Supplementary Material for
|
|
- Domenic Holmes
- 5 years ago
- Views:
Transcription
1 Supplementary Material for Parathyroid Hormone Signaling through Low-density-lipoprotein-related Protein 6 Mei Wan, Chaozhe Yang, Jun Li, Xiangwei Wu, Hongling Yuan, Hairong Ma, Xi He, Shuyi Nie, Chenbei Chang, Xu Cao To whom correspondence should be addressed. mwan@uab.edu; and Cao@uab.edu This PDF file includes Supplementary Materials and Methods Supplemental figures 1-7 1
2 Supplementary Materials and Methods In vitro kinase assays. GST, GST-LRP5C and GST-LRP6C were purified from bacterial lysates by absorption to glutathione-agarose beads. GST-LRP5C and GST-LRP6C beads were washed with phosphorylation buffer (25 mm Tris-HCl, ph 7.5, 1 mm MgCl 2, 2 mm MnCl 2,.4 mm EDTA, 1 mm dithiothreitol, 2 mm orthovanadate, 1 mm NaF, 5 mm β-glycerophosphate, and 1 μm ATP) containing a protease inhibitor mixture (1 mm phenylmethylsulfonyl fluoride and 1 μg/ml antipain, chymostatin, leupeptin, and pepstatin A). [γ 32 P]ATP was then added to the mixture and incubated for 3 min at 3 C with PKA catalytic subunit. Phosphorylation status was analyzed on an 8.5% SDS-PAGE gel and autoradiography. Animals. In the intermittent injection model, PTH (1-34) (4µg/kg per day) or vehicle (equivalent volume of 1mM acetic acid in sterile PBS) in a final volume of 1µl was given daily by subcutaneous injection for 6 weeks to two-month-old male C57BL/J6 mice (6 per group). In the continuous infusion model, ALZET Osmotic Pumps (Model 24, DURECT Corp., Cupertino, CA, USA) were implanted subcutaneously into the backs of mice under anesthesia. Continuous infusion of PTH (1-34) or vehicle (equivalent volume of 1mM acetic acid in sterile PBS) was conducted to release 4µg/kg per day at the rate of.25µl/h for 6 weeks. To ensure continuous administration of active PTH (1-34), the original pump was removed and replaced by a new one in a different subcutaneous site every 2 weeks. Analysis of bone phenotype and histomorphometric analysis. Bone radiographs of excised femora and tibia were obtained using a soft X-ray apparatus (FAXITRON, wheeling, Illinois, USA). For histological analyses, the proximal tibia were resected and fixed in 1% buffered formalin for 48 h, decalcified in 1% ethylenediamine tetraacetic acid (EDTA) (ph 7.) for 2 days and embedded in paraffin. 5-μm thick longitudinally oriented sections of bone including metaphysis and diaphysis were processed for hematoxylin and eosin (H&E) staining. For double labeling, mice were given subcutaneous injections of demeclocycline (Sigma, St. Louis, MO, USA) at a dose of 2 mg/kg (in bacteriostatic water, ph 7.3) and calcein (Sigma, St. Louis, MO, USA) at dose of 1 mg/kg (in 2% sodium bicarbonate solution) 1 days and 3 days, respectively, before sacrifice. 1-μm thick nondecalcified sections of bone were processed for the dynamic analysis. 2
3 Sections were subjected to microphotography as the basis for histomorphometric measurements and the quantitative histomorphometric analyses were conducted in a blinded fashion with OsteoMeasure Software (OsteoMetrics Inc., Decatur, GA, USA). Two/three-dimensional parameters of trabecular bone of femur were measured in a 2-mm square, 1 mm distal to the lowest point of the growth plate in the secondary spongiosa. Bone volume (BV/TV, %) and Bone surface referent bone formation rate (BFR/BS, μm 2 /μm/day) were measured in four randomly selected visual fields per specimen, in a total of six specimens in each group. 3
4 Supplementary Figures A PTH (1-84) min β-catenin α-tubulin B Ratio of β-catenin/α-tubulin C β-catenin α-tubulin D Ratio of β-catenin/α-tubulin Con (M) Figure 1. Activation of β-catenin signaling by PTH in HEK293 cells. (A) Stabilization of β-catenin in HEK293 cells treated with 1-8 M PTH (1-84). Cells were transfected with PTH1R, serum deprived and treated with PTH for various times. Cytosolic fractions were prepared for detection of β-catenin by western blot. (B) Densitometric quantification of β-catenin protein as shown in (A). (C) Dose-dependent effect of PTH on β-catenin stabilization. Cells were transfected with PTH1R, serum deprived and treated with various doses of PTH (1-84) for 1h. Cytosolic fractions were prepared for detection of β-catenin levels by western blot. (D) Densitometric quantification of β-catenin protein as shown in (C). 4
