Study to explore the significance of saliva as a diagnostic tool to detect microrna in oral potentially malignant disorders

Transcription

1 Originl Article Study to explore the significnce of sliv s dignostic tool to detect microrna in orl potentilly mlignnt disorders T. N. Um Mheswri 1, M. S. Nivedhith 2 1 Deprtment of Orl Medicine nd Rdiology, Sveeth Dentl College nd Hospitls, Sveeth University, Chenni, Tmil Ndu, Indi, 2 Deprtment of Endodontics nd Conservtive Dentistry, Sveeth Dentl College nd Hospitls, Sveeth Institute of Medicl nd Technicl Sciences, Chenni, Tmil Ndu, Indi Correspondence: Dr. T. N. Um Mheswri, Deprtment of Orl Medicine nd Rdiology, Sveeth Dentl College nd Hospitls, Sveeth Institute of Medicl nd Technicl Sciences, Chenni, Tmil Ndu, Indi. E-mil: umsmsi@gmil.com ABSTRACT Orl crcinogenesis is complex multistep process nd there is need for discovery of novel iomrkers such s slivry microrna (mirna) for erly dignosis s 16 62% of OSCC develops from orl potentilly mlignnt disorders (OPMDs). Orl tissues re immersed in sliv; hence, sliv is non-invsive relile indictor for erly mlignnt chnges in orl epithelil precursor lesions. The role of mirna s signtures of crcinogenesis though well estlished in vitro nd in vivo, there re no studies evluting the expression of slivry mirna in Indin popultion. This study is the forerunner to study more genomic novel mrkers in sliv proving the dignostic potentil of sliv mirna in erly dignosis of mlignncy. The study minly ims in evluting whether sliv eing non-invsive dignostic fluid cn e used s relile source to study mirna expression minly mirna 21 nd mirna 31 s iomrker to detect erly dysplstic chnges in OPMDs. The study hd proved tht mirna 21 nd 31 re definitely expressed in oth control nd OPMDs in sliv, nd there is significnt downregultion of gene expression seen in OPMDs with verge fold expression of mirna 21 clculted s (P = 0.016) nd verge fold expression of mirna 31 s (P = 0.014). Keywords: Erly dysplsi, microrna 21, microrna 31, novel genomic mrker, slivry microrna Introduction Clinicins hve reported tht the min prolem encountered in orl cncer is the lte dignosis leding to lymphtic spred nd recurrence. Recent literture hs reported tht clinicl nd pthologicl vriles cnnot ssess erly mlignnt chnges in orl precursor lesions. [1] There re thousnds of genes trnscriing messenger RNA, microrna (mirna), etc. Hence, cncer development is multistep complex process demnding the need for identifiction of novel iomrkers such s mirna which hve een proved in recent studies tht they re the signtures of orl crcinogenesis. [2] Orl tissues re immersed in sliv; hence, recent studies hve proved Access this rticle online Wesite: E-ISSN: How to cite this rticle: Mheswri TNU, Nivedhith MS. Study to explore the significnce of sliv s dignostic tool to detect microrna in orl potentilly mlignnt disorders. J Adv Phrm Edu Res 2017;7(3): Source of Support: Nil, Conflict of Interest: None declred. tht sliv is not just surrogte mrker ut hs proved to e more significnt in expressing iomrker. [3,4] Slivry mirna expression studies will e helpful in erly dignosis nd prevention of mlignnt trnsformtion of orl potentilly mlignnt disorders (OPMDs). [5] Null hypothesis of the current reserch suggests tht there is no significnt difference in expression of slivry mirna 21 nd 31 etween control nd OPMDs nd lternte hypothesis suggests significnt difference in expression of slivry mirna 21 nd 31 etween control nd OPMDs. Aim The present dignostic study ims t evluting the expression of slivry mirna 21nd 31 in OPMDs. Ojectives 1. To evlute whether mirna is expressed in sliv. 2. To study the expression of slivry mirna 21 nd 31 in vrying dysplstic OPMDs. 