amino acid residues in the cell-free expression system (Invitrogen). In vitro transcription and translation was conducted based on the manufacturer-recommended conditions. Briefly, the reaction solution (5 μl) contained the following components: 2 μl Escherichia coli slyd extract, 2.5 μl

11 reaction mix, 3 μl amino acids solution, 2 μl methionine solution, 1 μl T7 enzyme mix and 1 μg of circular DNA template, 1 μl Lumio green detection reagent, and nuclease-free water with or without.1 μm EZN-392 or EZN-415. The reaction was conducted at 37 C for 1-2 h in a Gemini XS spectrofluorometer (Molecular Devices), where the amount of lumio-tag synthesized was monitored real-time (Ex = 5 nm, Em = 535 nm)(a). The fusion protein product was recovered by cold acetone and analyzed by SDS-PAGE (B). Figure S8. Down-modulation of mrna in liver and tumors at different time points after one bolus dose. Tumor-bearing mice were dosed on day with 1 mg/kg EZN-392. Liver and tumors were harvested on day1, 2, 4, and 7. Total RNA was extract from liver and tumor tissues and HER3 mrna levels determined by real-time PCR. TaqMan gene expression assays specific for mouse and human HER3 were used for liver and tumor samples, respectively.

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-2 Mouse urinary bladder carcinoma C57BL/6 2

Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-2 Mouse urinary bladder carcinoma C57BL/6 2 America, Hershey, PA Australia, Melbourne, VIC Europe, Munich info@vivopharm.com www.vivopharm.com Tissue Bladder Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

America, Hershey, PA Australia, Melbourne, VIC Europe, Munich

America, Hershey, PA Australia, Melbourne, VIC Europe, Munich America, Hershey, PA Australia, Melbourne, VIC Europe, Munich info@vivopharm.com www.vivopharm.com Bladder MB-9-luc 2 Mouse urinary bladder carcinoma yes yes yes C57BL/6 2 Bone UMR-106 Rat osteosarcoma

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

Galactose Assay Kit. Catalog Number KA assays Version: 04. Intended for research use only.

Galactose Assay Kit. Catalog Number KA assays Version: 04. Intended for research use only. Galactose Assay Kit Catalog Number KA1669 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures

Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/12/e1601756/dc1 Supplementary Materials for Syrosingopine sensitizes cancer cells to killing by metformin Don Benjamin, Marco Colombi, Sravanth K. Hindupur, Charles

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of

Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us.

MolecularMD. One-Step qrt-pcr BCR-ABL Kit. Product Description and User Manual. For Quantitative RT-PCR Analysis of BCR-ABL. Contact Us. Contact Us If you have any questions for or comments about MolecularMD, please feel free to contact us. Email Customer Service CustomerService@MolecularMD.com Technical Support TechSupport@MolecularMD.com

More information

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models

Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics

More information

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA. Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial

More information

A protocol for enhancement of the AAV-mediated expression of transgenes

A protocol for enhancement of the AAV-mediated expression of transgenes A protocol for enhancement of the AAV-mediated expression of transgenes Hiroaki Mizukami, Takeharu Kanazawa, Takashi Okada, and Keiya Ozawa Division of Genetic Therapeutics, Center for Molecular Medicine,

More information

Annexin V-PE Apoptosis Detection Kit

Annexin V-PE Apoptosis Detection Kit Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Phospholipid Assay Kit

Phospholipid Assay Kit Phospholipid Assay Kit Catalog Number KA1635 100 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products.. INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

supplementary information

supplementary information Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated

More information

Ascorbic Acid Assay Kit

Ascorbic Acid Assay Kit Ascorbic Acid Assay Kit Catalog Number KA1660 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Principle of the Assay... 3 General

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Phospholipid Assay Kit

Phospholipid Assay Kit Phospholipid Assay Kit Catalog Number KA1635 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Lipid Droplets Fluorescence Assay Kit

Lipid Droplets Fluorescence Assay Kit Lipid Droplets Fluorescence Assay Kit Item No. 500001 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

ab SREBP-2 Translocation Assay Kit (Cell-Based)

ab SREBP-2 Translocation Assay Kit (Cell-Based) ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic

More information

Pinpoint Slide RNA Isolation System II Catalog No. R1007

Pinpoint Slide RNA Isolation System II Catalog No. R1007 INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

Figure S1. Figure S2. Figure S3.

Figure S1. Figure S2. Figure S3. Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-)

More information

Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Catalog Number KA1538 48 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use...