5 A B C Osteoblasts containing β-catenin (%) ** ** * * Control.5h 2h 8h PTH 24h Figure 2. PTH single dose injection elevated β-catenin level in osteoblasts in mice. Immunohistochemical analysis of β-catenin level in tibia sections from 2-month-old male mice at the indicated time points after PTH (1-34) (2 μg/kg) injection. Representative of tissue sections obtained at different times after PTH injection and immunohistochemically stained for β-catenin and counterstained with hematoxylin. β-catenin-positive osteoblasts were stained in brown (A). β-catenin-positive osteoblasts were counted in a blinded fashion from three random high power fields per specimens in a 2-mm square, 1 mm distal to the lowest point of the growth plate in the secondary spongiosa, and a total of six specimens in each group were used. The quantification of β-catenin-positive osteoblasts is presented as percentage of total osteoblasts (B). *:p<.5; **:P<.1 (in comparison with control), n=6. 5
6 VSVG-LRP PTH (1-84) IP: Axin1 Blot: VSVG IP: VSVG Blot: VSVG Slerostin CM DKK1 CM Figure 3. Soluble Sclerostin and DKK1 inhibits PTH-induced axin-lrp6 binding. HEK 293 cells were transfected with PTH1R and VSVG-tagged LRP6 and treated with Sclerostin CM or DKK1 CM followed by treatment of 1-8 M PTH (1-84) for 3 min. The axinassociated LRP6 was determined by western blotting of the anti-axin1 immunoprecipitates. 6
7 sigfp silrp PTH (1-34) p-erk1/2 Total Erk1/2 p-creb Total CREB LRP6 Figure 4. Inhibitory effect of silrp6 on PTH-induced ERK1/2 and CREB phosphorylation. C2C12 cells expressing sigfp (control) or silrp6 together with PTH1R were treated with or without PTH (1-34) for 15 min, and lysates were analyzed by immunoblotting using antibodies specifically recognizing perk1/2, total ERK1/2, pcreb (Ser 133 ), total CREB and LRP6. 7
8 A B b 4 2. ** BV/TV (%) ** BFR/BS (μm 2 /μm/d) Vehicle PTH Vehicle PTH Intermittent Injection BV/TV (%) Vehicle PTH BFR/BS (μm 2 /μm/d) Vehicle PTH Continuous Infusion C 8
9 Figure 5. PTH intermittent injection increases, whereas PTH continuous infusion decreases the levels of β- catenin and phosphorylated LRP6 in osteoblasts in the mouse femurs. (A) PTH intermittent injection increases, whereas PTH continuous infusion decreases osteoblast formation and bone density. (i) Bone densities of distal femurs of mice by X-ray imaging after PTH (1-34) (4μg/kg) daily injection or continuous infusion for 6 weeks. (ii) Histological analyses of bone formation with HE-stained tibia longitudinal sections. (iii) Mineral apposition analyses by demeclocycline and calcein double labeling of trabecular bone. (B) Bone and histomorphometric indices were measured at the trabecular of the distal femur after PTH (1-34) daily injection or continuous infusion for 6 weeks. Total bone volume per tissue volume (BV/TV, %) and bone formation rate relative to bone surface (BFR/BS) were calculated. *:p<.5; **:P<.1 (in comparison with control), n=6. (C) Immunohistochemical staining of β-catenin (upper panel) and phosphorylated LRP6 (lower panel) counterstained with hematoxylin of consecutive sections from metaphyseal area of distal femurs of mice after treatment with vehicle control or PTH (1-34) through either daily injection (4µg/kg/day) or continuous infusion (4µg/kg/day) for 6 weeks. 9
10 A GST GST-LRP5C GST-LRP6C B PKA KD 116KD 93KD 53KD 37KD 29KD Non-specific GST-LRP5C GST-LRP6C GST Figure 6. Phosphorylation of LRP6 intracellular domain by PKA in vitro. (A) GST (Lane 1 and 2), GST-LRP5 (Lane 3 and 4), and GST-LRP6 (Lane 6 and 7) were incubated with [γ 32 P]ATP and PKA catalytic subunit for 3 min at 3 C. Phosphorylation status was analyzed on an 8.5% SDS-PAGE gel and autoradiography. Lane 5, molecular weight marker. (B) Purified GST (Lane 2), GST-LRP5 (Lane 3), and GST-LRP6 (Lane 4) showing on Commassie Blue gel. Lane 1, molecular weight marker. 1
11 HA- LRP5 VSVG- LRP6 Vehicle Forskolin (5µM) IP: axin1 Blot: HA WCL Blot: HA IP: axin1 Blot: VSVG WCL Blot: VSVG Figure 7. Effect of forskolin on LRP5-axin and LRP6-axin binding. HEK293 cells were transfected with PTH1R and HA-tagged LRP5 or VSVG-tagged LRP6. Cells were then treated with indicated vehicle or forskolin for 3min. The LRP5- or LRP6- associated axin was determined by Western blotting of the anti-axin1 immunoprecipitates. 11
Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.
