The Application of Cell-Based Impedance Technology in Drug Discovery

Size: px
Start display at page:

Download "The Application of Cell-Based Impedance Technology in Drug Discovery"

Transcription

1 The Application of Cell-Based Impedance Technology in Drug Discovery Yama A. Abassi, PhD Sr. Director Cell Biology and Assay Development ACEA Biosciences

2 ACEA Biosciences Founded in early Located in San Diego, CA Mission: Integration of microelectronics with cell biology and molecular biology for providing innovative and cost-effective microelectronic biological analysis systems and applications for life science industry and clinical diagnostics ACEA s first product was marketed under the brand name of RT-CES system in In November of 7 Roche and ACEA Biosciences entered into an exclusive agreement for the development, supply and distribution for ACEA Bioscience s real-time cell assay technology. Under the terms of the agreement, RAS will exclusively market systems for real-time cell analysis, based on ACEA Bioscience's impedance-based technology The first joint Roche/ACEA product is marketed under the brand name of xcelligence

3 xcelligence RTCA SP System Computer and Software E-Plate Analyzer Plate Reader(RTCA SP) (in C incubator) Gold Microelectrode Covers 8% of Well Area

4 Electronic Sensor Technology Applied to Cell Biology: Principle of peration Derivation of Cell Index A dimensionless parameter termed Cell Index (CI) is derived as a relative change in measured electrical impedance to represent cell status. Several features of the CI are summarized:. When cells are not present or are not well-adhered on the electrodes, then the CI is zero. Under the same physiological conditions when more cells are attached on the electrodes, then the CI values are larger. Thus, CI is a quantitative measure of cell number present in a well.. Additionally, change in a cell status, such as cell morphology, cell adhesion or cell viability will lead to a change in CI.

5 Advantages of xcelligence System for Cell-Based Assays and Drug Discovery Applications Label free, no reporters Non-invasive measurement Real-time Monitoring -Short-term (milliseconds) -Long-term (days and weeks) Continuous QC

6 Cell-based Assays: Traditional Methods Seed cells Treatment: e.g.: drug compound Traditional methods: Labeling (e.g. optical) & End-point Measurement Initiate Experiment 8- Hours Black Box -8 Hours - Hours Data Analysis

7 Cell-based Assays: Traditional Methods vs xcelligence System Seed cells Treatment: e.g.: drug compound Traditional methods: Labeling (e.g. optical) & End-point Measurement Initiate Experiment Normalized Cell Index Hours -8 Hours - Hours Control Cmpd A Cmpd B Cmpd C Cmpd D Treatment Data Analysis Time (Hours) Continuous QC xcelligence System : Label-free: Electronics-based detection Real-time: Continuous measurement, data analysis and display Therefore, both short term and long term compound effects can be captured

8 Applications Developed on the xcelligence System Cell Proliferation Cell Quality Compound-mediated Cytotoxicity Cell-mediated Cytotoxicity Cell Adhesion and Spreading Functional Monitoring of Receptor Tyrosine Kinase Signaling Functional Monitoring of GPCR Signaling IgE Receptor Function Cell Invasion and Migration Barrier Function Viral Cytopathogenecity

9 Applications Developed on the xcelligence System Cell Proliferation Cell Quality Compound-mediated Cytotoxicity Cell Response Profiling Cell-mediated Cytotoxicity Cell Adhesion and Spreading Functional Monitoring of Receptor Tyrosine Kinase Signaling Functional Monitoring of GPCR Signaling IgE Receptor Function Cell Invasion and Migration Barrier Function Viral Cytopathogenecity

10 Time-Dependent Cell Response Profiling

11 The Road to Cellular Cytotoxicity Takes Many Twists and Turns Normalized Cell Index DMS.5 um.5 um.5 um um um um 8 um um. um. um.7 um.6 um Proteasome Inhibitor Anti-Mitotic N-Glycosylation Inhibitor um". um. um. um Control Tunicamycin um DNA Damaging 6 8

12 Are Impedance-Based Cell Response Profiles Predictive of Biological Mechanism?

13 H H H TCRP Approach E-Plate Add Cells Monitor - hours Add Compound Monitor 8 hours Interdigitated gold microelectrodes Real-Time Continuous Monitoring Impedance-based real-time cellular response profile Seed A59 Cancer Cells in 96 well E-Plates Treat with Compounds at a final concentration f μm Spectrum Compound Library from MS Discovery (Collection of FDA approved drugs, nature compounds Experimental compounds, insecticides and herbicides) Monitor the cellular response for 8 hours Compare cytological profiles

