microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

Size: px
Start display at page:

Download "microrna-200b and microrna-200c promote colorectal cancer cell proliferation via"

Transcription

1 Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1. Patients Characteristics. Case No. Clinical History Gender Age (years) TNM Stage CRC#1 colon carcinoma male 79 Ⅱ CRC#2 colon carcinoma male 85 Ⅱ CRC#3 colon carcinoma Female 63 Ⅱ CRC#4 colon carcinoma Female 51 Ⅱ CRC#5 colon carcinoma male 69 Ⅱ CRC#6 colon carcinoma Female 75 Ⅱ CRC#7 colon carcinoma male 61 Ⅱ CRC#8 colon carcinoma male 83 Ⅱ CRC#9 colon carcinoma male 62 Ⅱ CRC#10 colon carcinoma male 58 Ⅱ CRC#11 colon carcinoma Female 58 Ⅱ CRC#12 colon carcinoma male 66 Ⅱ CRC#13 colon carcinoma Female 69 Ⅱ CRC#14 colon carcinoma Female 44 Ⅱ CRC#15 colon carcinoma male 56 Ⅱ 1

2 Supplementary Figure Legends Supplementary Figure 1. Comparison of mir-200b/c and RECK levels in different colorectal cancer cells. (A) Comparison of mir-200b/c levels in HT29, Caco-2 and SW480 cells. (B) Comparison of RECK protein levels in HT29, Caco-2 and SW480 cells. Left panel: representative image; right panel: quantitative analysis (**P < 0.01).. Supplementary Figure 2. Overexpression of mir-200b/c and regulation of RECK expression by mir-200b/c in Caco-2, HT29 and SW480 cells. (A and B) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in Caco-2 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (C and D) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (E and F) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in SW480 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (G) Quantitative RT-PCR analysis of mir-200b and mir-200c levels in Caco-2 cells infected with control lentivirus or lentivirus to overexpress mir-200b, mir-200c, or mir-200b plus mir-200c (**P < 0.01).(H and I) Western blotting analysis of RECK protein levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (J) Quantitative RT-PCR analysis of RECK mrna levels in HT29 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). (K and L) Western blotting analysis of RECK protein levels in SW480 cells 2

3 treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (M) Quantitative RT-PCR analysis of RECK mrna levels in SW480 cells treated with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) and in cells treated with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio). Supplementary Figure 3. Selection of efficient sirna against RECK and Downregulation of RECK expression by sirna and upregulation of RECK expression by overexpression vector in colorectal cancer cells. (A) Three sirna sequences targeting different sites of human RECK cdna were designed. (B and C) Western blotting analysis of RECK protein levels in Caco-2 cells treated with different scrambled control sirnas and different RECK sirnas. B: representative image; C: quantitative analysis (**P < 0.01). The sequence with the best interfering effect (named RECK sirna1) was selected and used in further studies.(d) Western blotting analysis of protein levels of RECK, SKP2, p27 Kip1 in Caco-2cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (E) Western blotting analysis of RECK protein levels in HT29 cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (F) Western blotting analysis of RECK protein levels in SW480 cells treated with scrambled control sirna, RECK sirna, control vector, or RECK vector. Left panel: representative image; right panel: quantitative analysis (**P < 0.01). Supplementary Figure 4. MTT assay analysis and EdU proliferation assay analysis of the effect of RECK-targeted mir-200b/c on the growth of colorectal cancer cells. (A and B) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of HT29 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. (C) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of HT29 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression 3

4 vector. (D and E) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of SW480 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. (F) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of SW480 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. The cells with red fluorescence are in the S phase of mitosis, and the cells with blue fluorescence represent all of the cells. (G and H) The EdU proliferation assay was performed 48 h after the transfection of HT29 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. Left panel: representative image; right panel: ratio of EdU-positive HT29 cells (**P < 0.01). (I) The EdU proliferation assay was performed 48 h after the transfection of HT29 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. Left panel: representative image; right panel: ratio of EdU-positive HT29 cells (**P < 0.01). (J and K) The EdU proliferation assay was performed 48 h after the transfection of SW480 cells with scrambled negative control RNA, pre-mir-200b/c, or anti-mir-200b/c. Left panel: representative image; right panel: ratio of EdU-positive SW480 cells (**P < 0.01). (L) The EdU proliferation assay was performed 48 h after the transfection of SW480 cells with scrambled control sirna, RECK sirna, control vector or the RECK overexpression vector. Left panel: representative image; right panel: ratio of EdU-positive SW480 cells (**P < 0.01). Supplementary Figure 5. The effect of mir-200b/c and RECK on the migration of colorectal cancer cells. (A) Analysis of the migration ability of Caco-2 cells transfected with pre-scramble, pre-mir-200b, pre-mir-200c, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) using wound healing assay. (B) Analysis of the migration ability of Caco-2 cells transfected with anti-scramble, anti-mir-200b, anti-mir-200c, or anti-mir-200b plus anti-mir-200c (in a 0.5:0.5 ratio) using wound healing assay. (C) Analysis of the migration ability of Caco-2 cells transfected with scrambled control sirna, RECK sirna, control vector, or RECK vector using wound healing assay. Left panel: representative image; right panel: quantitative analysis. (**P < 0.01). Supplementary Figure 6. The effects of mir-21 on RECK in combination with mir-200b/c. 4