Supplemental figures and figure legends (957-INS-RG-RV-) Supplemental Figure. A B.5.5 Interaction p=.89 Model p
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More information1. Supplementary Prevention Experiment Additional Results
1. Supplementary 1. 1. Prevention Experiment Additional Results Figure 1 presents the NMR measurements of tibiae and femurs bones, which were measured 6 weeks post operation at the central zone of bone
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationMEK1 Assay Kit 1 Catalog # Lot # 16875
MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationOn Line Data Supplement
On Line Data Supplement Chemicals and Other Materials [γ- 32 P]ATP, L-[ 35 S]methionine, L-[ 3 H]leucine, m 7 GTP-Sepharose, glutathione- Sepharose 4B and ECL reagents were purchased from Amersham Pharmacia
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationTumor stage : I II III IV. well differentiated. moderately differentiated. adenocarcinoma. normal colon (adjacent to cancer) Log (T/H) SLAP mrna level
moderately differentiated well differentiated Log (T/H) mrna level a Tumor stage : I II III IV.4.4.8 1.2 1.6 2. 2.4 2.8 3.2 N 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 # patient b normal colon (adjacent
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationControl GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationAPPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation.
APPENDIX 1 Preparation of reagents 1.1. Preparation of dosing solution Nonylphenol 15 mg of Nonylphenol was dissolved in olive oil (10 ml) and used as stock solution. The stock solution was serially diluted
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationORS 2015 Annual Meeting (Orthopedic Research Society)
ORS 2015 Annual Meeting (Orthopedic Research Society) Poster No: 1045 CERAMENT Bone Void Filler Impregnated with Gentamicin Increases Bone Formation and Decreases the Rate of Detectable Infection after
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationArgininosuccinate synthetase 1 suppression and arginine restriction inhibit cell
Argininosuccinate synthetase 1 suppression and arginine restriction inhibit cell migration in gastric cancer cell lines Yan-Shen Shan 1, Hui-Ping Hsu 1, Ming-Derg Lai 2,3, Meng-Chi Yen 2,4, Wei-Ching Chen
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationDramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its
Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,
More informationEffects of Whole Body Exposure to Electromagnetic Field on Normal and Osteoporotic Bone Metabolism in Rats
Effects of Whole Body Exposure to tromagnetic Field on Normal and Osteoporotic Bone Metabolism in Rats S. Fukuda and H. Iida National Institute of Radiological Sciences, Chiba 263-8 Japan INTRODUCTION
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationGinkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells
Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells Zhuhong Zhang 1, Si Chen 2, Hu Mei 3, Jiekun Xuan 2, Xiaoqing Guo 1, Letha Couch 2, Vasily N.
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More informationSupporting Information
Supporting Information Muraski et al. 10.1073/pnas.0709135105 SI Text Generation of Transgenic Animals. Pim-WT and Pim-DN cdnas were subcloned NheI/SmaI from pegfp-c1 Pim-1 and pegfp-c1 Pim-DN plasmids
More informationMicrostructural changes in the bone tissue and in the bone callus of diabetic rats with and without insulin treatment
Microstructural changes in the bone tissue and in the bone callus of diabetic rats with and without insulin treatment A. Zamarioli 1, M.S. Campos 1, A. Guimarães 1, M. Butezloff 1, G.B. Leoni 2, M.D. Sousa-Neto
More informationFor the rapid, sensitive and accurate quantification of Ras in various samples
ab128504 Ras Assay Kit Instructions for Use For the rapid, sensitive and accurate quantification of Ras in various samples This product is for research use only and is not intended for diagnostic use.
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationSupplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationAMPK Phosphorylation Assay Kit
AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More information