Hypercholesterolemia in CLL and Response to Statin Therapy

Size: px
Start display at page:

Download "Hypercholesterolemia in CLL and Response to Statin Therapy"

Transcription

1 Hypercholesterolemia in CLL and Response to Statin Therapy 10 th Annual Canadian CLL Meeting Winnipeg, MB Sept 18, 2014 Signy Chow, MD, FRCPC Sunnybrook Health Sciences Centre, Toronto, ON

2 Outline Hypercholesterolemia is associated with cancer and possibly CLL Epidemiologic evidence Causal relationship Statins Reduce cholesterol What is the effect on CLL?

3

4 High Serum Free Fatty Acid Levels Are Found In CLL Patients Higher levels of FFA in CLL patients compared to normal controls (NS) Higher levels of FFA associated with higher CLL disease risk (p <0.001) Masoodi M et al. Leukemia (2014) 28: 1381

5 High Serum FFA in CLL patients statin x

6 LDL-C Increases Proliferation & STAT3 Phosphorylation In Primary CLL Cells 6 days Cell counts x10(4) control P=0.04 P=0.32 LDL (0.5mM) HDL (0.5mM) Pt.40 Pt.55 Pt.27 Pt.9 Pt.72 Pt.47 Pt.46 Pt.100 Pt.44 Pt.43 Pt.105 Pt.99 Proliferation θ cycd chol LDL pstat Lipoproteins (mm) βactin

7 High Fat Diets Promote Engraftment Of human CLL Cells In NOG-SCID Mice

8 Is Cholesterol Metabolism A Therapeutic Target in CLL? You haven't been taking your cholesterol medication, have you?

9 FL and statins 228 DLBCL, 293 FL registry enrolled ( ) Median followup 47months Statin-exposed vs. non-exposed newly diagnosed lymphoma Follicular Lymphoma Statins associated with improved event free survival HR 0.45 ( ) Initial watchful waiting: [HR 0.38 ( )]

10 686 patients from Mayo clinic database Rai stage 0-1 ( ), seen within 3 months of diagnosis Compared Statin or NSAID use at time of diagnosis Overall survival and time to first treatment 136/686 patients on statins (20%) More men on statins (68% vs 59% p=0.05) Older age on statins (median 65 vs 69) Median Time to First Therapy 7.9y (statin) vs 11.8y (no statin), p=0.52 Overall Survival 10.1 (statin) vs 11.4y (no statin), p=0.10 Fig 1. Time to first treatment among patients with Rai 0 CLL (p=0.52)

11 Title 335 pts evaluated 254 patients with data on statin use, 65 on statins at diagnosis No difference in baseline characteristics 26% statin use No difference in overall or treatment free survival Reduced need for therapy at diagnosis (p=0.04) 98/198 (52%) patients not on statins 24/65 (37%) patients on statins Stratification by sex: Female patients on statins significantly less likely to ever be treated than females not on statins (p<0.001) Male patients on statins at diagnosis no difference in eventual need for therapy

12 CLL and statins in combination? ----No ASA/No Statin 192/ ASA/No Statin 16/ No ASA/Statin 12/ ASA+Statin 10/20 Retrospective analysis of 280 relapsed/refractory CLL treated with FCR( ) With or without statins or ASA 58 on statins, ASA or both Outcomes ORR (p<0.01) Statins + ASA 100% Statins alone 82% ASA alone 81% Neither 72% PFS 6.1y, OS 9.2y (statin and ASA) PFS 1.6y, OS 3.7y (no statin or ASA) Multivariate adjusted model Statins+ASA associated with favorable outcome for PFS and OS Single agent did not affect PFS or OS Consistent with in vitro synergism of simvastatin and purine analogs No ASA/No Statin 169/ ASA/No Statin 15/ No ASA/Statin 11/ ASA+Statin 9/20 1 Podhorecka M, Ann Hematol 2010; 89:

13 Cases: 67F, Rai 0, CD38+ Co-morbidities: temporal arteritis, PVD, CAD, Barrett s, osteoporosis Medications: ASA, HCTZ/Triamterine, Losartan, Acetaminophen 18months post diagnosis Lymphocytes 9.7x10 6 to 46.5x10 6 cells/ ml Lipid profile: TC 7.28mM, HDL 1.73mM, LDL-C 4.99mM, non-hdl-c 5.5mM Simvastatin 5mg OD for 4 weeks, increased to 10mg OD thereafter Decrease in LDL-C: 3.8mM to 3.0mM Lymphocytes 10.1x10 6 cells/ml at 6 months, 2.1x 10 6 cells/ml at 8 months 62M, Rai 0, CD38- Co-morbidities: CABG, HSP, renal colic, sinusitis Medications: ASA, vitamins 67months post diagnosis Lymphocytes 6.9X10 6 to 58.6x10 6 cells/ml (Rai 1) Lipid Profile: TC 5.19mM, HDL-C 1.36mM, LDL-C 3.36mM, total non-hdl-c 3.83mM Lovastatin 20mg OD Decrease in LDL-C: 3.4mM to 2.7mM Lymphocytes: 20.1x10 6 cells/ml at 5 months 2.2x10 6 cells/ml at 9 months 2.4x10 6 cells/ml at 24months

14 Statin Induced Remissions? Case 1 LDL Lymphocyte count (x 10^6) Case 2 LDL Days from Statin Initiation

15 CLL and Statins: Questions What is the incidence of hyperlipidemia in CLL patients? Do patients on statins have a different clinical course? What is the effect on CLL in initiating statin therapy?

