SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell 1, Phuong Doan 1, Jen-Tsan Chi 1,2, Alice B Salter 1, William E. Lento 3, Tannishtha Reya 3, Nelson Chao 1,4, John P Chute 1,3 1 Division of Cellular Therapy, Department of Medicine, Duke University, Durham, NC; 2 Department of Molecular Genetics and Microbiology, Duke University, Durham, NC; 3 Department of Pharmacology and Cancer Biology, Duke University, Durham, NC; 4 Department of Immunology, Duke University, Durham, NC *GGM and PD contributed equally to this manuscript Supplementary Figures 1 5 Supplementary Tables 1, 2

2 Supplementary Fig. 1

3 Supplementary Fig. 2 a

4 b HUBEC CD45.1 CD CD45.2 B220 Mac-1/Gr-1 Thy1.2 HUBEC + anti-ptn CD45.2 B220 Mac-1/Gr-1 Thy1.2

5 c * * ^ ^ ^

6 Supplementary Fig. 3 * **

7 Supplementary Fig. 4

8 Supplementary Fig. 5 a * ^ **

9 Supplementary Fig. 5 b *

10 Supplementary Table 1. Genes overexpressed by HUBECs Fold Change Symbol Name SCG2 secretogranin II (chromogranin C) IGFBP1 insulin-like growth factor binding protein APOE apolipoprotein E PTN pleiotrophin CX3CL1 chemokine (C-X3-C motif) ligand 1 or fractalkine OLFML2A olfactomedin-like 2A TNFRSF11B tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) HAPO hemangiopoietin LGALS3BP lectin, galactoside-binding, soluble, 3 binding protein 12.1 CXCL12 stromal cell-derived factor IGFBP2 insulin-like growth factor binding protein 2, 36kDa IGFBP3 insulin-like growth factor binding protein SEMA3B sema domain, immunoglobulin domain, secreted, (semaphorin) 3B

11 Supplementary Table 2. CRU frequencies in BM 34 - KSL cells and their progeny BM source Cell Dose No. CRU 95% Confidence Engrafted Estimate Interval Day of 9 1 in 39 1/21 1/ KSL 30 6 of of 7 TSF 10 2 of 9 1 in 58 1/31 1/ of of 9 TSF + PTN 10 6 of 8 1 in 10 1/5 1/ of of 9 BM 34 - KSL cells (CD ) or their progeny following 7 day culture were transplanted at limiting dilutions into lethally irradiated C57Bl6 (CD ) mice along with 1 x 10 5 host BM MNCs in a competitive repopulating assay. At 12 weeks post-transplant, PB was collected from all recipient mice and flow cytometric analysis was performed to measure CD donor-derived cell repopulation in the recipient mice. Positive engraftment was defined as > 1% CD cells in the recipient mice. Poisson statistical analysis using the maximum likelihood estimator was performed to estimate the CRU frequency in each group 20,39.

12 Supplementary Figure Legends Supplementary Figure 1 Transplantation of PTN-treated BM HSCs facilitates the engraftment of neutrophils and platelets in lethally irradiated mice. 100% of mice (13 of 13) transplanted with BM 34 - KSL cells (black line) died by day +18. A fraction of mice transplanted with the progeny of TSF cultures (blue line) or TSF + PTN cultures (red line) survived through day +25 (4/13 in each group). Mice transplanted with the progeny of TSF + PTN culture demonstrated increased neutrophil counts at day +21 and +25 and increased platelet count at day +21 (n=13 mice per group, means + SEM). Supplementary Figure 2 PTN signaling is necessary for HUBEC-mediated HSC expansion. (a) Scatter plots show the percentages of total CD donor cells and donor-derived B-lymphoid, myeloid, and T cell populations in the PB in all mice transplanted with 30 BM 34 - KSL cells or their progeny following 7 day culture with HUBECs + TSF + IgG or HUBECs + TSF + anti-ptn. Mice transplanted with the progeny of TSF + HUBECs + IgG cultures demonstrated significantly higher total CD cell engraftment (P=0.03) and engraftment of B- lymphoid (B-220 +, P=0.004) and myeloid cells (Mac-1/Gr-1 +, P=0.01) compared to mice transplanted with the same dose of day 0 BM 34 - KSL cells (mean + SEM, n=7-10/group). Conversely, mice transplanted with the progeny of BM 34 - KSL cells cultured with TSF + HUBECs + anti-ptn demonstrated significant reduction in total CD cell, B-lymphoid, myeloid, and T cell (Thy ) engraftment compared to mice transplanted with the progeny of TSF + HUBECs + IgG (mean

