hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
|
|
- Cory Nichols
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed in mammalian cell and was used as immunogen. M, protein ladder. (B) Purified GRP78-His protein and MCF7 whole cell lysate were resolved on SDS-PAGE and immunoblotted with (0.5 ug/ml) that was pre-incubated with 100 ug/ml bovine serum albumin (BSA) or GRP78-His. GRP78-His completely blocked the binding of to GRP78 on the immunoblot. (C) Breast carcinoma cell MCF7 was treated with 300 nm thapsigargin or DMSO for 16 hours and the whole cell lysates were immunoblotted using (signal in red) and antibody against HSP70 (signal in green). The same membrane was used for both antibodies. only recognized GRP78, which was significantly induced after thapsigargin treatment. (D) in immunoblot assays recognized the GRP78 protein band in mouse embryo fibroblast (MEF) lysates prepared from the Grp78 floxed/floxed mice. The GRP78 band was absent in the c78f/f MEFs where the Grp78 alleles were deleted by treatment of the MEFs with adenovirus expressing the cre-recombinase. The blot was re-probed with anti beta-actin antibody to confirm equivalent protein loading in both lanes. These results also show that only immunoreacted with GRP78 in mouse protein lysates, confirming its specificity. (E) Scatchard assay to determine the affinity of to GRP78. Fig. S2. induces GRP78 endocytosis through clathrin mediated pathway. (A) MCF7 cells were glucose starved for 3 days and then treated with 50 ug/ml for 1 hour at 37 C. Cells were fixed with paraformaldehyde and permeabilized with Triton X-100, followed by co-staining with and clathrin antibody. Co-localization of
2 GRP78/ and clathrin is shown. (B) Glucose starved MCF7 cells were incubated with 50 ug/ml at 4 C for an hour, followed by staining with EphB4 antibody on ice without fixation and permeabilization. Plasma membrane localization of GRP78 is shown. Cells were also treated with or the combination of and 2ug/mL or 5 ug/ml chlorpromazine for 1 hour at 37 C, followed by the same staining procedure described above. treatment significantly reduced the surface GRP78, whereas the endocytosis inhibitor chlorpromazine restored surface GRP78. Nuclei were counterstained with DAPI. Scale bar, 20 Fig. S3. induces apoptosis of tumor cells in vitro. (A) HT29 cells were glucose starved and treated with or control IgG for 5 days, and the cell viability was analyzed with clonogenic assay. Representative pictures and statistical analysis (normalized to PBS treated cells) are shown. treated cells had significantly less colony formed. Treated cells were also analyzed with M30-CytoDEATH (B) and Caspase activity assay (C). Experiments were performed at least in triplicate. Asterisk and double asterisks indicate P < 0.05 and P < 0.02 respectively, as determined by an unpaired 2-tail student T-test. Fig. S4. Surface GRP78 Forms Complex with PI3K. (A) Flag tagged GRP78 without KDEL was over-expressed in 293T cells, followed by surface protein biotinylation and immunoprecipitation (IP). The interaction of surface GRP78 with p85, but not EphB2, Erk1/2, or beta-actin was detected. In the bottom panel, biotinylated surface GRP78 could also be detected with fluorochrome-conjugated streptavidin. (B) The interaction of endogenous surface GRP78 with p85 was detected in 293T cells treated with thapsigargin. Same biotin-ip system was used as in (A).
3 Fig. S5. Surface GRP78 level in cancer cell lines. (A) Cancer cells were grown in complete medium or glucose depleted medium for 3 days and then subjected to cell surface biotinylation. The biotinylated surface GRP78 was enriched with streptavdin beads, resolved on SDS-PAGE, and detected with. (B) The band intensity on immunoblot was quantified with Odyssey and the ratio of surface GRP78 in total GRP78 is shown. Fig. S6. treatment of xenograft tumor leads to reduced vessel density and mtor signaling. treated A549 tumors were analyzed with CD31 antibody (A) and phosphorylated mtor (pmtor) antibody (B)s. Nuclei were counterstained with DAPI (blue). Asterisk and double asterisks indicate P < 0.02, and P < respectively, as determined by an unpaired 2-tail student T-test. Fig. S7. shows no toxicity to normal organs in tumor xenograft study. H&E staining pictures of the major mice organs in A549 xenograft study shows no apparent toxicity Fig. S8. Inhibition of primary tumor growth and metastasis by in 4T1 orthotopic model. (A) Pictures of primary 4T1 tumor in fat pad #4 (top) and metastasis in contralateral fat pad #9 (bottom) after 7 days of treatment. Tumor is demarcated by black line and #4 pad is indicated by black arrow. (B) Pictures of primary 4T1 tumor (demarcated with white dotted line) in fat pad #4 (indicated by white arrows) and metastasis (demarcated with red dotted line) in contralateral fat pad #9 (indicated by red arrows) after 14 days of treatment. Two representative pictures were shown for each group. inhibited primary tumor growth and secondary metastasis to #9 fat pads. (C) H&E staining and immunohistochemical staining of ps6 in 4T1 primary tumors harvested from mice treated with control IgG and
4 on day 14. Compared to the tumor from control IgG treated mouse, tumor from treated mouse is much smaller. ps6 staining (middle panel) is also much weaker in. Quantification data are presented as mean ± SEM (n=4). Signals were quantified with Image J. Double asterisks indicate P < Fig. S9. inhibits the growth of hormone refractory mouse prostate cancer cell CE1 in vivo. The anti-tumor activity of was tested in the xenograft tumor model of a PTEN deficient, hormone refractory mouse prostate cancer cell CE1. The study was performed as described in Figure 2A. Asterisk indicates P < 0.05, as determined by an unpaired 2-tail student T-test.