16 CLL and Statins: Study Lipid profiling of CLL patients in a specialized CLL clinic at Sunnybrook Health Sciences Centre Initiation of statin therapy for elevated LDL-C All other usual CLL care

17 CLL and Statins: Study Methods Baseline Characteristics: Demographics, Stage, Prognostic Factors (cytogenetics, CD38, beta 2 microglobulin) Lipid profile Inclusion Patients seen in clinic Jan 2012 Feb 2014 (26months) CLL, SLL Exclusion Other lymphoproliferative disorders (MCL, SMZL) Outcomes: Association with known prognostic factors Time to First Treatment Need for Therapy

18 CLL and Statins: Study Prevalence of Dyslipidemia 281 patients with CLL seen in a specialized CLL clinic from Jan 2012 Feb without cholesterol profiles 7 with MBL 231 patients for evaluation 107 patients on statins 10 additional with dyslipidemia not on therapy 114 patients with diagnosed no lipid abnormalities or statin therapy 62 patients with LDL-C 2.5mmol/L 18 of which had LDL-C 3.5mmol/L ( =135)/231 patients (58.4%) with abnormal lipids

19 /article/11732-eng.htm

20 CLL and Statins: Significant differences between statin/non statin groups: Age [median 65 (no statins) vs 69 (statins)] LDL [2.70 ± 0.91 (no statins) vs 2.38 ± 1.15 (statins)] HDL [1.30 ± 0.47 (no statins) 1.12 ± 0.42 (statins)] No differences: Stage Cytogenetics CD38 expression Beta 2 microglobulin level Gender

21 CLL and Statins: Therapy Need for Treatment Time to First Treatment Date of diagnosis until date of first treatment Treatment = chemoimmunotherapy or high dose glucocorticoids

22 CLL and Statins: Therapy Need for Treatment (p=0.50) Treated patients: Total: 96/ % No statins: 54/ % Statins: 42/ % Median Time to First Treatment (p=0.02): Total: 48 (24, 83) months (n= 89) No Statin: 36 (11, 100) months (n=51) Statin: 57.5 (32, 77) months (n=38)

23 CLL and Statins: Therapy Time to First Treatment Time to First Therapy Comparison N = 89 [Median (Q1, Q3)] P-value Statin Use Statin (32, 77) 0.02 No Statin (11, 100) Gender Female (36, 118) 0.02 Male (16, 76) Cytogenetics Normal/13q (34, 100) Trisomy 12/11q (42, 118) Complex/17p (7, 56) Multivariate analysis Statin use and gender are significant after adjusting for each other Neither are significant after accounting for cytogenetics (available in 73 of 89 treated patients) Power Calculation (α=0.05, β=0.80) Sample size of 94 patients in each group required to achieve an 80% power to detect a 50% difference in TFT between groups

24 CLL and Statins: Therapy Time to First Treatment by Statin Initiation No statin (N=124) Statin Started (N=40) Statin Previous (N=67) P-value W&W 1 (%) Available TFT data/total 51/54 13/13 25/27 Treated 2 Median TFT (Q1, Q3) (mo) 36 (11, 100) 74 (62, 96) 45 (30, 64) 0.04 Initiation of statin therapy prolonged time to first treatment Median Duration of follow up Statin: 68months Non-statin: 79.5months Proportion of watchful waiting not affected

25 Conclusions LDL-C promotes the growth of CLL cells in vitro and possibly in mice CLL patients have an increased incidence of abnormal lipid metabolism And lipid profiling should be included in their diagnostic work-up There is a Role for Statins in CLL Therapy May be a useful intervention in watch and wait phase of CLL treatment to prolong time to first treatment

26 Acknowledgements Sunnybrook Odette Cancer Centre David Spaner Rena Buckstein Spaner Lab Lindsay McCaw YongHong Shi Statistics Liying Zhang University of Toronto

27 Total No Statin Statin Use P value Total Male 142 (61.5) 70 (56.5) 72 (67.3) 0.09 Median Age (Q1, Q3) 67 (60, 74) 65 (58, 73) 69 (63, 76) 0.01 RAI stage N 171 (74.0%) 83 (66.9%) 88 (82.2%) Lipid Profile HDL (mmol/l) 1.22 ± ± ± LDL (mmol/l) 2.55 ± ± ± TC/HDL 3.95 ± ± ± Non HDL-C (mmol/l) 3.22 ± ± ± B2M ( mg/ml) 0.31 Mean Std Dev 3.24 ± ± ± 1.98 CD38 status 0.28 Unknown 70 (30.3%) 39 (32.8%) 31 (29.0%) CD CD Partial Cytogenetics Unknown 118 (51.1%) 56 (45.1%) 62 (57.9%) 13q q p Normal >1 abnormality

28 All Patients Initiated on Statin Therapy Lymphocyte Count (x 10^6) Days from Initiation of Statin Therapy

Short Telomeres Predict Poor Prognosis in Chronic Lymphocytic Leukemia

Short Telomeres Predict Poor Prognosis in Chronic Lymphocytic Leukemia Short Telomeres Predict Poor Prognosis in Chronic Lymphocytic Leukemia L. Yang Internal Medicine Resident University of Manitoba Supervisor: Dr. J. Johnston Prognostic factors Clinical course is unpredictable

More information

New Evidence reports on presentations given at EHA/ICML Bendamustine in the Treatment of Lymphoproliferative Disorders

New Evidence reports on presentations given at EHA/ICML Bendamustine in the Treatment of Lymphoproliferative Disorders New Evidence reports on presentations given at EHA/ICML 2011 Bendamustine in the Treatment of Lymphoproliferative Disorders Report on EHA/ICML 2011 presentations Efficacy and safety of bendamustine plus

More information

Outcome of DLBCL patients over 80 years: A retrospective survey from 4 Institutions

Outcome of DLBCL patients over 80 years: A retrospective survey from 4 Institutions Outcome of DLBCL patients over 80 years: A retrospective survey from 4 Institutions AA Moccia, S Gobba, A Conconi, S Diem, L Cascione, K Aprile von Hohenstaufen, W Gulden Sala, A Stathis, F Hitz, G Pinotti,

More information

We Can Cure Chronic Lymphocytic Leukemia with Current / Soon to be Approved Agents: CON ARGUMENT

We Can Cure Chronic Lymphocytic Leukemia with Current / Soon to be Approved Agents: CON ARGUMENT We Can Cure Chronic Lymphocytic Leukemia with Current / Soon to be Approved Agents: CON ARGUMENT Danielle M. Brander, MD Duke University Division of Hematologic Malignancies & Cell Therapy CLL & Indolent

More information

CARE at ASH 2014 Lymphoma. Dr. Diego Villa Medical Oncologist British Columbia Cancer Agency Vancouver Cancer Centre

CARE at ASH 2014 Lymphoma. Dr. Diego Villa Medical Oncologist British Columbia Cancer Agency Vancouver Cancer Centre CARE at ASH 2014 Lymphoma Dr. Diego Villa Medical Oncologist British Columbia Cancer Agency Vancouver Cancer Centre High-yield lymphoma sessions Sat, Dec 6 th Sun, Dec 7 th Mon, Dec 8 th EDUCATIONAL SESSIONS

More information

Splenic marginal zone NHL: Update on biology and therapy. Jonathan W. Friedberg M.D., M.M.Sc.