14 Hit Selection and Clustering Analysis TCRP from Screen Short-term response (w/in hour) Long Term Response (-8 hours) Hit criteria (5% of control) Hit criteria (5% and %)

15 TCRP with Known Mechanisms Short-Term Response Anti-Histamine Azelastine 6 8 Serotonin Receptor Antagonist 5 Methiothepin 6 8 L-Type Voltage-gated Ca Channel Inhibitor Amlodipine Colchicine 6 8 Etoposide Anti-mitotics DNA Damaging Long-Term Response HDAC Inhibitors Trichostatin A Emetine 6 8 Hydrocortisone 6 8 Protein-Synthesis Nuclear Hormone 6 8

16 TCRP with Known Mechanisms Short-Term Response Anti-Histamine Azelastine 6 8 Serotonin Receptor Antagonist 5 Methiothepin 6 8 L-Type Voltage-gated Ca Channel Inhibitor Amlodipine Colchicine 6 8 Etoposide Anti-mitotics DNA Damaging Long-Term Response HDAC Inhibitors Trichostatin A Emetine 6 8 Hydrocortisone 6 8 Protein-Synthesis Nuclear Hormone 6 8

17 TCRP of Anti-mitotic Compounds

18 Characterization of Impedance- Based Anti-mitotic Profile 6 h (Phase I) h (Phase II) h (Phase III) 8 h (Phase IV) Mitotic Index Mitotic Index (%) 9 8 Untreated nm Paclitaxel Time (h)

19 Validation of Mitotic Arrest Profile Eg5 Small Molecule Inhibitor 7 6 S-Trityl-L-Cysteine 5 DMS 6 8 Time (h) S-Trityl-L-Cysteine antitubulin Ab anti- PH

20 Compounds with Anti-mitotic Profile from the Spectrum Collection

21 Systematic Analysis of Impedance-Based Cell Response Profiles

22 Curve Classification Algorithm and Display

23 Ca Modulator Anti-mitotic Protein Synthesis In DNA Damaging Nuclear Receptor Clustering Analysis CELECXIB TAMXIFEN FLUPHENAZINE PERPHENAZINE METHITHEPIN CLCHICINE NCDAZLE NSCAPINE beta-peltatin ESTRADIL PURMYCIN PYRRMYCIN CYCLHEXIMIDE EMETINE LYCRINE TENIPSIDE CAMPTTHECIN STRPHANTHIDIN LEANDRIN ETPSIDE BUDESNIDE HMATRPINE HYDRALAZINE HYDRCRTISNE METHYLPREDNISLNE

24 TCRP CX- Inhibitors CX- Inhibitors N S H N Valdecoxib S F F F F F N N F N N S S NH NH Rofecoxib Celecoxib Deracoxib Valdecoxib 5 um um 5 um 6 8 Rofecoxib 5 um um 5 um.5 um 6 8 Deracoxib 5 um um 5 um.5 um 6 8

25 TCRP CX- Inhibitors CX- Inhibitors N S H N Valdecoxib S Rofecoxib Valdecoxib 5 um um 5 um 6 8 Rofecoxib 5 um um 5 um.5 um 6 8 F N N S NH Celecoxib F F F F F N N S NH Deracoxib Celecoxib 5 um um 5 um.5 um 6 8 Deracoxib 5 um um 5 um.5 um 6 8

26 Validation of Celecoxib as Modulator of Intracellular Calcium Levels. BAPTA AM 5 um Celecoxib um BAPTA AM DMS Untreated

27 Validation of Celecoxib as Modulator of Intracellular Calcium Levels BAPTA AM 5 um Celecoxib um BAPTA AM DMS Untreated Mean Fluorescence (Arbitrary Units) 5 - Thapsigargin 5 um 5 um.5 um 6.5 um Celecoxib

28 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles H HeLa Cells 5 S HN N H CH Monastrol CH Monastrol 5 6

29 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles H HeLa Cells 5 S HN N H CH Monastrol CH Monastrol 5 6

30 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles H HeLa Cells 5 S HN N H CH Monastrol CH Monastrol 5 6