13 + SEM, n=7-10/group, P=0.004, P=0.0001, P=0.002, P=0.001, respectively; one tailed t test). (b) Representative flow cytometric analysis is shown of PB donorderived (CD ) multilineage engraftment at 12 weeks post-transplant in a mouse transplanted with the progeny of TSF + HUBECs + IgG cultures versus a mouse transplanted with the progeny of TSF + HUBECs + anti-ptn. Percentages of total are shown in each quadrant. (c) Inhibition of PTN signaling prevents HUBEC-mediated expansion of LT-HSCs. Donor CD cell engraftment was persistently higher in mice transplanted with the progeny of BM 34 - KSL cells following HUBECs + TSF culture (striped bars) as compared to mice transplanted with the same dose of day KSL cells (black bars), with significant differences at weeks 8 and 12 (mean + SEM, n=7-10/group, *P=0.004 and *P=0.03, respectively). Mice transplanted with the progeny of 34 - KSL cells cultured with HUBECs + TSF + anti-ptn (gray bars) demonstrated significantly decreased CD cell engraftment at 8, 12 and 24 weeks post-transplant compared to mice transplanted with the progeny of 34 - KSL cells cultured with HUBECs + TSF (mean + SEM, n=7-10/group, ^P=0.0001, ^P=0.002, and ^P=0.002 for weeks 8, 12, and 24 respectively). Supplementary Figure 3 PTN does not signal through β-catenin. BM 34 - KSL cells ( cells/well) from flox-β-catenin mice (gray bars) and β-catenin -/- (LoxP,LoxP;Vav-cre) mice (black bars) were plated in culture with TSF alone or TSF ng/ml PTN x 7 days. No differences were observed in the

14 amplification of %KSL cells in culture between the flox-β-catenin group and the β-catenin -/- group (means + SD, n=3, *P=0.04 and **P=0.04). Supplementary Figure 4 Systemic administration of PTN augments the regeneration of BM LT-HSCs in irradiated mice. (Top) PB CD donor cell engraftment is shown at 12 weeks in CD mice (dots) transplanted with BM cells from mice that were irradiated with 700 cgy and then treated with saline or PTN x 7 days. (Bottom) Mice transplanted with BM cells from PTN treated mice displayed increased B220 (B cell), Mac-1 (myeloid) and Ter119 (erythroid) lineage engraftment compared to mice transplanted with saline-treated BM cells. Horizontal bars represent mean levels of engraftment in each condition (n=9/group). Supplementary Figure 5 Systemic administration of PTN increases phenotypic BM stem/progenitor cell content in non-irradiated mice. (a) Adult C57Bl6 mice were irradiated with 300 cgy TBI and then treated with saline, 2 µg GCSF or 2µg PTN IP x 7 days. At day +7, total BM cells, BM KSL cells and BM CFCs were measured in each group. * P=0.01 versus saline group, ^ P=0.01 versus saline group, **P=0.02 and P=0.01 versus saline and GCSF groups (n=5 mice/group, means + SD). (b) Non-irradiated adult C57Bl6 mice were treated IP daily x 7 days with saline or 2 μg PTN. At day +7, total BM cells, KSL cells, CFCs and LTC-ICs were measured in each group. PTN-treated mice demonstrated significantly increased BM KSL cells compared to saline-treated mice, but no

15 difference in total BM cells, CFCs or LTC-ICs. * P=0.009 versus saline group (n=5 mice/group, means + SD). Supplementary Methods HSC side population analysis and replating assay Hoechst staining of the cultured progeny of BM 34 - KSL cells was performed following a previously described protocol 21. Cells were analyzed on a BD FACSVantage using UV laser excitation at 350 nm and Hoechst Red and Blue emission was measured to identify side population cells on the basis of dye efflux of Hoechst 33342, as previously described 24. Greater than 100,000 events were analyzed per sample to maximize ability to detect side population cells. For the 14 day re-plating experiment, BM 34 - KSL cells were plated in a 96 well U-bottom plate at 1000 cells/well in either TSF or TSF ng/ml PTN. Cells were collected at day 7, pelleted, resuspended in PBS with 10%FBS and 1% pen/strep, and sorted for collection of 34 - KSL cells KSL cells were then replated into a 96 well plate with TSF alone or TSF + PTN culture media. Homing analysis BM Sca-1 + lin - cells from CD B6.SJL mice were injected via tail vein infusion at a dose of 4 x 10 4 cells into lethally irradiated CD C57BL6 recipients or cultured for 7 days in TSF or TSF with 100 ng/ml PTN. The cultured progeny of the identical dose of Sca-1 + lin - cells were also injected into lethally irradiated CD recipients. BM cells from recipient mice were collected at 24 hours post