5 (A) Quantitative RT-PCR analysis of mir-21, mir-200b and mir-200c levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio) (**P < 0.01). (B) Quantitative RT-PCR analysis of RECK mrna levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio). (C) Western blotting analysis of RECK protein levels in Caco-2 cells treated with pre-scramble, pre-mir-21, or pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio). Left panel: representative image; right panel: quantitative analysis (**P < 0.01). (D) The MTT viability assay was performed 12, 24, 36, 48, 60 and 72 h after the transfection of Caco-2 cells with pre-scramble, pre-mir-21, pre-mir-200b plus pre-mir-200c (in a 0.5:0.5 ratio), or pre-mir-21 plus pre-mir-200b plus pre-mir-200c (in a 0.5:0.25:0.25 ratio) (*P < 0.05; **P < 0.01). (E) Quantitative RT-PCR analysis of the expression levels of mir-21 (in the form of mirna/u6 ratio) in eight pairs of colorectal cancer (CRC) and normal adjacent tissue (NAT) samples (*P < 0.05; **P < 0.01). 5

6 Supplementary Figure 1 6

7 Supplementary Figure 2 7

8 Supplementary Figure 3 8

9 Supplementary Figure 4 9

10 Supplementary Figure 5 10

11 Supplementary Figure 6 11

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

mir-19a promotes colorectal cancer proliferation and migration by targeting TIA1

mir-19a promotes colorectal cancer proliferation and migration by targeting TIA1 Liu et al. Molecular Cancer (2017) 16:53 DOI 10.1186/s12943-017-0625-8 RESEARCH Open Access mir-19a promotes colorectal cancer proliferation and migration by targeting TIA1 Yanqing Liu 1, Rui Liu 2, Fei

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer

CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer Sun et al. Journal of Experimental & Clinical Cancer Research (2018) 37:106 https://doi.org/10.1186/s13046-018-0771-x RESEARCH Open Access LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel

More information

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript. Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The

More information

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1

MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1 Ji et al. Molecular Cancer 2014, 13:86 RESEARCH Open Access MicroRNA-181a promotes tumor growth and liver metastasis in colorectal cancer by targeting the tumor suppressor WIF-1 Dengbo Ji 1, Zhiguo Chen

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with isografts (control) at the 2nd week, 4th and 8th week by RT-PCR. At the advanced stage, the expression of these three

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28 Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,

More information

mir-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1

mir-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1 Zeng et al. Cellular & Molecular Biology Letters (2017) 22:12 DOI 10.1186/s11658-017-0041-5 Cellular & Molecular Biology Letters RESEARCH Open Access mir-378 suppresses the proliferation, migration and

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department

More information

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Long non-coding RNA (lncrna) small nucleolar RNA host gene 1 (SNHG1) promote cell proliferation in colorectal cancer by affecting P53

Long non-coding RNA (lncrna) small nucleolar RNA host gene 1 (SNHG1) promote cell proliferation in colorectal cancer by affecting P53 European Review for Medical and Pharmacological Sciences 2018; 22: 976-984 Long non-coding RNA (lncrna) small nucleolar RNA host gene 1 (SNHG1) promote cell proliferation in colorectal cancer by affecting

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. EBV-gB 23-431 mainly exists as trimer in HEK 293FT cells. (a) Western blotting analysis for DSS crosslinked FLAG-gB 23-431. HEK 293FT cells transfected

More information

KITENIN-targeting MicroRNA-124 Suppresses Colorectal Cancer Cell Motility and Tumorigenesis

KITENIN-targeting MicroRNA-124 Suppresses Colorectal Cancer Cell Motility and Tumorigenesis Oligonucleotide therapeutics original article -targeting MicroRNA-124 Suppresses Colorectal Cancer Cell Motility and Tumorigenesis So-Yeon Park 1, Hangun Kim 2, Somy Yoon 1, Jeong A Bae 1, Seok-Yong Choi

More information

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun

More information

Table S1. Quantitative RT-PCR primers

Table S1. Quantitative RT-PCR primers Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

LGR5 promotes the proliferation of colorectal cancer cells via the Wnt/β-catenin signaling pathway

LGR5 promotes the proliferation of colorectal cancer cells via the Wnt/β-catenin signaling pathway ONCOLOGY LETTERS 9: 2859-2863, 2015 LGR5 promotes the proliferation of colorectal cancer cells via the Wnt/β-catenin signaling pathway YU LIN 1,2, TINGYU WU 1, QIANQIAN YAO 1, SHUMING ZI 1, LONG CUI 1,3,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4

mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4 ONCOLOGY LETTERS mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4 ZHONGSONG ZHAO, WEIWEI LIU and JIANHUA LI Digestive System Department, Shandong Provincial

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway

Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Int J Clin Exp Pathol 2015;8(2):1419-1426 www.ijcep.com /ISSN:1936-2625/IJCEP0004445 Original Article TRAF4 promotes the growth and invasion of colon cancer through the Wnt/β-catenin pathway Ke Yang 1*,

More information

RESEARCH ARTICLE. Wen-Shuang Wang 1,2, Xing-Sheng Yang 2, Min Xia 1, Hai-Yang Jiang 1, Jian-Qing Hou 1 * Abstract. Introduction

RESEARCH ARTICLE. Wen-Shuang Wang 1,2, Xing-Sheng Yang 2, Min Xia 1, Hai-Yang Jiang 1, Jian-Qing Hou 1 * Abstract. Introduction DOI:http://dx.doi.org/10.7314/APJCP.2012.13.9.4435 RESEARCH ARTICLE Silencing of Twist Expression by RNA Interference Suppresses Epithelial-mesenchymal Transition, Invasion, and Metastasis of Ovarian Cancer

More information

SUPPLEMENTAY FIGURES AND TABLES

SUPPLEMENTAY FIGURES AND TABLES SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE

More information