Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Size: px
Start display at page:

Download "Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR"

Transcription

1 Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very long chain cadvl GGGGCGCCTTTGCGG GCGGCTCTGGGTTTG cyl-coenzyme Dehydrogenase, long chain CC GTCCCCGGGTGCCT GCCTGCTCCCGTGC COX-1 cetyl-coenzyme Carboxylase-1/α TCGGCCGCGTTCGG TCTCCGTCTGGGCGTGG CS cyl-coenzyme oxidase 1/ palmitoyl CCGCTCGGGTC CCGTGTGTTCCCCCGG cyl-co synthetase short-chain family member 2 NGPTL4 TCCCGCCCCCCTTC TGGTCTCTCCGTTGCC ap2 ngiopoietin-like 4 GGTGGGCTCTCCCT TCCGCCTTTCTCCTTCC TGL Fatty acid binding protein 4, adipocyte CTGGTCCCTTCCCCTC CCGCTGTGGGGGG CHOP-1 dipose triglyceride lipase GCGGCGGGTGGC CTGCGGTCGTCGGCC Cox5b C/EP homologous protein 1 TCGCCGGTGTGGG GTTGGGTTCCCGTTGGG CPT1a Cytochrome c Oxidase, Subunit Vb CTTGCGCTCTCGCTGGG GGCTTTCGCCCGGG CPT1b Carnitine palmitoyltransferase 1a, liver TGGGCTGGTCGTTGCTC TCGGGTTTGTCGGGG Carnitine palmitoyltransferase 1b, muscle Cyclin D1 TTGTGCTCTCCTGCCTC GGGTGGGTTGGTGCT DGT1 GCCCCTGCGTGTTTTGC CCTGGGTGTGCTCCC DGT2 Diacylglycerol O-acyltransferase 1 CCGGCCCTGCTCTT CTTCGGGTGCTGCGTTCTT FS Diacylglycerol O-acyltransferase 2 GGTCCCGGCGCTTCT GCCTGGTGGCTTCTGTGT FTP Fatty acid synthase CTGTGCCCCTGTTCCG CTCCCCGCCTTGGGG GDH Fatty acid transport protein TGCCCGTCCTGCCTC GCGGCCTTGGGGGTG Glyceraldehyde-3-phosphate dehydrogenase GLUT4 GGGGGGGCTTGCTG TGGGCCGTCCGTG GPT Glucose transporter 4 CGCCCGGCCGG TGCTGCTCGTCTTCTCGT Glycerol-3-phosphate acyltransferase, mitochondrial Gyk GTCGCCCGGGGCC CCCGGCTTTGGGGCT Hadha Glycerol kinase GCCCGTTCCGGG GGCCCCCCCTTTTGG Hydroxyacyl-Coenzyme dehydrogenase, alpha subunit

2 HSL TTCTCCGCCCTGCC TGTGGCTGGGCTTGTTG LCD Hormone-sensitive lipase CCCTGTTGCTCGGCTC CCGCCGTTCCCCTTGG LDLR Long-chain acyl-co dehydrogenase CTCCTGCTTCCGGTGCC CCCCTGTGCCTTGCTTG LPL Low density lipoprotein receptor GGCGGTCGGGTGTTG CGTTGTCTGGGGGTCTT PEPCK Lipoprotein lipase GCTTCCGCCGGTTC GGGCGGTCTGTCGTTCT Pfkl Phosphoenolpyruvate carboxykinase GCTCGCCCTTGCCT CTCCCGGTCCTCTGG PPRα Phosphofructokinase, liver TCGGCGCTTTCGGCTG GCCTTGTGCGGCGT Peroxisome proliferator activated receptor alpha PPRβ/δ TTGGCCCGTTCGGTTTG CGGTCTCCCCGTGTG Peroxisome proliferator activator receptor beta/delta PPRγ TGTGGGGTGCTCGGC CCGGCGTTGTCCCCTT Peroxisome proliferator activated receptor gamma Pref-1 CCCGGTGGCTTCGGTG GGGGGGGTCTCTTGTTGG Preadipocyte factor 1 Resistin GCCTTTCTTTCCCCTCCT GTCCGCTTTGCCTGTT SCD1 TTCTTGCGTCCTCTGGTGC CGGGTTGTGTTCTTGTCGT SREP-1c Stearoyl-Co desaturase-1 GGCCTCGCTCTCCG TCCTGCCTCTGTGCCTC Sterol regulatory element binding transcription factor 1c TKT TGGCTCCGGCTCTT TCCGCTTGTTTCCGC UCP2 Transketolase CGTGTGGTGGTCCGCT TTCCTCTCGTGCTGGTCTT UCP3 Uncoupling protein 2 GGTGGTGCCTCGCTC GCGTTCTGTTCGGGTCTTT Uncoupling protein 3 Visfatin CCCGTTGGTGGCTGT TGGTGCCGTGCCTCTG