31 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles H HeLa Cells 5 S HN N H CH Monastrol CH Monastrol 5 6 Long Term Monastrol Phospho-Histone H

32 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles H HeLa Cells N 5 S HN N H CH Monastrol CH Monastrol 5 6 H CC HC N H Long Term CH nifedipine Monastrol Phospho-Histone H

33 Advantages of Short Term and Long Term Monitoring of Cellular Response Profiles S HN N H H CH Monastrol Mean Relative Fluorescence 6 8 CH Short Term 5 Monastrol Voltage-Gated Calcium Level Modulation 6 8 Monastrol (um) HeLa Cells 5 6 H CC HC Long Term Phospho-Histone H N H Monastrol N CH nifedipine

34 Functional Monitoring of GPCR Signaling

35 GPCR Activation Leads to Modulation of the Actin Cytoskeleton

36 Dynamic Monitoring of GPCR-mediated Morphological Dynamics Using the xcelligence RTCA System Histamine Phalloidin anti-paxillin.8 CTR.6.. Unstimulated Time (h) +Histamine.5 Vasopressin Phalloidin anti-paxillin...9 CTR Unstimulated Vasopressin Time (h)

37 Functional Monitoring of Gq Coupled Receptors on the xcelligence RT-CA System Histamine H Receptor RT-CA Assay H-IP Assay His um His nm His pm CTR EC 5 =.7 nm [ H]IP bound (cpm) 5 5 EC 5 = 9 nm Time (hr) [Histamine] Log M [Histamine] Log M

38 Functional Monitoring of G s Coupled Receptors on the xcelligence RT-CA System Dopamine Receptor RT-CA Assay camp Assay...8 SKF 89, um SKF 89, nm SKF 89,. nm CTR 6 8 Time (hr) normalized CI EC 5 =.7 nm [SKF 89] Log M [camp] pmoles/well EC 5 =.9 nm [SKF 89] Log M

39 Functional Monitoring of G i Coupled Receptors on the xcelligence RT-CA System 5-HTA Receptor RT-CA Assay camp Assay H-DPAT, um 8-H-DPAT, nm 8-H-DPAT,. nm CTR 6 8 Time (hr).... EC 5 = 9 nm [8-H DPAT] Log M [camp], nmol/well 5 5 EC 5 = 6 nm [8-H-DPAT] Log M

40 Dynamic Monitoring of Endogenous Receptors Using the xcelligence System Histamine Receptor (Gq) in HeLa Cells Histamine um Histamine 6 nm Histamine nm CTR 6 8 Time (hr) Calcitonin Receptor (Gs) in CH Cells 6 8 Time (hr) Calcitonin 5 um Calcitonin nm Calcitonin pm CTR pioid Receptor (Gi) in NIE5 Cells DPDPE um DPDPE nm DPDPE pm CTR Time (hr) [Histamine] Log M [Calcitonin] Log M EC 5 = 6nM EC 5 = 85 pm EC 5 = nm [DPDPE] Log M

41 Dynamic Monitoring of Receptors in Disease-Relevant Cell Types Cor.AT Cells from Axiogenesis Mouse ES Cell-Derived Cardiomyocytes % Pure Population β Adrenergic Receptor Activation in Cardiomyocyte-Differentiated Cor.AT Cells Time (Hours) 75 nm 5 nm nm 6 nm. nm. nm EC-5=. nm

42 Identification of Histamine H Receptor Inverse Agonist using the xcelligence RT-CA System Normarlized CI Histamine nm CTR Time (h) Norm alized CI Histamine nm Loratidine um Time (h)

43 List of Receptors Functionally Monitored by the xcelligence GPCR RTK FcR (IgE and IgG) TCR System Death Receptors (FasR, TNFR) Integrins Toll Receptors Nuclear Hormone Receptors

44 Summary Impedance-based monitoring of cellular status using the xcelligence platform allows for monitoring of both short term and long term responses The ability to monitor short and long term responses within the same experiment provides cytological profiles which can be predictive of mechanism of action The non-invasive nature of impedance readout provides the advantage of working with primary cells or disease relevant cells both for long term cytotoxicity studies and short term receptor responses

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity Featured Study: Using the Time Resolving Function of the xcelligence System to Optimize Endpoint Viability and

More information

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving

More information

Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T)

Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T) Using Impedance-Based Approaches for Measuring Cell-Mediated Cytotoxicity; Antibody-Dependent (ADCC) and Chimeric Antigen Receptor T (CAR-T) Vashu Pamnani, PhD. Cambridge Bioscience T Cells Non-Adherent

More information

mesc Derived Cardiomyocytes and the RTCA Cardio Instrument - The Perfect Match for Screening Cardiac Effects

mesc Derived Cardiomyocytes and the RTCA Cardio Instrument - The Perfect Match for Screening Cardiac Effects mesc Derived Cardiomyocytes and the RTCA Cardio Instrument - The Perfect Match for Screening Cardiac Effects Dr. Kristina Tressat, Axiogenesis AG ELRIG Drug Discovery II 7-8 Sep 2011, Manchester Challange

More information

System. xcelligence System RTCA HT Instrument. Application Note No. 14 /January Long-Term High-Throughput Cytotoxicity Profiling

System. xcelligence System RTCA HT Instrument. Application Note No. 14 /January Long-Term High-Throughput Cytotoxicity Profiling System Application Note No. 14 /January 2013 xcelligence System RTCA HT Instrument Long-Term High-Throughput Cytotoxicity Profiling For life science research only. Not for use in diagnostic procedures.

More information

xcelligence RTCA Cardio Instrument Monitor Cardiomyocyte Beating in Real Time for Drug Discovery Research

xcelligence RTCA Cardio Instrument Monitor Cardiomyocyte Beating in Real Time for Drug Discovery Research xcelligence RTCA Cardio Instrument Monitor Cardiomyocyte Beating in Real Time for Drug Discovery Research xcelligence RTCA Cardio Instrument A new way to test for compound cardiotoxicity Cardiac liability

More information

System. From Classical to Online Monitoring of G-ProteinCoupled Receptor. Stimulation in Living Cells. Application Note No.

System. From Classical to Online Monitoring of G-ProteinCoupled Receptor. Stimulation in Living Cells. Application Note No. System Application Note No. 6 / December 2008 From Classical to Online Monitoring of G-ProteinCoupled Receptor Stimulation in Living Cells From Classical to Online Monitoring of G-Protein-Coupled Receptor

More information

Now Wireless. The icelligence System. RTCA Technology, Label-Free Real-Time Cellular Analysis

Now Wireless. The icelligence System. RTCA Technology, Label-Free Real-Time Cellular Analysis The icelligence System TM Label-Free Real-Time Cellular nalysis RTC Technology, Now Wireless. For life science research only. Not for use in diagnostic procedures. The icelligence System TM The icelligence

More information

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes. on the ACEA xcelligence RTCA CardioECR

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes. on the ACEA xcelligence RTCA CardioECR Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes on the ACEA xcelligence RTCA CardioECR Application Note Version 2.1 / March 2018 Contents 1. Introduction 1 2. Assessment of pro-arrhythmic

More information

Plate-Based Assay Methods for the Assessment of Cellular Health

Plate-Based Assay Methods for the Assessment of Cellular Health Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule

More information

Measuring Cardiac Activity:

Measuring Cardiac Activity: icell Cardiomyocytes 2 Application Protocol Measuring Cardiac Activity: Impedance Detection with xcelligence RTCA Cardio System Introduction icell Cardiomyocytes 2, human cardiomyocytes derived from induced

More information

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification

More information

PHRM20001: Pharmacology - How Drugs Work!

PHRM20001: Pharmacology - How Drugs Work! PHRM20001: Pharmacology - How Drugs Work Drug: a chemical that affects physiological function in a specific way. Endogenous substances: hormones, neurotransmitters, antibodies, genes. Exogenous substances:

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

Drug Receptor Interactions and Pharmacodynamics

Drug Receptor Interactions and Pharmacodynamics Drug Receptor Interactions and Pharmacodynamics Dr. Raz Mohammed MSc Pharmacology School of Pharmacy 22.10.2017 Lec 6 Pharmacodynamics definition Pharmacodynamics describes the actions of a drug on the

More information

xcelligence Real-Time Cell Analyzers

xcelligence Real-Time Cell Analyzers xcelligence Real-Time Cell Analyzers Application Note No. 18 Evaluating Functional Potency of Immunotherapies Targeting Tumors of B Cell Origin Introduction A growing understanding of the molecular interactions