Splenic marginal zone NHL: Update on biology and therapy. Jonathan W. Friedberg M.D., M.M.Sc. Splenic marginal zone NHL: Update on biology and therapy Jonathan W. Friedberg M.D., M.M.Sc. Marginal zone NHL: A Neglected Lymphoma? Marginal zone NHL/MALT; 3 rd most common B-cell NHL Al-Hamadani et

More information

Pinkal Desai MD MPH Weill Cornell Medical College New York, NY WHI Annual Meeting, May 5-6, 2016

Pinkal Desai MD MPH Weill Cornell Medical College New York, NY WHI Annual Meeting, May 5-6, 2016 Pinkal Desai MD MPH Weill Cornell Medical College New York, NY WHI Annual Meeting, May 5-6, 2016 Reproductive hormones interact with the immune system Human lymphocytes (B and T) and some lymphoma and

More information

CLL: disease specific biology and current treatment. Dr. Nathalie Johnson

CLL: disease specific biology and current treatment. Dr. Nathalie Johnson CLL: disease specific biology and current treatment Dr. Nathalie Johnson Disclosures Consultant and Advisory boards Roche, Abbvie, Gilead, Jansson, Lundbeck,Merck Research funding Roche, Abbvie, Lundbeck

More information

NON HODGKINS LYMPHOMA: INDOLENT Updated June 2015 by Dr. Manna (PGY-5 Medical Oncology Resident, University of Calgary)

NON HODGKINS LYMPHOMA: INDOLENT Updated June 2015 by Dr. Manna (PGY-5 Medical Oncology Resident, University of Calgary) NON HODGKINS LYMPHOMA: INDOLENT Updated June 2015 by Dr. Manna (PGY-5 Medical Oncology Resident, University of Calgary) Reviewed by Dr. Michelle Geddes (Staff Hematologist, University of Calgary) and Dr.

More information

Janet B. Long, MSN, ACNP, CLS, FAHA, FNLA Rhode Island Cardiology Center

Janet B. Long, MSN, ACNP, CLS, FAHA, FNLA Rhode Island Cardiology Center Primary and Secondary Prevention of Coronary Artery Disease: What is the role of non statin drugs (fenofibrates, fish oil, niacin, folate and vitamins)? Janet B. Long, MSN, ACNP, CLS, FAHA, FNLA Rhode

More information

Adherence to Heart Failure

Adherence to Heart Failure Disease Management Programs Adherence to Heart Failure Management Guidelines Raed Odeh, Nurse Specialist Co-Authers: Elias Fadel, MB Bdeir, A. Mukhtar, T. Conboy, M. Al-Mallah. King Abdul Aziz Medical

More information

Raising the Bar in CLL Michael E. Williams, MD, ScM Byrd S. Leavell Professor of Medicine Chief, Hematology/Oncology Division

Raising the Bar in CLL Michael E. Williams, MD, ScM Byrd S. Leavell Professor of Medicine Chief, Hematology/Oncology Division Raising the Bar in CLL Michael E. Williams, MD, ScM Byrd S. Leavell Professor of Medicine Chief, Hematology/Oncology Division University of Virginia Cancer Center The Clinical Continuum of CLL Early asymptomatic

More information

2/20/2013. Why use imaging in CV prevention? Update on coronary CTA in 2013 Coronary CTA for 1 0 prevention: pros and cons Are we there yet?

2/20/2013. Why use imaging in CV prevention? Update on coronary CTA in 2013 Coronary CTA for 1 0 prevention: pros and cons Are we there yet? Evolving Role of Coronary CTA in Primary Cardiovascular Disease Prevention: Are We There Yet? Ron Blankstein, M.D., F.A.C.C. Co-Director, Cardiovascular Imaging Training Program Associate Physician, Preventive

More information

Chronic Lymphocytic Leukemia (CLL): Refresher Course for Hematologists Ekarat Rattarittamrong, MD

Chronic Lymphocytic Leukemia (CLL): Refresher Course for Hematologists Ekarat Rattarittamrong, MD Chronic Lymphocytic Leukemia (CLL): Refresher Course for Hematologists Ekarat Rattarittamrong, MD Division of Hematology Department of Internal Medicine Faculty of Medicine Chiang-Mai University Outline

More information

Addition of Rituximab to Fludarabine and Cyclophosphamide in Patients with CLL: A Randomized, Open-Label, Phase III Trial

Addition of Rituximab to Fludarabine and Cyclophosphamide in Patients with CLL: A Randomized, Open-Label, Phase III Trial Addition of Rituximab to Fludarabine and Cyclophosphamide in Patients with CLL: A Randomized, Open-Label, Phase III Trial Hallek M et al. Lancet 2010;376:1164-74. Introduction > In patients with CLL, the

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Be Still My Beating Heart!

Be Still My Beating Heart! 030-Coronary Disease 1/13/04 12:21 PM Page 30 Be Still My Beating Heart! An Update on Coronary Disease Heart disease has long been considered a male health problem, because men are affected at an earlier

More information

Highlights of ICML 2015

Highlights of ICML 2015 Highlights of ICML 2015 Jonathan W. Friedberg M.D. Director, James P. Wilmot Cancer Center Statistics, ICML 2015: a global meeting Almost 3700 participants. 90 countries represented. Attendees: USA 465

More information

Considerations and Controversies in the Management of Dyslipidemia for ASCVD Risk Reduction

Considerations and Controversies in the Management of Dyslipidemia for ASCVD Risk Reduction Considerations and Controversies in the Management of Dyslipidemia for ASCVD Risk Reduction Pamela B. Morris, MD, FACC, FAHA, FASCP, FNLA Chair, ACC Prevention of Cardiovascular Disease Council The Medical

More information

Update: Chronic Lymphocytic Leukemia

Update: Chronic Lymphocytic Leukemia ASH 2008 Update: Chronic Lymphocytic Leukemia Improving Patient Response to Treatment with the Addition of Rituximab to Fludarabine-Cyclophosphamide ASH 2008: Update on chronic lymphocytic leukemia CLL-8

More information

Background. Approved by FDA and EMEA for CLL and allows for treatment without chemotherapy in all lines of therapy

Background. Approved by FDA and EMEA for CLL and allows for treatment without chemotherapy in all lines of therapy Updated Efficacy and Safety From the Phase 3 RESONATE-2 Study: Ibrutinib As First-Line Treatment Option in Patients 65 Years and Older With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Abstract

More information

Dyslipidemia: Lots of Good Evidence, Less Good Interpretation.