16 cell infusion. Homing capacity was determined by the percentage of donor CD cells present in the recipient BM at 24 hours post-infusion. Neutrophil and platelet engraftment assay Lethally irradiated C57Bl6 mice were transplanted with either a limiting dose (100 cells) of BM 34 - KSL cells from C57Bl6 donor mice or the progeny of the identical dose of cells cultured for 7 days with TSF or TSF ng/ml PTN. PB complete blood counts (CBCs) were measured prior to irradiation and twice weekly starting at day +8 post-irradiation. Blood samples were analyzed on a HEMAVET 950FS hematology analyzer. Quantitative RT-PCR and Direct ELISA RT-PCR analyses of PTN in ECs and HES-1 and PTEN in BM KSL cells and FACS-sorted KSL cells following culture were performed using a 2-step RT-PCR reaction as previously described 39. Conditioned medium was generated from HUBECs and non-brain ECs as previously described 11,20 and ELISA for PTN was performed following manufacturer s guidelines. Analysis of PI3-kinase and Notch signaling For analysis of RPTPβ/ζ expression on hematopoietic cells, cytospins of BM MNCs were generated (~10,000 cells/slide). Rat anti-rptpβ/ζ (BD) or rat IgG was added and a FITC anti-rat secondary antibody was utilized. Flow cytometric analysis was performed on BM KSL cells to confirm RPTPβ/ζ expression. PI3-

17 kinase signaling in BM 34 - KSL cells was inhibited using 10 µm of the PI3-kinase inhibitor, LY (Cell Signaling Technology, Inc). Notch signaling was antagonized using 30 µm of γ-secretase inhibitor II (Calbiochem). The inhibitors were added to cultures of 500 BM 34 - KSL cells supplemented with TSF or TSF + PTN. Transgenic β-catenin -/- (loxp,loxp;vav-cre) mice were a gift from T. Reya, Duke University. Immunofluorescence analysis for the activated β-catenin was performed using cytospins of BM KSL cells or their progeny and staining with antibody against non-phosphorylated β-catenin (Clone 8E7, Upstate Biotechnology, Lake Placid, NY) or isotype control, and goat anti-mouse alexafluor 488 (BD) 34. Administration of PTN to non-irradiated mice and following 300 cgy Non-irradiated, adult C57Bl6 mice were treated with saline or 2 µg PTN IP daily x 7 days and effects on total BM cells, BM KSL cells, BM CFCs and LTC-ICs were measured at day +7. Adult C57Bl6 mice were also irradiated with 300 cgy TBI and treated identically with saline or PTN x 7 days and BM cells, BM KSL cells and BM CFCs were measured in each group at day +7.

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

Chronic variable stress activates hematopoietic stem cells

Chronic variable stress activates hematopoietic stem cells SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human) Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis

More information

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual

More information

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figure 1. Successful excision of genes from WBM lysates and Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.

More information

Dickkopf-1 promotes hematopoietic regeneration via direct and niche-mediated mechanisms

Dickkopf-1 promotes hematopoietic regeneration via direct and niche-mediated mechanisms a r t i c l e s Dickkopf-1 promotes hematopoietic regeneration via direct and niche-mediated mechanisms Heather A Himburg 1,7, Phuong L Doan 2,7, Mamle Quarmyne 1,3, Xiao Yan 1,3, Joshua Sasine 1, Liman

More information

UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT

UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT UMBILICAL CORD BLOOD STEM CELLS EXPANDED IN THE PRESENCE OF NICOTINAMIDE (NICORD) PROVIDE LONG TERM MULITI-LINEAGE ENGRAFTMENT Mitchell E. Horwitz, MD Duke University Medical Center Duke Cancer Institute

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of

More information

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Regulates Hematopoietic Stem. Cell Self-Renewal. Mamle Quarmyne

Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Regulates Hematopoietic Stem. Cell Self-Renewal. Mamle Quarmyne Protein Tyrosine Phosphatase Receptor Type S (PTPRS) Regulates Hematopoietic Stem Cell Self-Renewal by Mamle Quarmyne Department of Pharmacology and Cancer Biology Duke University Date: Approved: John

More information

Getting to the root of Cancer

Getting to the root of Cancer Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow

CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

BCR-ABL - LSK BCR-ABL + LKS - (%)