More information

Welcome to the Exhibitor Tutorial presented by

Welcome to the Exhibitor Tutorial presented by Welcome to the Exhibitor Tutorial presented by February 1, 217 1 Calcium Handling Assays with Human ipsc-derived Cell Types Coby Carlson, Ph.D. 7 February 217 Transformative Potential of ipsc Technology

More information

Cell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule

Cell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within

More information

Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia

Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptors Families Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptor Families 1. Ligand-gated ion channels 2. G protein coupled receptors 3. Enzyme-linked

More information

GFP Assays

GFP Assays GFP Assays 2009-07-03 GFP Assays Akt1 SMAD2 STAT3 NFAT-C1 MAPKAP-k2 Rac-1 PLCδ PH domain FYVE G2M CCPM Cell survival, proliferation, apoptosis, insulin response pathways TGF-beta signalling, growth, differentiation,

More information

Cardiomyocyte? March 14 th 2013

Cardiomyocyte? March 14 th 2013 What Makes a Cardiomyocyte a Cardiomyocyte? Kyle Kolaja March 14 th 2013 What Makes a Cardiomyocyte a Cardiomyocyte? Shouldn t proliferate Should beat Should be fairly pure Should look like and express

More information

Basics of Pharmacology

Basics of Pharmacology Basics of Pharmacology Pekka Rauhala Transmed 2013 What is pharmacology? Pharmacology may be defined as the study of the effects of drugs on the function of living systems Pharmacodynamics The mechanism(s)

More information

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes on the ACEA xcelligence RTCA CardioECR

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes on the ACEA xcelligence RTCA CardioECR Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes on the ACEA xcelligence RTCA CardioECR Version 1.2 CONTENTS Getting started... 3 Technical support and training... 3 1. Introduction...

More information

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes. on the ACEA xcelligence RTCA CardioECR

Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes. on the ACEA xcelligence RTCA CardioECR Assessment of pro-arrhythmic effects using Pluricyte Cardiomyocytes on the ACEA xcelligence RTCA CardioECR User Guide Version 3.0 / March 2018 Contents 1. Introduction 2 2. Workflow 3 3. Important recommendations

More information

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling

Chapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules

More information

Cell Communication. Cell Communication. Cell Communication. Cell Communication. Cell Communication. Chapter 9. Communication between cells requires:

Cell Communication. Cell Communication. Cell Communication. Cell Communication. Cell Communication. Chapter 9. Communication between cells requires: Chapter 9 Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the receptor binds -may be on the plasma membrane or within the cell 2 There are four

More information

Receptors and Drug Action. Dr. Subasini Pharmacology Department Ishik University, Erbil

Receptors and Drug Action. Dr. Subasini Pharmacology Department Ishik University, Erbil Receptors and Drug Action Dr. Subasini Pharmacology Department Ishik University, Erbil Receptors and Drug Action Receptor Receptor is defined as a macromolecule or binding site located on the surface or

More information

Developmental regulation of Medium Spiny Neuron dendritic arborization. Lorene M. Lanier Department of Neuroscience

Developmental regulation of Medium Spiny Neuron dendritic arborization. Lorene M. Lanier Department of Neuroscience Developmental regulation of Medium Spiny Neuron dendritic arborization Lorene M. Lanier Department of Neuroscience Diversity in dendritic arbors Pyramidal Purkinje Medium Spiny http://youtu.be/_tqpca6wx84

More information

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment

More information

Chapter 11 Guided Reading: Cell Communication

Chapter 11 Guided Reading: Cell Communication Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication

More information

xcelligence Real-Time Cell Analyzers

xcelligence Real-Time Cell Analyzers xcelligence Real-Time Cell Analyzers Application Note No. 9 A New Way to Monitor Virus-Mediated Cytopathogenicity Introduction One of the most important procedures in virology is the measurement of viral

More information

By the name of Allah

By the name of Allah By the name of Allah Receptors function and signal transduction ( Hormones and receptors Types) We were talking about receptors of the neurotransmitters; we have 2 types of receptors: 1- Ionotropic receptors

More information

Membrane associated receptor transfers the information. Second messengers relay information

Membrane associated receptor transfers the information. Second messengers relay information Membrane associated receptor transfers the information Most signals are polar and large Few of the signals are nonpolar Receptors are intrinsic membrane proteins Extracellular and intracellular domains

More information

ANATOMY & PHYSIOLOGY - CLUTCH CH. 6 - CELL COMMUNICATION.