Dyslipidemia: Lots of Good Evidence, Less Good Interpretation. Dyslipidemia: Lots of Good Evidence, Less Good Interpretation. G Michael Allan Evidence & CPD Program, ACFP Associate Professor, Dept of Family, U of A. CFPC CoI Templates: Slide 1 Faculty/Presenter Disclosure

More information

INTERNATIONAL LIPOPROTEIN STANDARDIZATION FORUM Fasting Time and Lipid Levels in a Community-Based Population: A Crosssectional

INTERNATIONAL LIPOPROTEIN STANDARDIZATION FORUM Fasting Time and Lipid Levels in a Community-Based Population: A Crosssectional INTERNATIONAL LIPOPROTEIN STANDARDIZATION FORUM Fasting Time and Lipid Levels in a Community-Based Population: A Crosssectional Study. Christopher Naugler MD Associate Professor, University of Calgary

More information

Advances in CLL 2016

Advances in CLL 2016 Advances in CLL 2016 The Geoffrey P. Herzig Memorial Symposium, Louisville, KY Kanti R. Rai, MD Northwell-Hofstra School of Medicine Long Island Jewish Medical Center New Hyde Park, NY Disclosures Member

More information

Idelalisib in the Treatment of Chronic Lymphocytic Leukemia

Idelalisib in the Treatment of Chronic Lymphocytic Leukemia Idelalisib in the Treatment of Chronic Lymphocytic Leukemia Jacqueline C. Barrientos, MD Assistant Professor of Medicine Hofstra North Shore LIJ School of Medicine North Shore LIJ Cancer Institute CLL

More information

The case for maintenance rituximab in FL

The case for maintenance rituximab in FL New-York, October 23 rd 2015 The case for maintenance rituximab in FL Pr. Gilles SALLES For FL patients, progression-free survival still needs to be improved Median R-CHVP-I 66 months P

More information

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium

Comprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:

More information

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution

Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution Figure S1. Comparison of fasting plasma lipoprotein levels between males (n=108) and females (n=130). Box plots represent the quartiles distribution of A: total cholesterol (TC); B: low-density lipoprotein

More information

Low HDL and Diabetic Dyslipidemia

Low HDL and Diabetic Dyslipidemia The Lowdown: Low HDL and Diabetic Dyslipidemia Patients with diabetes commonly have a low-density lipoprotein cholesterol (LDL-C) no higher than that of the general population. What treatment is warranted

More information

The Diabetes Link to Heart Disease

The Diabetes Link to Heart Disease The Diabetes Link to Heart Disease Anthony Abe DeSantis, MD September 18, 2015 University of WA Division of Metabolism, Endocrinology and Nutrition Oswald Toosweet Case #1 68 yo M with T2DM Diagnosed DM

More information

1. What to test. 2. When to test

1. What to test. 2. When to test Biomarkers: the triad of questions 1. What to test 2. When to test 3. Who to test Biomarkers: the triad of questions 1. What to test 2. When to test 3. Who to test Impact of CLL biological features on

More information

FOLLICULAR LYMPHOMA: US vs. Europe: different approach on first relapse setting?

FOLLICULAR LYMPHOMA: US vs. Europe: different approach on first relapse setting? Indolent Lymphoma Workshop Bologna, Royal Hotel Carlton May 2017 FOLLICULAR LYMPHOMA: US vs. Europe: different approach on first relapse setting? Armando López-Guillermo Department of Hematology, Hospital

More information

What have We Learned in Dyslipidemia Management Since the Publication of the 2013 ACC/AHA Guideline?

What have We Learned in Dyslipidemia Management Since the Publication of the 2013 ACC/AHA Guideline? What have We Learned in Dyslipidemia Management Since the Publication of the 2013 ACC/AHA Guideline? Salim S. Virani, MD, PhD, FACC, FAHA Associate Professor, Section of Cardiovascular Research Baylor

More information

Patient characteristics Intervention Comparison Length of followup

Patient characteristics Intervention Comparison Length of followup ISCHAEMIA TESTING CHAPTER TESTING FOR MYCOCARDIAL ISCHAEMIA VERSUS NOT TESTING FOR MYOCARDIAL ISCHAEMIA Ref ID: 4154 Reference Wienbergen H, Kai GA, Schiele R et al. Actual clinical practice exercise ing

More information

CAR-T CELLS: NEW HOPE FOR CANCER PATIENTS

CAR-T CELLS: NEW HOPE FOR CANCER PATIENTS CAR-T CELLS: NEW HOPE FOR CANCER PATIENTS Natasha Kekre, MD, MPH, FRCPC Hematologist, Blood and Marrow Transplant Program, TOH Associate Scientist, Ottawa Hospital Research Institute Assistant Professor

More information

BENDAMUSTINE + RITUXIMAB IN CLL

BENDAMUSTINE + RITUXIMAB IN CLL BENDAMUSTINE + RITUXIMAB IN CLL Barbara Eichhorst Bologna 13. November 2017 CONFLICT OF INTERESTS 1. Advisory Boards Janssen, Gilead, Roche, Abbvie, GSK 2. Honoraria Roche, GSK, Gilead, Janssen, Abbvie,

More information

CLL Biology and Initial Management. Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology

CLL Biology and Initial Management. Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology CLL Biology and Initial Management Gordon D. Ginder, MD Director, Massey Cancer Center Lipman Chair in Oncology CLL- Epidemiology Most common adult leukemia 25-30% in western world Incidence in US 4.5

More information

BTK Inhibitors and BCL2 Antagonists

BTK Inhibitors and BCL2 Antagonists BTK Inhibitors and BCL2 Antagonists Constantine (Con) S. Tam Director of Haematology, St Vincent s Hospital Melbourne; Lead for Chronic Lymphocytic Leukemia and Indolent Lymphoma, Peter MacCallum Cancer

More information

Dr Claire Burney, Lymphoma Clinical Fellow, Bristol Haematology and Oncology Centre, UK