BCR-ABL - LSK BCR-ABL + LKS - (%) Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day

More information

SUPPLEMENTARY INFORMATION doi: /nature12026

SUPPLEMENTARY INFORMATION doi: /nature12026 doi:1.138/nature1226 a 4 35 3 MCSF level (pg/ml) 25 2 15 1 5 1h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect

More information

Protein tyrosine phosphatase σ regulates hematopoietic stem cell repopulating capacity

Protein tyrosine phosphatase σ regulates hematopoietic stem cell repopulating capacity The Journal of Clinical Investigation Brief Report Protein tyrosine phosphatase σ regulates hematopoietic stem cell repopulating capacity Mamle Quarmyne, 1,2 Phuong L. Doan, 3 Heather A. Himburg, 1 Xiao

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1). Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80 a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki

pro-b large pre-b small pre-b CCCP (µm) Rag1 -/- ;33.C9HCki a TMRM FI (Median) b TMRM FI (Median) c 20 15 10 5 0 8 6 4 2 0 pro-b large pre-b small pre-b 0 10 20 30 40 50 60 70 80 90 100 TMRM (nm) pro-b large pre-b small pre-b 0 1 2 4 8 16 32 64 128 256 CCCP (mm)

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

The Role of Rac Signaling in The Perivascular Niche

The Role of Rac Signaling in The Perivascular Niche The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for

More information

Supplementary Figures

Supplementary Figures Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1

More information

Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model

Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Selective Enhancement of Donor Hematopoietic Cell Engraftment by the CXCR4 Antagonist AMD3100 in a Mouse Transplantation Model Yubin Kang 1, Benny J. Chen 2, Divino DeOliveira 2, Jeffrey Mito 2, Nelson

More information

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus

Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic

More information

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Supplementary Information:

Supplementary Information: Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema

More information

Stem Cell Biology Laboratory, Large Scale Biology Corporation, Vacaville, California, USA;

Stem Cell Biology Laboratory, Large Scale Biology Corporation, Vacaville, California, USA; Stem Cells Original Article Quantitative Analysis Demonstrates Expansion of SCID-Repopulating Cells and Increased Engraftment Capacity in Human Cord Blood Following Ex Vivo Culture with Human Brain Endothelial

More information

Nature Medicine: doi: /nm.3922

Nature Medicine: doi: /nm.3922 Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

NK cell flow cytometric assay In vivo DC viability and migration assay

NK cell flow cytometric assay In vivo DC viability and migration assay NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with

More information

Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells

Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU

Comprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources

More information

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather

More information

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every

More information

TISSUE-SPECIFIC STEM CELLS

TISSUE-SPECIFIC STEM CELLS TISSUE-SPECIFIC STEM CELLS a Division of Stem Cell Therapy, b Stem Cell Bank, Center for Stem Cell Biology and Regenerative Medicine, f Laboratory of Molecular Pathogenesis, Center for Experimental Medicine

More information

Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection

Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection Supplementary Information Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection Noah S. Butler, Jacqueline Moebius, Lecia L. Pewe, Boubacar Traore, Ogobara K.

More information

To compare the relative amount of of selected gene expression between sham and

To compare the relative amount of of selected gene expression between sham and Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15

Supplemental Information. Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection. Cell Host & Microbe, Volume 15 Cell Host & Microbe, Volume 15 Supplemental Information Gut Microbiota Promotes Hematopoiesis to Control Bacterial Infection Arya Khosravi, Alberto Yáñez, Jeremy G. Price, Andrew Chow, Miriam Merad, Helen

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Dual Targeting Nanoparticle Stimulates the Immune

Dual Targeting Nanoparticle Stimulates the Immune Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table. Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and

ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Supplement: Infusing mature megakaryocytes into mice yields functional platelets

Supplement: Infusing mature megakaryocytes into mice yields functional platelets Supplement: Infusing mature megakaryocytes into mice yields functional platelets Rudy Fuentes 1,3, Yuhuan Wang 3, Jessica Hirsch 3, Cheng Wang 3, Lubica Rauova 2,3, G. Scott Worthen 4, M. Anna Kowalska

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1

IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice. competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

University of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory

University of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory Supplementary File ASXL1 plays an important role in erythropoiesis Hui Shi 1,2,3, Shohei Yamamoto 1,2,4, Mengyao Sheng 3, Jie Bai 3, Peng Zhang 1,2, Runze Chen 1,2, Shi Chen 1,2, Lihong Shi 3, Omar Abdel-Wahab

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL) Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information