ANATOMY & PHYSIOLOGY - CLUTCH CH. 6 - CELL COMMUNICATION. !! www.clutchprep.com CONCEPT: CELL-TO-CELL CONNECTIONS AND SIGNALING Gap and Tight Junctions: Adjacent cells communicate and hold on to each other via junctions. Two important kinds: Gap Junctions are

More information

Pharmacodynamics. OUTLINE Definition. Mechanisms of drug action. Receptors. Agonists. Types. Types Locations Effects. Definition

Pharmacodynamics. OUTLINE Definition. Mechanisms of drug action. Receptors. Agonists. Types. Types Locations Effects. Definition Pharmacodynamics OUTLINE Definition. Mechanisms of drug action. Receptors Types Locations Effects Agonists Definition Types Outlines of Pharmacodynamics Antagonists Definition Types Therapeutic Index Definition

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology

A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology A Membrane Receptor Binding Assay Using MesoScale Electrochemiluminescence Technology Jian Huang, Jay Liu and Robert Bostwick Lead Discovery Department AstraZeneca Pharmaceuticals Background The receptor

More information

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

(3) Cyclic Nucleotide Gated (CNG) Assay Technology. (4) Developing uhts CNG Assays on the FLIPR Tetra

(3) Cyclic Nucleotide Gated (CNG) Assay Technology. (4) Developing uhts CNG Assays on the FLIPR Tetra Miniaturized Cyclic Nucleotide-Gated (CNG) Channel Assays to Discover Neuropeptide Y Receptor Modulators Sanjay Saldanha, PhD, HTS/Lead ID Department Slide 1 Presentation Outline (1) Intro to Scripps Florida

More information

Signal Transduction: G-Protein Coupled Receptors

Signal Transduction: G-Protein Coupled Receptors Signal Transduction: G-Protein Coupled Receptors Federle, M. (2017). Lectures 4-5: Signal Transduction parts 1&2: nuclear receptors and GPCRs. Lecture presented at PHAR 423 Lecture in UIC College of Pharmacy,

More information

PHRM20001 NOTES PART 1 Lecture 1 History of Pharmacology- Key Principles

PHRM20001 NOTES PART 1 Lecture 1 History of Pharmacology- Key Principles PHRM20001 NOTES PART 1 Lecture 1 History of Pharmacology- Key Principles Hippocrates (5 th century BCE):... benefit my patients according to my greatest ability and judgment, and I will do no harm or injustice

More information

xcelligence System RTCA Cardio Instrument

xcelligence System RTCA Cardio Instrument xcelligence System Application Note No. 15 January 2013 xcelligence System RTCA Cardio Instrument Preclinical Cardiac Safety Assessment using Human ipsc Derived icell TM Cardiomyocytes Introduction Over

More information

Multiparametric assessment of the effects of chemotherapeutic drugs on the (electro)physiology of Pluricyte Cardiomyocytes

Multiparametric assessment of the effects of chemotherapeutic drugs on the (electro)physiology of Pluricyte Cardiomyocytes Multiparametric assessment of the effects of chemotherapeutic drugs on the (electro)physiology of Pluricyte Cardiomyocytes Event Presenter Date Ncardia Workshop Tessa de Korte, MSc December 1, 2017 Page

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Importance of calcium assay parameters in drug discovery

Importance of calcium assay parameters in drug discovery Actelion Pharmaceutical Allschwill Hamamatsu 10th FDSS User Meeting June 2014 Importance of calcium assay parameters in drug discovery Sabine Rouanet Dr. Isabelle Bertrand Directeur: Pr. Jean-Charles Schwartz

More information

Basics of Signal Transduction. Ebaa M Alzayadneh, PhD

Basics of Signal Transduction. Ebaa M Alzayadneh, PhD Basics of Signal Transduction Ebaa M Alzayadneh, PhD What is signal transduction? Cell signaling The science of understanding how individual cells sense their environments and respond to stimuli... how

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 18, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 18, 2016 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 15, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 15, 2018 -- PAGE 1 of 8 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Measuring Cardiac Activity:

Measuring Cardiac Activity: icell Cardiomyocytes 2 Application Protocol Measuring Cardiac Activity: Impedance and Extracellular Field Potential Detection with CardioExcyte 96 System Introduction icell Cardiomyocytes 2, human cardiomyocytes

More information

Chapter 11: Cell Communication

Chapter 11: Cell Communication Name Period Chapter 11: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