Dr Claire Burney, Lymphoma Clinical Fellow, Bristol Haematology and Oncology Centre, UK EMBT LWP 2017-R-05 Research Protocol: Outcomes of patients treated with Ibrutinib post autologous stem cell transplant for mantle cell lymphoma. A retrospective analysis of the LWP-EBMT registry. Principle

More information

Investigating the effect of antiretroviral switch to tenofovir alafenamide on lipid profiles in people living with HIV within the UCD ID Cohort

Investigating the effect of antiretroviral switch to tenofovir alafenamide on lipid profiles in people living with HIV within the UCD ID Cohort Investigating the effect of antiretroviral switch to tenofovir alafenamide on lipid profiles in people living with HIV within the UCD ID Cohort A. Lacey 1, W. Tinago 1, E. Alvarez Barco 1, A.J. Macken

More information

Bendamustine is Effective Therapy in Patients with Rituximab-Refractory, Indolent B-Cell Non-Hodgkin Lymphoma

Bendamustine is Effective Therapy in Patients with Rituximab-Refractory, Indolent B-Cell Non-Hodgkin Lymphoma Bendamustine is Effective Therapy in Patients with Rituximab-Refractory, Indolent B-Cell Non-Hodgkin Lymphoma Kahl BS et al. Cancer 2010;116(1):106-14. Introduction > Bendamustine is a novel alkylating

More information

Rosuvastatin: An Effective Lipid Lowering Drug against Hypercholesterolemia

Rosuvastatin: An Effective Lipid Lowering Drug against Hypercholesterolemia ISPUB.COM The Internet Journal of Cardiovascular Research Volume 3 Number 1 Rosuvastatin: An Effective Lipid Lowering Drug against Hypercholesterolemia V Save, N Patil, G Rajadhyaksha Citation V Save,

More information

John J.P. Kastelein MD PhD Professor of Medicine Dept. of Vascular Medicine Academic Medial Center / University of Amsterdam

John J.P. Kastelein MD PhD Professor of Medicine Dept. of Vascular Medicine Academic Medial Center / University of Amsterdam Latest Insights from the JUPITER Study John J.P. Kastelein MD PhD Professor of Medicine Dept. of Vascular Medicine Academic Medial Center / University of Amsterdam Inflammation, hscrp, and Vascular Prevention

More information

Georg Hopfinger 3. Med.Abt and LBI for Leukemiaresearch and Haematology Hanusch Krankenhaus,Vienna, Austria

Georg Hopfinger 3. Med.Abt and LBI for Leukemiaresearch and Haematology Hanusch Krankenhaus,Vienna, Austria Chronic lymphocytic Leukemia Georg Hopfinger 3. Med.Abt and LBI for Leukemiaresearch and Haematology Hanusch Krankenhaus,Vienna, Austria georg.hopfinger@wgkk.at CLL Diagnosis and Staging Risk Profile Assessment

More information

CLL & SLL: Current Management & Treatment. Dr. Peter Anglin

CLL & SLL: Current Management & Treatment. Dr. Peter Anglin CLL & SLL: Current Management & Treatment Dr. Peter Anglin Chronic Lymphocytic Leukemia Prolonged clinical course Chronic A particular type of blood cell B lymphocyte Lymphocytic Cancer of white blood

More information

Chronic lymphocytic Leukemia

Chronic lymphocytic Leukemia Chronic lymphocytic Leukemia after IwCLL, ICML and EHA 2017 Ann Janssens, MD, PhD Hematology, UZ Leuven Brussels, 14 september 2017 Front line treatment CLL Active or progressive disease No active or progressive

More information

Dr. A. Van Hoof Hematology A.Z. St.Jan, Brugge. ASH 2012 Atlanta

Dr. A. Van Hoof Hematology A.Z. St.Jan, Brugge. ASH 2012 Atlanta Dr. A. Van Hoof Hematology A.Z. St.Jan, Brugge ASH 2012 Atlanta DLBCL How to improve on R-CHOP What at relapse Mantle cell lymphoma Do we cure patients Treatment at relapse Follicular lymphoma Watch and

More information

Eyes on Korean Data: Lipid Management in Korean DM Patients

Eyes on Korean Data: Lipid Management in Korean DM Patients Eyes on Korean Data: Lipid Management in Korean DM Patients ICDM Luncheon Symposium Sung Rae Kim MD PhD Division of Endocrinology and Metabolism The Catholic University of Korea Causes of Death in People

More information

Risikoprofil-gesteuerte, individualisierte Therapiestrategien bei der CLL. Michael Hallek University of Cologne

Risikoprofil-gesteuerte, individualisierte Therapiestrategien bei der CLL. Michael Hallek University of Cologne Risikoprofil-gesteuerte, individualisierte Therapiestrategien bei der CLL Michael Hallek University of Cologne 100 90 80 70 60 Substantial progress in CLL therapy in one decade 50 40 complete remissions

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

How would you manage Ms. Gold

How would you manage Ms. Gold How would you manage Ms. Gold 32 yo Asian woman with dyslipidemia Current medications: Simvastatin 20mg QD Most recent lipid profile: TC = 246, TG = 100, LDL = 176, HDL = 50 What about Mr. Williams? 56

More information

Sanger Heart & Vascular Institute Symposium 2015

Sanger Heart & Vascular Institute Symposium 2015 Sanger Heart & Vascular Institute Symposium 2015 Cardiovascular Update For Primary Care Physicians William E. Downey, MD FACC FSCAI Medical Director, Interventional Cardiology Sanger Heart & Vascular Institute

More information

Learning Objectives. Cholesterol and Lipids in Kids: It s a Matter of the Heart. Is Atherosclerosis a Pediatric Disease?