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

By: Dr Mehrnoosh Shanaki

By: Dr Mehrnoosh Shanaki Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki

More information

RayBio Protein Carbonyl Content Assay Kit

RayBio Protein Carbonyl Content Assay Kit RayBio Protein Carbonyl Content Assay Kit User Manual Version 1.0 Mar 25, 2013 RayBio Protein Carbonyl Content Assay (Cat#: 68CT-PrCarb-S100) RayBiotech, Inc. We Provide You With Excellent Support And

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B HEC1A PTEN +/+ HEC1A PTEN -/- 16 HEC1A PTEN -/- 22 PTEN RAD51 % Cells with RAD51 foci 40 -IR +IR 30 20 10 * *! TUBULIN 0 HEC1A PTEN+/+ HEC1A PTEN-/- 16 HEC1A PTEN-/- 22 C D 1.0

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

More information

EPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric) Base Catalog # P-4059 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Global Acetyl Histone H3K27 Quantification Kit (Colorimetric)

More information

Supplemental Methods LC-MS Assay for NAD Concentration

Supplemental Methods LC-MS Assay for NAD Concentration Supplemental Methods LC-MS Assay for NAD Concentration The concentration of NAD in cells was determined by a non-validated liquid chromatography tandem mass spectrometry (LC-MS/MS) assay using 13 C 5 -NAD

More information

~Lentivirus production~

~Lentivirus production~ ~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Multi-Parameter Apoptosis Assay Kit

Multi-Parameter Apoptosis Assay Kit Multi-Parameter Apoptosis Assay Kit Catalog Number KA1335 5 x 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma

Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Midi Plant Genomic DNA Purification Kit

Midi Plant Genomic DNA Purification Kit Midi Plant Genomic DNA Purification Kit Cat #:DP022MD/ DP022MD-50 Size:10/50 reactions Store at RT For research use only 1 Description: The Midi Plant Genomic DNA Purification Kit provides a rapid, simple

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Fluorescence Microscopy

Fluorescence Microscopy Fluorescence Microscopy Imaging Organelles Mitochondria Lysosomes Nuclei Endoplasmic Reticulum Plasma Membrane F-Actin AAT Bioquest Introduction: Organelle-Selective Stains Organelles are tiny, specialized

More information

Comparative study of multicellular tumor spheroid formation methods and implications for drug screening

Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Supporting Information Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Maria F. Gencoglu, Lauren E. Barney, Christopher L. Hall, Elizabeth A. Brooks,

More information

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer

Supplemental File. TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Supplemental File TRAF6 is an amplified oncogene bridging the Ras and nuclear factor-κb cascade in human lung cancer Daniel T. Starczynowski, William W. Lockwood, Sophie Delehouzee, Raj Chari, Joanna Wegrzyn,

More information

D-Mannitol Assay Kit (Colorimetric)

D-Mannitol Assay Kit (Colorimetric) D-Mannitol Assay Kit (Colorimetric) Catalog Number KA3760 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Free Fatty Acid Assay Kit

Free Fatty Acid Assay Kit Free Fatty Acid Assay Kit Catalog Number KA1667 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples:

Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Dr. Sanjeeva Srivastava IIT Bombay Work-flow: protein sample preparation Precipitation methods Removal of interfering substances Specific examples: Sample preparation for serum proteome analysis Sample

More information

RayBio Phenylalanine Fluorometric Assay Kit

RayBio Phenylalanine Fluorometric Assay Kit RayBio Phenylalanine Fluorometric Assay Kit User Manual Version 1.0 June 25, 2014 RayBio Phenylalanine Fluorometric (Cat#: 68-Phenyl-S100) RayBiotech, Inc. We Provide You With Excellent Support And Service

More information

LavaCell. Fluorescent Cell Stain. (version A) Catalog No

LavaCell. Fluorescent Cell Stain. (version A) Catalog No LavaCell Fluorescent Cell Stain (version A) Catalog No. 15004 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263

More information

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles

More information

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes

More information

Monitoring intracellular activity of Arylsulfatase B on its natural substrates in a functional bioassay using LIF-CZE

Monitoring intracellular activity of Arylsulfatase B on its natural substrates in a functional bioassay using LIF-CZE Monitoring intracellular activity of Arylsulfatase B on its natural substrates in a functional bioassay using LIF-CZE Erno Pungor Jr; Charles M. Hague; Ginger Chen; Jeffrey F. Lemontt; William S. Prince

More information

Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs.

Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Supplementary Figure S1: Alignment of CD28H. (a) Alignment of human CD28H with other known B7 receptors. (b) Alignment of CD28H orthologs. Predicted CD28H protein sequences from human, chimpanzee (pan

More information

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor

More information