3. To evlute whether there is significnt difference in expression of slivry mirna etween helthy nd vrying degree of dysplstic lesions This is n open ccess journl, nd rticles re distriuted under the terms of the Cretive Commons Attriution-NonCommercil-ShreAlike 4.0 License, which llows others to remix, twek, nd uild upon the work non-commercilly, s long s pproprite credit is given nd the new cretions re licensed under the identicl terms Journl of Advnced Phrmcy Eduction & Reserch Pulished y SPER Pulictions

2 Mheswri nd Nivedhith: Slivry mirna in OPMD Mterils nd Methods Mterils Smple size ws clculted using G Power softwre using single men smple size determintion nd ws clculted s 18 per group for power of 80%. Judgement smpling s OPMDs ws exmined cliniclly initilly nd then included in the study. Initilly, pilot study fter ethicl clernce [032/02/2017/IEC/SU] ws strted with 10 smples including five control nd five test smples to evlute whether mirna expression occurs in sliv. Inclusion criteri include OPMDs, nmely, orl leukoplki, orl lichen plnus, nd orl sumucous firosis. Exclusion criteri include ptients who re undergoing tretment for OPMDs. Figure 1: () Orl sumucous firosis with leukoplki, () hyperkertosis with mild dysplsi Methods Smple collection Unstimulted whole sliv from the prticipnts ws collected etween 6 nd 11 m fter providing ptient informtion sheet nd otining informed consent duly signed y the prticipnt. Prticipnts were sked to refrin from eting, drinking, or pplying orl hygiene procedures on the dy of sliv collection. Prticipnts were instructed to mouth rinse with wter efore collection to void contmintion. Sliv smples were collected using spitting method nd 8 10 ml ws collected in 50 ml flcon tue kept on dry ice. Sliv processing Sliv centrifugtion t 2600 g 15 min 4 C ws done to otin superntnt sliv followed y RNA extrction done using RNse inhiitor. Smples were liquoted in 440 µl nd stored t 80 C until further use. Slivry totl RNA isoltion y RNesy kit (Qigen) ccording to the mnufcturer s protocol from the sme mount of collected sliv for ech suject ws done using Nnodrop spectrophotometer for quntifiction of the extrcted RNA. Tqmn mirna Reverse Trnscription in mster mix ws prepred in polypropylene tue y scling the volumes to the desired numer of RT rections. Centrifugtion nd the RT mster mix were plced on ice until mirna rection nd nontemplte control in rection ws used in the rection setup to void contmintion during rection nd lso to confirm the non-specific mplifiction for study of mirna expression, nmely, hs-mir-21-5p MIMAT UAGCUUAUCAGACUGAUGUUGA, hs-mir- 31-5p (AGGCAAGAUGCUGGCAUAGCU), nd hs-mir-16-5p MIMAT UAGCAGCACGUAAAUAUUGGCG. MiRNA 16-5p ws used s reference gene nd mirna 21-5p nd mirna 31-5p were the trget genes. [6] Results The dignostic study hs proved the significnt difference with downregulted expression of slivry mirna in ll OPMDs (PMD) with mild dysplsi cses when compred to helthy control smples. Cliniclly dignosed nd histopthologiclly investigted cses were lone included in the study [Figures 1-5]. The demogrphic dt, dverse hits, nd histopthologicl fetures of the test smples Figure 2: () Verrucous leukoplki, () verrucous hyperplsi Figure 3: () Cndidl leukoplki, () hyperkertosis with mild dysplsi Figure 4: () Orl sumucous firosis (OSMF), () dvnced OSMF with mild dysplsi with leukoplki re tulted [Tle 1]. The CT vlue or cycle threshold defines the numer of cycles required for the fluorescent signl to cross the threshold. [7] The verge CT vlues of slivry mirna 21 nd 31 in control versus OPMDs were