Learning Objectives. Cholesterol and Lipids in Kids: It s a Matter of the Heart. Is Atherosclerosis a Pediatric Disease? Scott J. Soifer, MD Professor and Vice Chair Department of Pediatrics University of California, San Francisco UCSF Benioff Children s Hospital Cholesterol and Lipids in Kids: It s a Matter of the Heart

More information

Diabetes and the Heart

Diabetes and the Heart Diabetes and the Heart Jeffrey Boord, MD, MPH Advances in Cardiovascular Medicine Kingston, Jamaica December 6, 2012 Outline Screening for diabetes in patients with CAD Screening for CAD in patients with

More information

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi

Hyperlipidemia. Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Hyperlipidemia Prepared by : Muhannad Mohammed Supervisor professor : Dr. Ahmed Yahya Dallalbashi Outline The story of lipids Definition of hyperlipidemia Classification of hyperlipidemia Causes of hyperlipidemia

More information

eastern cooperative oncology group Michael Williams, Fangxin Hong, Brad Kahl, Randy Gascoyne, Lynne Wagner, John Krauss, Sandra Horning

eastern cooperative oncology group Michael Williams, Fangxin Hong, Brad Kahl, Randy Gascoyne, Lynne Wagner, John Krauss, Sandra Horning Results of E4402 (RESORT): A Randomized Phase III Study Comparing Two Different Rituximab Dosing Strategies for Low Tumor Burden Indolent B-Cell Lymphoma Michael Williams, Fangxin Hong, Brad Kahl, Randy

More information

UNMET NEEDS OF PATIENTS WITH CLL/SLL AND FL. June 6, 2018

UNMET NEEDS OF PATIENTS WITH CLL/SLL AND FL. June 6, 2018 UNMET NEEDS OF PATIENTS WITH CLL/SLL AND FL June 6, 2018 0 PRESENTATION OVERVIEW IN CLL/SLL AND FL: Review patient heterogeneity and its connection to unmet needs Explore unmet needs within the CLL/SLL

More information

Multiple Myeloma Updates 2007

Multiple Myeloma Updates 2007 Multiple Myeloma Updates 2007 Brian Berryman, M.D. Multiple Myeloma Updates 2007 Goals for today: Understand the staging systems for myeloma Understand prognostic factors in myeloma Review updates from

More information

Dr G R Letchuman. Clogged by Cholesterol

Dr G R Letchuman. Clogged by Cholesterol Dr G R Letchuman Clogged by Cholesterol Main message Cholesterol management is all about reducing risk of CV events vs the side effects, hassle and cost of drugs News that it is no longer important to

More information

Advances in Immunotherapy for Lymphoma. Ashley Freeman, MD, FRCPC Immunotherapy Research Fellow

Advances in Immunotherapy for Lymphoma. Ashley Freeman, MD, FRCPC Immunotherapy Research Fellow Advances in Immunotherapy for Lymphoma Ashley Freeman, MD, FRCPC Immunotherapy Research Fellow The immune system and cancer Immunotherapies available for lymphoma Upcoming immunotherapy clinical trials

More information

Coronary Artery Disease in Women

Coronary Artery Disease in Women Coronary Artery Disease in Women by Wael Almahmeed MD, FCCP, FRCPC, FRCPE, FACP, FACC, FESC Clinical Associate Professor of Medicine, UAE University Consultant Cardiologist at Cleveland Clinic, Abu Dhabi

More information

The 1 World Congress on Controversies in Hematology (COHEM) Rome, September 2010

The 1 World Congress on Controversies in Hematology (COHEM) Rome, September 2010 The 1 World Congress on Controversies in Hematology (COHEM) Rome, September 2010 Is the wait and watch philosophy still practical in the treatment of CLL even in younger patients? Expected to say NO Federico

More information

Clinical Policy: Pitavastatin (Livalo), Ezetimibe/Simvastatin (Vytorin 10/10 mg) Reference Number: CP.CPA.62 Effective Date:

Clinical Policy: Pitavastatin (Livalo), Ezetimibe/Simvastatin (Vytorin 10/10 mg) Reference Number: CP.CPA.62 Effective Date: Clinical Policy: Pitavastatin (Livalo), Ezetimibe/Simvastatin (Vytorin 10/10 mg) Reference Number: CP.CPA.62 Effective Date: 11.16.16 Last Review Date: 11.17 Line of Business: Commercial Revision Log See

More information

The JUPITER trial: What does it tell us? Alice Y.Y. Cheng, MD, FRCPC January 24, 2009

The JUPITER trial: What does it tell us? Alice Y.Y. Cheng, MD, FRCPC January 24, 2009 The JUPITER trial: What does it tell us? Alice Y.Y. Cheng, MD, FRCPC January 24, 2009 Learning Objectives 1. Understand the role of statin therapy in the primary and secondary prevention of stroke 2. Explain

More information

Hae Sun Suh, B.Pharm., Ph.D. Jason N. Doctor, Ph.D.

Hae Sun Suh, B.Pharm., Ph.D. Jason N. Doctor, Ph.D. Podium Presentation, May 18, 2009 Comparison of Cardiovascular Event Rates in Subjects with Type II Diabetes Mellitus who Augmented from Statin Monotherapy to Statin Plus Fibrate Combination Therapy with

More information

Improving Response to Treatment in CLL with the Addition of Rituximab and Alemtuzumab to Chemoimmunotherapy

Improving Response to Treatment in CLL with the Addition of Rituximab and Alemtuzumab to Chemoimmunotherapy New Evidence reports on presentations given at ASH 2009 Improving Response to Treatment in CLL with the Addition of Rituximab and Alemtuzumab to Chemoimmunotherapy From ASH 2009: Chronic Lymphocytic Leukemia

More information

CLL what do I need to know as an Internist in Taimur Sher MD Associate Professor of Medicine Mayo Clinic

CLL what do I need to know as an Internist in Taimur Sher MD Associate Professor of Medicine Mayo Clinic CLL what do I need to know as an Internist in 218 Taimur Sher MD Associate Professor of Medicine Mayo Clinic Case 1 7 y/o white male for yearly medical evaluation Doing well and healthy Past medical history

More information

Chronic Lymphocytic Leukemia. Paolo Ghia

Chronic Lymphocytic Leukemia. Paolo Ghia Chronic Lymphocytic Leukemia Paolo Ghia Complex Karyotype: a novel predictive marker? Thompson PA et al. Cancer 2015 Complex karyotype superseded del(17p) Anderson MA et al. Blood 2017 Ibrutinib and Idela

More information

The Impact of Smoking on Acute Ischemic Stroke

The Impact of Smoking on Acute Ischemic Stroke Smoking The Impact of Smoking on Acute Ischemic Stroke Wei-Chieh Weng, M.D. Department of Neurology, Chang-Gung Memorial Hospital, Kee-Lung, Taiwan Smoking related mortality Atherosclerotic vascular disease