5 A M GRP78-His B Sample GRP78-His (10 ng) MCF7 lysate (10 ug) Blocking protein BSA GRP78-His BSA GRP78-His GRP78 Liu_FigS1 -actin D KDa f/f c78 f/f C MCF7 DMSO Tg GRP78 β-actin 35 GRP78 HSP70 E B/F kd=1.7 nm -actin Bound, pm
6 Liu_FigS2 A Clathrin DAPI /Clathrin/DAPI B EphB4 DAPI /EphB4/DAPI, 37C, 1 hour Chlorpromazine, 5 ug/ml, 37C, 1 hour Chlorpromazine, 2 ug/ml, 37C, 1 hour, 4C, 1 hour
7 Liu_FigS3 A PBS Ctrl IgG 1.2 Relative colony number * 0.0 Ctrl IgG B 10 5 C 3 Ctrl IgG M30-FITC Treatment Apoptotic cell percentage (%) 42.7 ± 5.3 Ctrl IgG 24.5 ± K 100K 150K 200K 250K FSC-A Caspase activity ** ** Caspase 8 Caspase 9
8 A B IP Liu_FigS p85 GRP78 EphB2 Erk1/2 -actin Sum p85 Actin GRP78 GRP78 p85 Biotin -actin Biotin 43 34
9 A Liu_FigS5 Whole cell lysate (5 ug) Surface protein fraction (42 ug input) Cell HT29 A549 MCF7 H249 HT29 A549 MCF7 H249 Glucose GRP actin B Surface GRP78 vs. total GRP78 (%) Glucose Cell HT29 A549 MCF7 H249
10 A CD31 DAPI Liu_FigS6 Ctrl IgG * 0 20 CD31 Coverage (%) B pmtor (Ser2448) DAPI Ctrl IgG ** pmtor positive area (%)
11 Ctrl IgG Liu_FigS7 Kidney Liver Heart Lung
12 Liu_FigS8 A 4T1, day 7, Ctrl IgG 4T1, day 7, Ctrl IgG Contralateral metastasis #9 fat pad Primary tumor #4 fat pad B 4T1 tumor in fat pads (day 14) Control Control #9 #4 #9 #4 C H&E ps6(s235/s236) ** ps6 positive area (%)
13 Liu_FigS9 300 CE1 Tumor size (mm 3 ) Ctrl IgG * Days of treatment
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationTel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationSupplementary Figure 1 Maschalidi et al.
a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationSupplementary Fig. 1
PDK1-dependent quenching of TACE shedding activity in prion and Alzheimer s diseases Mathéa Pietri, Caroline Dakowski, Samia Hannaoui, Aurélie Alleaume-Butaux, Julia Hernandez-Rapp, Audrey Ragagnin, Sophie
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationsupplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): This is a well written and well executed study describing a novel mechanism of pro-angiogenic signalling which may, potentially, help to explain
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationWilliam C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationSupplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationLive cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationa! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!
a! b! c! Diamet (μm) 2 2 1 WT Nogo-A/B-deficient -9-8 -7 - -5-4 PE (LogM) Diamet (μm) 2 2 1-12-11-1 -9-8 -7 - -5 U-419 (LogM) Diamet (μm) 2 2 1-8 -7 - -5 S1P (LogM) d! WT! Nogo-A/B-deficient! MLE! enos!
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
More informationLoss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
More informationAnti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More information