clculted for ll the smples [Tles 2 nd 3] nd delt CT vlues were clculted y evluting the difference in CT vlues of trget genes in ech of the smples with tht of the reference gene nd compred etween control nd test smples [Grphs 1 nd 2]. The fold expression revels tht slivry mirna is significntly downregulted in test smples when compred to control with P = for mirna 21 nd P = for mirna 31 proving the significnce of study of slivry mirna in dignosing erly dysplstic chnges in OPMDs [Tle 4] verge CT vlues of mirna 21 (36.84) when compred to mirna 31 (39.99) in test smples Journl of Advnced Phrmcy Eduction & Reserch Jul-Sep 2017 Vol 7 Issue 3 279

3 Mheswri nd Nivedhith: Slivry mirna in OPMD Figure 5: () Orl sumucous firosis (OSMF), () OSMF with mild epithelil dysplsi Grph 1: Delt CT vlues of slivry microrna 21 in control nd orl potentilly mlignnt disorders Figure 6: Risk of is chrt of six studies included in systemtic review done using RevMn 5.3 Grph 2: Delt CT vlues of slivry microrna 31 in control nd orl potentilly mlignnt disorders proves tht expression of slivry mirna 21 is more significnt s lesser the CT vlues higher the expression [Grphs 3 nd 4]. Discussion MiRNA in sliv s vile mrker for orl crcinom ws first developed in [8] A systemtic review ws first done efore strting the pilot study to evlute the significnce of slivry mirna in OPMDs. Around 574 studies were identified from we serch, from which fter pplying humn filter 197 studies were otined. 2 studies were identified from mnul serching, so totl of 199 studies were retrieved. 175 studies were excluded fter pplying the inclusion (studies done in slivry microrna of OPMDs nd orl cncer) nd exclusion criteri (studies done in mirna of serum, plsm or tissues of oth OPMDs, nd orl cncers). A totl of six studies, tht were done in the sliv smples of OPMDs nd orl cncer were included in the systemtic review. [6] Two studies Momen et l. nd Zhrn et l. hve proved with sttisticl evidence of sensitivity nd specificity for four slivry mirnas, nmely, mirna 27, mirna 145, mirna 181, nd mirna 21. [9,10] There is only one study tht hs compred the sliv smples with the tissue smples nd hs Grph 3: Comprison of fold expression of slivry microrna 21 nd 31 concluded tht sliv smples re significnt predictors thn tissue nd mirna 31 is significnt mrker thn mirna 21 in sliv smples of OPMDs. [11] The systemtic review concluded tht five mirnas, nmely, mirna-31, mirna-24, mirna-27, mirna-21, mirna-184 re upregulted nd 15 mirnas, nmely, mirna-200, mirna-125, mirna-11, mirna-191, mirna-136, mirna-147, mirna-1250, mirna-632, mirna-646, mirna-668, mirna-877, mirna-503, mirna-200, mirna-323-5, nd mirna-145 re downregulted 280 Journl of Advnced Phrmcy Eduction & Reserch Jul-Sep 2017 Vol 7 Issue 3

4 Mheswri nd Nivedhith: Slivry mirna in OPMD Tle 1: Demogrphic, tocco history, nd histopthologicl dt of PMD cses Code no Age/sex Tocco history Dignosis Histopthology report T1 56/M Slked lime nd etel nut 4 times/ dy for 30 yers Orl sumucous firosis in the right nd left uccl mucos, homogeneous orl leukoplki in the left uccl mucos Hyperorthokertinized strtified epithelium of vrile thickness with mild epithelil dysplsi nd dvnced orl sumucous firosis T2 33/M Betel nut 8 10 pckets/dy for 5 yers Verrucous leukoplki T3 36/M Beedi smoking 15/dy for 10 yers Cndidl leukoplki in the left nd right uccl mucos T4 37/M Mw chewing 5 pckets/dy for Orl sumucous firosis in the right nd left uccl 16 yers mucos, orl leukoplki in the right nd left uccl mucos Hyperprkertosis with shrp rete pegs prkertin plugging with epithelil hyperplsi suggestive of verrucous hyperplsi Hyperkertosis with mild epithelil