More information

TREATMENT CONSIDERATIONS IN CLL/SLL AND FL. June 6, 2018

TREATMENT CONSIDERATIONS IN CLL/SLL AND FL. June 6, 2018 TREATMENT CONSIDERATIONS IN CLL/SLL AND FL June 6, 2018 0 PRESENTATION OVERVIEW IN CLL/SLL AND FL: Discuss key considerations that influence patient outcomes Highlight the importance of patients quality

More information

*Jagiellonian University, Kraków, Poland

*Jagiellonian University, Kraków, Poland Single-Agent MOR208 in Relapsed or Refractory (R-R) Non-Hodgkin s Lymphoma (NHL): Results from Diffuse Large B-Cell Lymphoma (DLBCL) and Indolent NHL Subgroups of a Phase IIa Study Wojciech Jurczak, *

More information

DYNAMO: A PHASE 2 STUDY OF DUVELISIB IN PATIENTS WITH REFRACTORY INDOLENT NON HODGKIN LYMPHOMA

DYNAMO: A PHASE 2 STUDY OF DUVELISIB IN PATIENTS WITH REFRACTORY INDOLENT NON HODGKIN LYMPHOMA DYNAMO: A PHASE 2 STUDY OF DUVELISIB IN PATIENTS WITH REFRACTORY INDOLENT NON HODGKIN LYMPHOMA Ian Flinn, CB Miller, KM Ardeshna, S Tetreault, SE Assouline, PL Zinzani, J Mayer, M Merli, SD Lunin, AR Pettitt,

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

Disclosures. Pediatric Dyslipidemia Casey Elkins, DNP, NP C, CLS, FNLA. Learning Objectives. Atherogenesis. Acceptable Values

Disclosures. Pediatric Dyslipidemia Casey Elkins, DNP, NP C, CLS, FNLA. Learning Objectives. Atherogenesis. Acceptable Values 39 th National Conference on Pediatric Health Care Pediatric Dyslipidemia Casey Elkins, DNP, NP C, CLS, FNLA March 19-22, 2018 CHICAGO Disclosures Speakers Bureau Sanofi and Regeneron Learning Objectives

More information

Management of Post-transplant hyperlipidemia

Management of Post-transplant hyperlipidemia Management of Post-transplant hyperlipidemia B. Gisella Carranza Leon, MD Assistant Professor of Medicine Lipid Clinic - Vanderbilt Heart and Vascular Institute Division of Diabetes, Endocrinology and

More information

The case against maintenance rituximab in Follicular lymphoma. Jonathan W. Friedberg M.D., M.M.Sc.

The case against maintenance rituximab in Follicular lymphoma. Jonathan W. Friedberg M.D., M.M.Sc. The case against maintenance rituximab in Follicular lymphoma Jonathan W. Friedberg M.D., M.M.Sc. Follicular lymphoma: What are goals of treatment? Change natural history of disease: Decrease transformation

More information

Consolidation and maintenance therapy for transplant eligible myeloma patients

Consolidation and maintenance therapy for transplant eligible myeloma patients Consolidation and maintenance therapy for transplant eligible myeloma patients Teeraya Puavilai, M.D. Division of Hematology, Department of Medicine Faculty of Medicine Ramathibodi Hospital Mahidol University

More information

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown

More information

Diabetes: Use of Adjunctive Therapy ACEs, ARBs, ASA & STATINs --Oh My! Veronica J. Brady, PhD, FNP-BC, BC-ADM, CDE Project ECHO April 19, 2018

Diabetes: Use of Adjunctive Therapy ACEs, ARBs, ASA & STATINs --Oh My! Veronica J. Brady, PhD, FNP-BC, BC-ADM, CDE Project ECHO April 19, 2018 Diabetes: Use of Adjunctive Therapy ACEs, ARBs, ASA & STATINs --Oh My! Veronica J. Brady, PhD, FNP-BC, BC-ADM, CDE Project ECHO April 19, 2018 Points to Ponder ASCVD is the leading cause of morbidity

More information

Rapid Case Ascertainment in Population and Hospital- Based Studies: Notes From the Field

Rapid Case Ascertainment in Population and Hospital- Based Studies: Notes From the Field Rapid Case Ascertainment in Population and Hospital- Based Studies: Notes From the Field James R. Cerhan, M.D., Ph.D. Mayo Clinic College of Medicine University of Iowa College of Public Health Overview

More information

ASH up-date: Changing the Standard of Care for Patients with. (or: Who to treat with What When?)

ASH up-date: Changing the Standard of Care for Patients with. (or: Who to treat with What When?) ASH up-date: Changing the Standard of Care for Patients with B-cell Chronic Lymphocytic Leukaemia (or: Who to treat with What When?) Dr Anna Schuh, MD, PhD, MRCP, FRCPath Consultant and Senior Lecturer

More information

New Lipid Lowering Agents (PCSK9 Inhibitors, Bempedoic Acid, Apabetalone) in the Elderly? The State of the Recent Knowledge Prof.

New Lipid Lowering Agents (PCSK9 Inhibitors, Bempedoic Acid, Apabetalone) in the Elderly? The State of the Recent Knowledge Prof. New Lipid Lowering Agents (PCSK9 Inhibitors, Bempedoic Acid, Apabetalone) in the Elderly? The State of the Recent Knowledge Prof. Maciej Banach Łódź, PL According to : Central Intelligence Agency". Retrieved

More information

Hyperlipidemia in an Otherwise Healthy 80 Year-Old Patient. Theodore D Fraker, Jr, MD Professor of Medicine

Hyperlipidemia in an Otherwise Healthy 80 Year-Old Patient. Theodore D Fraker, Jr, MD Professor of Medicine Hyperlipidemia in an Otherwise Healthy Theodore D Fraker, Jr, MD Professor of Medicine Orlando, Florida October 7-9, 2011 80-Year-Old Patient Primary Prevention Issues in the Elderly: Coronary artery disease

More information

National Horizon Scanning Centre. Rituximab (MabThera) for chronic lymphocytic leukaemia. September 2007

National Horizon Scanning Centre. Rituximab (MabThera) for chronic lymphocytic leukaemia. September 2007 Rituximab (MabThera) for chronic lymphocytic leukaemia This technology summary is based on information available at the time of research and a limited literature search. It is not intended to be a definitive

More information

Clinical Overview: MRD in CLL. Dr. Matthias Ritgen UKSH, Medizinische Klinik II, Campus Kiel

