Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
|
|
|
- Polly Cunningham
- 5 years ago
- Views:
Transcription
1 Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical replicates. *p<0.05 compared to control kidneys. (B) Kidneys from Wt1Cre;LSL-PLAG1 and wild-type littermate at P1, with glomeruli marked with black circles. (C) Number of glomeruli per kidney at P1, counted by sectioning through entire kidney. (D) Kidneys from Foxd1Cre;LSL-PLAG1 and wild-type littermates at four weeks of age (scale bar = 500 um).
2 Supplemental Figure S2. PLAG1 is overexpressed in Wilms tumor cells in the absence of DICER1-dependent micrornas (A) Strategy for knocking out DICER1 in WiT49 using CRISPR/Cas9. A guide RNA targeting the second coding exon of DICER1 (protospacer-adjacent motif highlighted in blue) was transiently transfected into WiT49 to create three independent subclones with biallelic frameshift mutations. (B) Immunoblot showing absence of DICER1 protein in subclones. (C) Quantitative PCR for mirnas in DICER1-knockout WiT49 subclones. Values represented as mean ± SD from three technical replicates. **p<0.01 (two-tailed t-test versus parental cells). (D) PLAG1 and IGF2 expression in DICER1-knockout WiT49 subclones. Values represented as mean ± SD from four technical replicates. **p<0.01 (two-tailed t-test versus parental cells). (E) Quantitative PCR for PLAG1 in DICER1-knockout WiT49 subclones transfected with mirna mimics. Values represented as mean ± SD from four technical replicates. *p<0.05, **p<0.01, ***p<0.001 (two-tailed t-test versus control mimic).
3 Supplemental Figure S3. mtorc1 signaling activity in the setting of PLAG1 overexpression (A) Survival of WiT49 cells, with and without PLAG1 overexpression, treated with varying concentrations of NVP-AEW451. Values represent mean ± SD from four technical replicates at each dose. (B-C) Immunostaining of Wt1Cre;LSL-PLAG1 kidneys at P4, for PLAG1 (B) and phospho-s6 (C) (scale bar = 100 um). (D-E) Immunostaining of control kidneys at P4, for PLAG1 (D) and phospho-s6 (E) (scale bar = 100 um). (F) GSEA of HALLMARK_MTORC1_SIGNALING gene set in RNA-seq from P8 kidneys. (G) Levels of exogenous human PLAG1, endogenous mouse Plag1, and Igf2 in RNAseq from P8 kidneys.
4 Supplemental Figure S4. Wilms tumors with mirna processing mutations are less commonly aneuploid. Copy number changes in relapsed favorable histology Wilms tumors from the TARGET dataset, segregated by presence of mutations in the mirna processing pathway. Gain is shown in red, while loss is shown in blue. Imprinting status at chromosome 11p15 shown along right side (retention of imprinting in black; LOI in orange; LOH in yellow).
5 Supplemental Table 1. Oligonucleotides used for cloning, PCR, and qpcr analysis. Oligo 3utrmiR34bs_F1_XbaI 3utrmiR34bs_R1_XbaI 3utrmiR15bs1_F1_XbaI 3utrmiR15bs1_R1_XbaI 3utrmiR15bs2_F1_XbaI 3utrmiR15bs2_R1_XbaI 3utr_miR34bs_NotI_s 3utr_miR34bs_NotI_as 3utr_miR15bs1_NotI_s 3utr_miR15bs1_NotI_a s 3utr_miR15bs2_NotI_s 3utr_miR15bs2_NotI_a s hplag1_orf_r2 hplag1_orf_f2_attb1 PLAG1q_F1 PLAG1q_R1 higf2_qf1 higf2_qr1 migf2_qf1 migf2_qr1 higf2_p3_chipf higf2_p3_chipr hintergene_chipf hintergene_chipr Sequence tcattctagagtaccaccctcccacgtttc tcattctagatccgaaactggactcttaattcat tcattctagacaaccagcattggtgaaggc tcattctagaccttgtggacaaaagctggg tcattctagaaatctgcattccaggccgaa tcattctagatgtcctagacccagctattagac ttcctatatggaaaaaaaaaagtcttaaaatgtgacaatgcggccgcaatcagga caaaatacccaggtaaacttaactgaacacaaatg catttgtgttcagttaagtttacctgggtattttgtcctgattgcggccgcattgtcacatt ttaagacttttttttttccatataggaa tagcaccatgaagagttgtagcccaagttacatgcggccgctgatccaatataata ttgaaggagtgtttctgaga tctcagaaacactccttcaatattatattggatcagcggccgcatgtaacttgggcta caactcttcatggtgcta cactgtaggccacaagaagctgcagtactattatttaatgcggccgcaattaatatt ttaaatctggtatatggacaataaatagtctgct agcagactatttattgtccatataccagatttaaaatattaattgcggccgcattaaat aatagtactgcagcttcttgtggcctacagtg GGTCATCTAGGGCACAGCTAC GGGGACAAGTTTGTACAAAAAAGCAGGCTAGAAGGCCT GGTTTAGGCTG GCGTCCAGCCCGAAATATGA CATTTTGGCCAATCGCGGG TACCGCCATCTCCCTTCTCA TCCCTCTGACTGCTCTGTGA CACATTCGGCCTCTGCGAC ATCCCCATTGGTACCTGGAAG ATGCCCGTTCTAGAGAATTCAGG CCCAGCTCACGAGCACA CCTGGCCTCTCACACTCA AGAACCCTTGCTCTCCAC
6 migf2_p2_chipf migf2_p2_chipr mintergene_chipf mintergene_chipr CTTTTCGCTGCAGTCCCGAG AACTTCGAAGGACCGAGGAC ATTTTGTGCTGCATAACCTCCT TAGCAACATCCTAAGCTGGACA
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
Supplementary Figure 1
Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
Nature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
Chapter 8. Summary. Chapter 8. Summary
Chapter 8 Chapter 8 Summary Summary Summary In CHAPTER 1 an introduction to several aspects of cervical cancer, HPV and their relation with immunology is given. It took almost one-and-a-half centuries
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
Supplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Genetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
MicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
Appendix. Table of Contents
Appendix Table of Contents Appendix Figures Figure S1: Gp78 is not required for the degradation of mcherry-cl1 in Hela Cells. Figure S2: Indel formation in the MARCH6 sgrna targeted HeLa clones. Figure
Peli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately
Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19
Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 1 MicroRNA biogenesis 1. Pri mirna: primary mirna 2. Drosha: RNaseIII 3. DCR 1: Dicer 1 RNaseIII
Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
TMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
Table S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A
MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A Heba Alkhatabi, PhD Assistant Professor Department of Medical Laboratory Collage of Applied Medical science King Abdul Aziz
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
BIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Supplementary figures
Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed
Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'-
Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- hydroxyl-n-isobutyl-2,6,8,10-dodeca-tetraenamide) and (bottom) hydroxy-β-sanshool (2E,6E,8E,10E)-2'-hydroxyl-N-isobutyl-
The molecular genetics of endometrial cancer
The molecular genetics of endometrial cancer Lora Hedrick Ellenson, M.D. Department of Pathology and Laboratory Medicine Weill Medical College of Cornell University Introduction Classification of endometrial
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
MicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Posttranscriptional upregulation of HER3 by HER2 mrna induces trastuzumab resistance in breast cancer
Li et al. Molecular Cancer (2018) 17:113 https://doi.org/10.1186/s12943-018-0862-5 RESEARCH Open Access Posttranscriptional upregulation of HER3 by HER2 mrna induces trastuzumab resistance in breast cancer