dysplsi Prkertinized strtified squmous epithelium with trophic nd loss of rete pegs ilterlly suggestive of dvnced orl sumucous firosis with mild epithelil dysplsi T5 64/M Pn chewing 3 4 pckets/14 yers Orl sumucous firosis in the left uccl mucos Orl sumucous firosis with mild epithelil dysplsi Tle 2: CT nd delt CT vlues of slivry mirna 21 in control nd OPMDs (PMD) Smple Gene CT Smple Gene CT Delt CT CON1 mir_16p CON1 mir_21p CON2 mir_16p CON2 mir_21p CON3 mir_16p CON3 mir_21p CON4 mir_16p CON4 mir_21p CON5 mir_16p CON5 mir_21p Averge T1 mir_16p T1 mir_21p T2 mir_16p T2 mir_21p T3 mir_16p T3 mir_21p T4 mir_16p T4 mir_21p T5 mir_16p T5 mir_21p Averge OPMDs: Orl potentilly mlignnt disorders, MiRNA: microrna Tle 3: CT nd delt CT vlues of slivry mirna 31 in Control nd OPMDs (PMD) Smple Gene CT Smple Gene CT Delt CT CON1 mir_16p CON1 mir_31p CON2 mir_16p CON2 mir_31p CON3 mir_16p CON3 mir_31p CON4 mir_16p CON4 mir_31p CON5 mir_16p CON5 mir_31p Averge T1 mir_16p T1 mir_31p T2 mir_16p T2 mir_31p T3 mir_16p T3 mir_31p T4 mir_16p T4 mir_31p T5 mir_16p T5 mir_31p Averge OPMDs: Orl potentilly mlignnt disorders, MiRNA: microrna in orl squmous cell crcinom when compred to helthy control. 11 mirnas tht re deregulted in orl squmous cell crcinom were lso found to e deregulted in OPMDs when compred to helthy control [9-14] nd mirnas, 21 nd 31, hve een nlyzed repetedly. [10,11,13,14] Three studies hve unnimously proved mirna 31 nd mirna 21 [10,11,13] to e elevted in orl squmous cell crcinom. The men nd SD clculted y Zhrn et l., in 2015, for mirna 21 in orl cncer group ws with 65% sensitivity nd specificity nd AUC: [10] Hung et l. reported 100% sensitivity with AUC Grph 4: Comprison of slivry microrna 21 nd 31 expression in orl potentilly mlignnt disorders s 0.73 for slivry microrna 21. Similrly, Liu et l., in 2012, hve reported tht slivry mirna 31 ws elevted in orl cncer with men of 8.3, 100% specificity with AUC s 0.71 nd no significnt increse in orl verrucous leukoplki cses. [13] Study done y Al- Mlkey et l., in 2015, [14] proved sttisticlly significnt rise in slivry microrna 31 in orl cncer with men of versus control men s Hung et l. reported 100% sensitivity with AUC s for slivry microrna 31 nd in this study oth mirna 21 nd 31 were studied in tissue nd sliv with significnt increse in mirna 31 in dysplstic epithelium. All six studies hve used RT-qPCR to quntify slivry mirna, while one of it uses nnostring mirna expression ssy long with RT-qPCR. [9-14] These six studies were ssessed for their qulity using QUADAS tool 2. Qulity ssessment of dignostic ccurcy studies hs four domins, nmely, ptient smpling, index test, reference stndrd nd flow nd timing. Ech of these domins hd two to four questions which were nswered s yes, no, or uncler. [15] This dt were fed into Review mnger softwre, nmely, in RevMn 5.3 to otin color-coded chrt of risk of is nd pplicility concern [Figure 6]. However, one study y Zhrn et l. proved to e of low risk of is hving predetermined cut off vlue for the mirna efore the onset of the study. The sme study hs proved tht upregulted mirna 21 nd downregulted mirna 145 re mrkers for detecting OPMDs with dysplsi, OPMDs without dysplsi, nd orl squmous cell crcinom. [10] In contrst to these findings, the present study results revel sttisticlly Journl of Advnced Phrmcy Eduction & Reserch Jul-Sep 2017 Vol 7 Issue 3 281

