microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
|
|
- Michael Page
- 5 years ago
- Views:
Transcription
1 Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1. Patients Characteristics. Case No. Clinical History Gender Age (years) TNM Stage CRC#1 colon carcinoma male 79 Ⅱ CRC#2 colon carcinoma male 85 Ⅱ CRC#3 colon carcinoma Female 63 Ⅱ CRC#4 colon carcinoma Female 51 Ⅱ CRC#5 colon carcinoma male 69 Ⅱ CRC#6 colon carcinoma Female 75 Ⅱ CRC#7 colon carcinoma male 61 Ⅱ CRC#8 colon carcinoma male 83 Ⅱ CRC#9 colon carcinoma male 62 Ⅱ CRC#10 colon carcinoma male 58 Ⅱ CRC#11 colon carcinoma Female 58 Ⅱ CRC#12 colon carcinoma male 66 Ⅱ CRC#13 colon carcinoma Female 69 Ⅱ CRC#14 colon carcinoma Female 44 Ⅱ CRC#15 colon carcinoma male 56 Ⅱ 1
2 Supplementary Figure Legends Supplementary Figure 1. Comparison of mir-200b/c and RECK levels in different colorectal cancer cells. (A) Comparison of mir-200b/c levels in HT29, Caco-2 and SW480 cells. (B) Comparison of RECK protein levels in HT29, Caco-2 and SW480 cells. Left panel: representative image; right panel: quantitative analysis (**P < 0.01).. Supplementary Figure 2. Overexpression of mir-200b/c and regulation of RECK expression by mir-200b/c in Caco-2, HT29 and SW480 cells. (A and B) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in Caco-2 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (C and D) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (E and F) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in SW480 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (G) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in Caco-2 cells infected with control lentivirus or lentivirus to overexpress mir-200b, mir-200c, or mir-200b plus mir-200c (**P < 0.01).(H and I) Western blotting analysis of RECK protein levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (J) Quantitative RT-PCR analysis of RECK mrna levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). (K and L) Western blotting analysis of RECK protein levels in SW480 cells 2
3 treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (M) Quantitative RT-PCR analysis of RECK mrna levels in SW480 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Supplementary Figure 3. Selection of efficient sirna against RECK and Downregulation of RECK expression by sirna and upregulation of RECK expression by overexpression vector in colorectal cancer cells. (A) Three sirna sequences targeting different sites of human RECK cdna were designed. (B and C) Western blotting analysis of RECK protein levels in Caco-2 cells treated with different scrambled control sirnas and different RECK sirnas. B: representative image; C: quantitative analysis (**P < 0.01). The sequence with the best interfering effect (named RECK sirna1) was selected and used in further studies.(d) Western blotting analysis of protein levels of RECK, SKP2, p27 Kip1 in Caco-2cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (E) Western blotting analysis of RECK protein levels in HT29 cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (F) Western blotting analysis of RECK protein levels in SW480 cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). Supplementary Figure 4. MTT assay analysis and EdU proliferation assay analysis of the effect of RECK-targeted mir-200b/c on the growth of colorectal cancer cells. (A and B) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of HT29 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. (C) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of HT29 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression 3
4 vector. (D and E) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of SW480 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. (F) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of SW480 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. The cells with red fluorescence are in the S phase of mitosis, and the cells with blue fluorescence represent all of the cells. (G and H) The EdU proliferation assay was performed 48 h after the transfection of HT29 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. Left panel: representative image; right panel: ratio of EdU-positive HT29 cells (**P < 0.01). (I) The EdU proliferation assay was performed 48 h after the transfection of HT29 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. Left panel: representative image; right panel: ratio of EdU-positive HT29 cells (**P < 0.01). (J and K) The EdU proliferation assay was performed 48 h after the transfection of SW480 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. Left panel: representative image; right panel: ratio of EdU-positive SW480 cells (**P < 0.01). (L) The EdU proliferation assay was performed 48 h after the transfection of SW480 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. Left panel: representative image; right panel: ratio of EdU-positive SW480 cells (**P < 0.01). Supplementary Figure 5. The effect of mir-200b/c and RECK on the migration of colorectal cancer cells. (A) Analysis of the migration ability of Caco-2 cells transfected with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) using wound healing assay. (B) Analysis of the migration ability of Caco-2 cells transfected with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) using wound healing assay. (C) Analysis of the migration ability of Caco-2 cells transfected with scrambled control sirna, RECK sirna, control vector, or RECK vector using wound healing assay. Left panel: representative image; right panel: quantitative analysis. (**P < 0.01). Supplementary Figure 6. The effects of mir-21 on RECK in combination with mir-200b/c. 4