MBG301. Class IV. Classification of GPCRs according to their effector function (according to Lodish)

MBG301. Class IV. Classification of GPCRs according to their effector function (according to Lodish) MBG301 Class IV Classification of GPCRs according to their effector function (according to Lodish) 1. Adenylcyclase activation by GPCRs 2. Ion channel regulation by GPCRs 3. Phospholipase C (PLC) activation

More information

Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds

Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds Development of Screening Tools to Identify Nicotinic Subtype-Selective Compounds Glenn Kirsch, PhD Discovery Services Charles River Cleveland, Ohio USA Aurora Ion Channel Retreat July 7-9, 2015 Tobacco

More information

Revision. camp pathway

Revision. camp pathway االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition

More information

High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA

High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA High Throughput Screening as a Research Tool Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA Structure of this seminar Applications of High Throughput Screening

More information

xcelligence Real-Time Cell Analyzers

xcelligence Real-Time Cell Analyzers xcelligence Real-Time Cell Analyzers Application Note No. Identifying and Characterizing Endocrine Disruptors Using a Cell Panel-Based Real- Time Assay Diana Guimet, Can Jin, David Santa Ana, and Yama

More information

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system

Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,

More information

Identification of synoviocyte activation. Deborah Nguyen Genomics Institute of the Novartis Research Foundation, San Diego, CA, 92121

Identification of synoviocyte activation. Deborah Nguyen Genomics Institute of the Novartis Research Foundation, San Diego, CA, 92121 Identification of synoviocyte activation inhibitors by parallel biomarker profiling Deborah Nguyen Genomics Institute of the Novartis Research Foundation, San Diego, CA, 92121 1 GNF Paradigm for Discovery

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis

More information

For Research Use Only

For Research Use Only LANCE Ultra camp Kit For Research Use Only 1. Intended use The LANCE Ultra camp kit is intended for the quantitative determination of 3,5 -cyclic monophosphate (camp) in cell culture and cellular membrane

More information

11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer

11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer Cell Signaling Mechanisms Dr. Abercrombie 11/8/2016 Principal Parts of Neurons A Signal Processing Computer A Multitude of Synapses and Synaptic Actions Summation/Synaptic Integration 1 The Synapse Signal

More information

Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin

Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin Robust Cell-Based Assays for Detection of Neutralizing Antibodies to Follow on Biologics like Insulin, GLP1 & Avastin Abhi Saharia, Ph. D. Director of Marketing Bioassays in Biologics Development Research

More information

HORMONES (Biomedical Importance)

HORMONES (Biomedical Importance) hormones HORMONES (Biomedical Importance) Hormones are the chemical messengers of the body. They are defined as organic substances secreted into blood stream to control the metabolic and biological activities.

More information

SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric*

SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric* SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric* Catalog # 72084 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect HDAC activity. Enhanced Value: It provides

More information

Lecture Outline. Hormones & Chemical Signaling. Communication Basics: Overview. Communication Basics: Methods. Four methods of cell communication

Lecture Outline. Hormones & Chemical Signaling. Communication Basics: Overview. Communication Basics: Methods. Four methods of cell communication Lecture Outline Hormones & Chemical Signaling Communication Basics Communication Overview Communication Methods Signal pathways Regulation (modulation) of signal pathways Homeostasis... again Endocrine

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Metrion Biosciences: the ion channel specialists

Metrion Biosciences: the ion channel specialists Metrion Biosciences: the ion channel specialists In depth profiling of human ipsc cardiomyocytes: From electrophysiology to phenotypic assays Saïd El-Haou, PhD 30 November 2017 www.metrionbiosciences.com

More information

INTERACTION DRUG BODY

INTERACTION DRUG BODY INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase

More information

Propagation of the Signal

Propagation of the Signal OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Pharmacodynamics. Prof. Dr. Öner Süzer Cerrahpaşa Medical Faculty Department of Pharmacology and Clinical Pharmacology

Pharmacodynamics. Prof. Dr. Öner Süzer Cerrahpaşa Medical Faculty Department of Pharmacology and Clinical Pharmacology Pharmacodynamics Prof. Dr. Öner Süzer Cerrahpaşa Medical Faculty Department of Pharmacology and Clinical Pharmacology www.onersuzer.com Last updated: 13.05.2010 English Pharmacology Textbooks 2 2 1 3 3