5 Mheswri nd Nivedhith: Slivry mirna in OPMD Tle 4: Slivry mirna 21 nd 31 fold expression in OPMDs (PMD) Slivry MiRNA Control Averge CT nd PMD Averge CT nd Delt CT Fold expression 2 Ct P verge delt CT verge delt CT Ct= Ct (PMD) Ct (control) = P (0.016) = P (0.014) OPMDs: Orl potentilly mlignnt disorders, MiRNA: microrna significnt downregultion of oth mirna 21 nd 31 in test smples when compred to control nd verge CT vlues of slivry mirna prove tht comprtively mirna 21 is etter expressed in sliv thn mirna 31. Erlier studies were done in Cucsin, Asin, Africn, Tiwn, Irq, nd Aric popultions proving the demnd for such dignostic studies in Indin popultion. Conclusion The dignostic study of expression of slivry mirna in OPMDs hs proved tht slivry mirna cn e used s iomrker s there is n expression of oth reference gene [mir_16p] nd trget genes [mir_21p nd mir_31p] in oth control nd in OPMDs. Down-regulted gene expression in Indin popultion is significnt rcil difference s upregultion of these trget genes hve een studied in other popultions such s Cucsin, Asin, Africn, Tiwn, Irq, nd Aric. Sttisticl test of significnce revels tht mir_31p (P = 0.014) nd mir_21 p (P = 0.016) shows definitive down-regulted expression fold difference in OPMDs compred to control smples. The results of this pilot study proves the demnd for expnding the reserch not only y incresing the smple size ut lso studying the expression in moderte nd in severe dysplsi cses to nlyze the correltion of expression fold of mir _21 p nd mir_31p in vrying degree of dysplsi cses. References 1. Yng CC, Hung PS, Wng PW, Liu CJ, Chu TH, Cheng HW, et l. MiR-181 s puttive iomrker for lymph-node metstsis of orl squmous cell crcinom. J Orl Pthol Med Off Pul Int Assoc Orl Pthol Am Acd Orl Pthol 2011;40: Cervigne NK, Reis PP, Mchdo J, Sdikovic B, Brdley G, Glloni NN, et l. Identifiction of microrna signture ssocited with progression of leukoplki to orl crcinom. Hum Mol Genet 2009;18: Ngler RM. Sliv s tool for orl cncer dignosis nd prognosis. Orl Oncol 2009;45: Shpitzer T, Hmzny Y, Bhr G, Feinmesser R, Svulescu D, Borovoi I, et l. Slivry nlysis of orl cncer iomrkers. Br J Cncer 2009;101: Cheng YS, Rees T, Wright J. A review of reserch on slivry iomrkers for orl cncer detection. Clin Trnsl Med 2014;3:3. 6. Rinnerthler G, Hckl H, Gmpenrieder SP, Hmcher F, Hufngl C, Huser- Kronerger C, et l. MiR-16-5p is stly-expressed housekeeping microrna in rest cncer tissues from primry tumors nd from metsttic sites. Int J Mol Sci 2016;17:156; doi: /ijms Sog D, Yoshi S, Shiogm S, Miyzki H, Kondo S, Shintni S, et l. MicroRNA expression profiles in orl squmous cell crcinom. Oncol Rep 2013;30: Avissr M, Christensen BC, Kelsey KT, Mrsit CJ. MicroRNA expression rtio is predictive of hed nd neck squmous cell crcinom. Clin Cncer Res 2009;15: Momen-Hervi F, Trchtenerg AJ, Kuo WP, Cheng YS. Genomewide study of slivry micrornas for detection of orl cncer. J Dent Res 2014;93:86S-93S. 10. Zhrn F, Ghlwsh D, Shker O, Al-Johni K, Scully C. Slivry micrornas in orl cncer. Orl Dis 2015;21: Hung KF, Liu CJ, Chiu PC, Lin JS, Chng KW, Shih WY, et l. MicroRNA-31 upregultion predicts incresed risk of progression of orl potentilly mlignnt disorder. Orl Oncol 2016;53: Prk NJ, Zhou H, Elshoff D, Henson BS, Kstrtovic DA, Aemyor E, et l. Slivry microrna: Discovery, chrcteriztion, nd clinicl utility for orl cncer detection. Clin Cncer Res 2009;15: Liu CJ, Lin SC, Yng CC, Cheng HW, Chng KW. Exploiting slivry mir- 31 s clinicl iomrker of orl squmous cell crcinom. Hed Neck 2012;34: Al-Mlkey MK, As AA, Khlf NF, Murk IA, Jsim IA. Expression nlysis of slivry microrn-31 in orl cncer ptients. Int J Curr Microiol App Sci 2015;4: Whiting PF, Rutjes AW, Westwood ME, Mllett S, Deeks JJ, Reitsm JB, et l. Qud 2: A revised tool for the qulity ssessment of dignostic ccurcy studies. Ann Intern Med 2011;155: Journl of Advnced Phrmcy Eduction & Reserch Jul-Sep 2017 Vol 7 Issue 3