5 (A) Quantitative RT-PCR analysis of mir-21, mir-200b and mir-200c levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (B) Quantitative RT-PCR analysis of RECK mrna levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio). (C) Western blotting analysis of RECK protein levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (D) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of Caco-2 cells with pre-scramble, pre-mir-21, pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio), or pre-mir-21 plus pre-mir-200b plus pre-mir-200c (in a 0.5:0.25:0.25 ratio) (*P < 0.05; **P < 0.01). (E) Quantitative RT-PCR analysis of the expression levels of mir-21 (in the form of mirna/u6 ratio) in eight pairs of colorectal cancer (CRC) and normal adjacent tissue (NAT) samples (*P < 0.05; **P < 0.01). 5
6 Supplementary Figure 1 6
7 Supplementary Figure 2 7
8 Supplementary Figure 3 8
9 Supplementary Figure 4 9
10 Supplementary Figure 5 10
11 Supplementary Figure 6 11
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationSupplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationmir-19a promotes colorectal cancer proliferation and migration by targeting TIA1
Liu et al. Molecular Cancer (2017) 16:53 DOI 10.1186/s12943-017-0625-8 RESEARCH Open Access mir-19a promotes colorectal cancer proliferation and migration by targeting TIA1 Yanqing Liu 1, Rui Liu 2, Fei
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationCircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationHIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationLncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer
Sun et al. Journal of Experimental & Clinical Cancer Research (2018) 37:106 https://doi.org/10.1186/s13046-018-0771-x RESEARCH Open Access LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationDownregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationBhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationhttp / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationMicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1
Ji et al. Molecular Cancer 2014, 13:86 RESEARCH Open Access MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1 Dengbo Ji 1, Zhiguo Chen
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationFigure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with
Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationSUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationmir-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1
Zeng et al. Cellular & Molecular Biology Letters (2017) 22:12 DOI 10.1186/s11658-017-0041-5 Cellular & Molecular Biology Letters RESEARCH Open Access mir-378 suppresses the proliferation, migration and
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationThe splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer
The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department
More informationThe mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationResearch Communication
IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationLong non-coding RNA (lncrna) small nucleolar RNA host gene 1 (SNHG1) promote cell proliferation in colorectal cancer by affecting P53
European Review for Medical and Pharmacological Sciences 2018; 22: 976-984 Long non-coding RNA (lncrna) small nucleolar RNA host gene 1 (SNHG1) promote cell proliferation in colorectal cancer by affecting
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected
More informationKITENIN-targeting MicroRNA-124 Suppresses Colorectal Cancer Cell Motility and Tumorigenesis
Oligonucleotide therapeutics original article -targeting MicroRNA-124 Suppresses Colorectal Cancer Cell Motility and Tumorigenesis So-Yeon Park 1, Hangun Kim 2, Somy Yoon 1, Jeong A Bae 1, Seok-Yong Choi
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationLGR5 promotes the proliferation of colorectal cancer cells via the Wnt/β-catenin signaling pathway
ONCOLOGY LETTERS 9: 2859-2863, 2015 LGR5 promotes the proliferation of colorectal cancer cells via the Wnt/β-catenin signaling pathway YU LIN 1,2, TINGYU WU 1, QIANQIAN YAO 1, SHUMING ZI 1, LONG CUI 1,3,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationLong noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma
JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationmir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4
ONCOLOGY LETTERS mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4 ZHONGSONG ZHAO, WEIWEI LIU and JIANHUA LI Digestive System Department, Shandong Provincial
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationOriginal Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway
Int J Clin Exp Pathol 2015;8(2):1419-1426 www.ijcep.com /ISSN:1936-2625/IJCEP0004445 Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Ke Yang 1*,
More informationRESEARCH ARTICLE. Wen-Shuang Wang 1,2, Xing-Sheng Yang 2, Min Xia 1, Hai-Yang Jiang 1, Jian-Qing Hou 1 * Abstract. Introduction
DOI:http://dx.doi.org/10.7314/APJCP.2012.13.9.4435 RESEARCH ARTICLE Silencing of Twist Expression by RNA Interference Suppresses Epithelial-mesenchymal Transition, Invasion, and Metastasis of Ovarian Cancer
More informationSUPPLEMENTAY FIGURES AND TABLES
SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationMicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway
INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE
More information