More information

Effects of reference compounds on impedance signals from stem cellderived human cardiomyocytes

Effects of reference compounds on impedance signals from stem cellderived human cardiomyocytes Effects of reference compounds on impedance signals from stem cellderived human cardiomyocytes Herbert M. Himmel, Safety Pharmacology, Bayer Pharma AG, Wuppertal, Germany SPS Webinar Cardiac Safety Testing

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Introduction to Receptor Pharmacology

Introduction to Receptor Pharmacology Introduction to Receptor Pharmacology Dr Taufiq Rahman 2 nd August 2016 Part I: A general overview of receptors what is sustaining life? how a cell biologist will look at this? sustaining life means that

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

Cell Communication CHAPTER 11

Cell Communication CHAPTER 11 Cell Communication CHAPTER 11 What you should know: The 3 stages of cell communication: reception, transduction, and response. How a receptor protein recognizes signal molecules and starts transduction.

More information

Receptors. Dr. Sanaa Bardaweel

Receptors. Dr. Sanaa Bardaweel Receptors Types and Theories Dr. Sanaa Bardaweel Some terms in receptor-drug interactions Agonists: drugs that mimic the natural messengers and activate receptors. Antagonist: drugs that block receptors.

More information

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T

More information

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,

More information

Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective

Thanks to: Signal Transduction. BCB 570 Signal Transduction 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication

More information

Supplementary Information

Supplementary Information Supplementary Information Intrinsic Photosensitivity Enhances Motility of T Lymphocytes by Phan X. Thieu, Barbara Jaruga, Sandeep C. Pingle, Bidhan C. Bandyopadhyay, & Gerard P. Ahern Supplementary Figure

More information

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit CATALOG NO: IRAAKT2552 LOT NO: SAMPLE INTENDED USE The Hydrogen Peroxide Fluorescent Detection Kit is designed to quantitatively measure H2O2 in

More information

Cell Communication. Chapter 11. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Cell Communication. Chapter 11. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 11 Cell Communication PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Chapter 6 Communication, Integration, and Homeostasis

Chapter 6 Communication, Integration, and Homeostasis Chapter 6 Communication, Integration, and Homeostasis About This Chapter Cell-to-cell communication Signal pathways Novel signal molecules Modulation of signal pathways Homeostatic reflex pathways Cell-to-Cell

More information

Sarah Jaar Marah Al-Darawsheh

Sarah Jaar Marah Al-Darawsheh 22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble

More information

Degrading the Barriers to Drug Discovery in Ubiquitin E3 Ligase Pathways

Degrading the Barriers to Drug Discovery in Ubiquitin E3 Ligase Pathways Degrading the Barriers to Drug Discovery in iquitin E3 Ligase Pathways Blaine N. Armbruster, PhD. Sr. Manager - Discovery & Development Solutions EMD Millipore 1 Oct, 2012 Outline Introduction ti to EMD

More information

Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6

Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6 Neurotransmitter Systems II Receptors Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important chemical

More information

Cell Communication. Local and Long Distance Signaling

Cell Communication. Local and Long Distance Signaling Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life

More information

Life History of A Drug

Life History of A Drug DRUG ACTION & PHARMACODYNAMIC M. Imad Damaj, Ph.D. Associate Professor Pharmacology and Toxicology Smith 652B, 828-1676, mdamaj@hsc.vcu.edu Life History of A Drug Non-Specific Mechanims Drug-Receptor Interaction

More information

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal 24 Ayman Mesleh & Leen Alnemrawi Bayan Abusheikha Faisal We were talking last time about receptors for lipid soluble hormones.the general mechanism of receptors for lipid soluble hormones: 1. Receptors

More information

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte

More information

Data Sheet. Fluorogenic HDAC 8 Assay Kit Catalog #: 50068

Data Sheet. Fluorogenic HDAC 8 Assay Kit Catalog #: 50068 Data Sheet Fluorogenic HDAC 8 Assay Kit Catalog #: 50068 DESCRIPTION: The Fluorogenic HDAC 8 Assay Kit is a complete assay system designed to measure histone deacetylase (HDAC) 8 activity for screening

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface. Modification Effects on Cellular Uptake,

Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface. Modification Effects on Cellular Uptake, Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2014 Supplementary Information for: Label-free Monitoring of the Nanoparticle Surface Modification

More information