Clinical Overview: MRD in CLL. Dr. Matthias Ritgen UKSH, Medizinische Klinik II, Campus Kiel Clinical Overview: MRD in CLL Dr. Matthias Ritgen UKSH, Medizinische Klinik II, Campus Kiel m.ritgen@med2.uni-kiel.de Remission in CLL Clinical criteria (NCI->WHO) Lymphadenopathy Splenomegaly Hepatomegaly

More information

BCH 447. Triglyceride Determination in Serum

BCH 447. Triglyceride Determination in Serum BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed

More information

Medical evidence suggests that

Medical evidence suggests that COMBINATION THERAPY TO ACHIEVE LIPID GOALS David G. Robertson, MD* ABSTRACT Coronary heart disease (CHD) remains the leading cause of death in the United States despite recent advances in treatment and

More information

Update on Dyslipidemia and Recent Data on Treating the Statin Intolerant Patient

Update on Dyslipidemia and Recent Data on Treating the Statin Intolerant Patient Update on Dyslipidemia and Recent Data on Treating the Statin Intolerant Patient Steven E. Nissen MD Chairman, Department of Cardiovascular Medicine Cleveland Clinic Disclosure Consulting: Many pharmaceutical

More information

Frequency of Dyslipidemia and IHD in IGT Patients

Frequency of Dyslipidemia and IHD in IGT Patients Frequency of Dyslipidemia and IHD in IGT Patients *Islam MS, 1 Hossain MZ, 2 Talukder SK, 3 Elahi MM, 4 Mondal RN 5 Impaired glucose tolerance (IGT) is often associated with macrovascular complications.

More information

Update: New Treatment Modalities

Update: New Treatment Modalities ASH 2008 Update: New Treatment Modalities ASH 2008: Update on new treatment modalities GA101 Improves tumour growth inhibition in mice and exhibits a promising safety profile in patients with CD20+ malignant

More information

Open questions in the treatment of Follicular Lymphoma. Prof. Michele Ghielmini Head Medical Oncology Dept Oncology Institute of Southern Switzerland

Open questions in the treatment of Follicular Lymphoma. Prof. Michele Ghielmini Head Medical Oncology Dept Oncology Institute of Southern Switzerland Open questions in the treatment of Follicular Lymphoma Prof. Michele Ghielmini Head Medical Oncology Dept Oncology Institute of Southern Switzerland Survival of major lymphoma subtypes at IOSI 1.00 cause-specific

More information

In the Know: Canadian Guidelines for Dyslipidemia, 2003

In the Know: Canadian Guidelines for Dyslipidemia, 2003 In the Know: Canadian Guidelines for Dyslipidemia, 2003 In his reviews of Canadian dyslipidemia guidelines, Dr. Curnew explores the impact of major trials, the assessment and categories of risk, and both

More information

Epidemiology of MDS. Rena Buckstein MD Co-Director MDS Research Program Odette Cancer Center

Epidemiology of MDS. Rena Buckstein MD Co-Director MDS Research Program Odette Cancer Center Epidemiology of MDS Rena Buckstein MD Co-Director MDS Research Program Odette Cancer Center Definition: Epidemiology The study of the distribution of diseases in populations and of factors that influence

More information

Younger patients with chronic lymphocytic leukemia benefit from rituximab treatment: A single center study in China

Younger patients with chronic lymphocytic leukemia benefit from rituximab treatment: A single center study in China 1266 Younger patients with chronic lymphocytic leukemia benefit from rituximab treatment: A single center study in China ZHENSHU XU, JINYAN ZHANG, SHUNQUAN WU, ZHIHONG ZHENG, ZHIZHE CHEN and RONG ZHAN

More information

CLL & SLL: Current Management & Treatment. Dr. Isabelle Bence-Bruckler

CLL & SLL: Current Management & Treatment. Dr. Isabelle Bence-Bruckler CLL & SLL: Current Management & Treatment Dr. Isabelle Bence-Bruckler Chronic Lymphocytic Leukemia Prolonged clinical course Chronic A particular type of white blood cell B lymphocyte Lymphocytic Cancer

More information

Making War on Cholesterol with New Weapons: How Low Can We/Should We Go? Shaun Goodman

Making War on Cholesterol with New Weapons: How Low Can We/Should We Go? Shaun Goodman Making War on Cholesterol with New Weapons: How Low Can We/Should We Go? Shaun Goodman Disclosures Research grant support, speaker/consulting honoraria: Sanofi and Regeneron Including ODYSSEY Outcomes

More information

What do the guidelines say about combination therapy?

What do the guidelines say about combination therapy? What do the guidelines say about combination therapy? Christie M. Ballantyne, MD Center for Cardiovascular Disease Prevention Methodist DeBakey Heart & Vascular Center Baylor College of Medicine Houston,

More information

Marshall Tulloch-Reid, MD, MPhil, DSc, FACE Epidemiology Research Unit Tropical Medicine Research Institute The University of the West Indies, Mona,

Marshall Tulloch-Reid, MD, MPhil, DSc, FACE Epidemiology Research Unit Tropical Medicine Research Institute The University of the West Indies, Mona, Marshall Tulloch-Reid, MD, MPhil, DSc, FACE Epidemiology Research Unit Tropical Medicine Research Institute The University of the West Indies, Mona, Jamaica At the end of this presentation the participant

More information

ΛΟΙΜΩΞΗ HIV. Ιγνάτιος Οικονομίδης,MD,FESC Β Πανεπιστημιακή Καρδιολογική

ΛΟΙΜΩΞΗ HIV. Ιγνάτιος Οικονομίδης,MD,FESC Β Πανεπιστημιακή Καρδιολογική ΛΟΙΜΩΞΗ HIV Ιγνάτιος Οικονομίδης,MD,FESC Β Πανεπιστημιακή Καρδιολογική Κλινική, Νοσοκομείο «Αττικόν» Infection Acute Myocardial Infarction p er 100,000 HIV/AIDS discharg es 800 700 600 500 400 300 200

More information

EVIDENCE IN BRIEF OVERALL CLINICAL BENEFIT

EVIDENCE IN BRIEF OVERALL CLINICAL BENEFIT well structured and organized, provided perc with a much deeper understanding of patients experiences with relapse or refractory CLL/SLL and its treatment. perc deliberated upon the cost effectiveness

More information