3 Supplementary Figure 1. Effect of Smad3 deficiency on weight of various organs. C: Relative weight of liver (), quadriceps (), and brown adipose tissue (C) of 8-week-old and mice. Values represent percentage of body weight. D: Flow cytometry analysis of rdu-positive adipocytes in and epididymal adipose tissue. Values in bold represent percentage of rdu-positive adipocytes. and mice were injected intraperitoneally with 5 μg/g body weight of rdu for 3 consecutive days. dipocytes from epididymal adipose tissue were isolated, stained using rdu Flow kit and analyzed by flow cytometry as recommended by manufacturer (ecton Dickinson, Franklin Lakes, NJ). E: Representative hematoxylin-eosin stained paraffinembedded section of the and liver. Scale bars, 1 μm. F: Mean plasma cholesterol in and mice. Values represent mean ± SEM, n= 8/group. Liver weight (% body weight) D Muscle weight (% body weight) C rown fat weight (% body weight) rdu (FITC) E D F Cholesterol (mg/dl) (x 1) (x 1) 7-D

4 Supplementary Figure 2. Values collected on the metabolic activity, food and water consumptions, and physical activity for 24-h dark-light cycle. F: The mean O 2 consumption (), CO 2 emission (), heat production (C), fuel consumption (D), and horizontal (E) and rearing (F) movements monitored over a 24-h light-dark cycle period. Horizontal movements (X amb ) and rearing movements (Z tot ) were measured by counting the number of horizontal and vertical infrared beam breaks. Respiratory exchange ratio (RER) was calculated by VO 2 /VCO 2. Values represent mean ± SEM, n= 8/group. 4 O consumption 2 4 CO emission 2 VO2 (ml/kg/h) VCO2 (ml/kg/h) C Heat (kcal/hr/kg) E Xamb (counts) Metabolic rate 8 6 Horizontal movement D RER F Ztot (counts) Fuel consumption Vertical movement

5 Supplementary Figure 3. Effect of Smad3 deficiency on β-oxidation in liver. : Relative fold change in mrn level of the indicated genes in and liver as determined by real-time PCR. Values are normalized to ribosomal protein L27 (RPL27). Normalized values from mice were arbitrarily assigned a value of 1. Values represent mean ± SEM, n= 3/group. : The rate of [ 14 C]palmitate β-oxidation of hepatocytes freshly isolated from and liver. 2.5 cadl Hadha cox1 CS CPT1a PPRα PPRβ/δ [ 14 C]palmitate oxidation (nmol/1 x 1 5 cells) Relative fold-change in gene expression (gene/rpl27).

6 Supplementary Figure 4. Food intake and cholesterol level in and mice. and : Daily food intake () and mean food intake () by and mice on either high-fat diet () or low-fat diet () during and at the end of the 18- week feeding regime, respectively. Four experimental groups with a cohort of ten 8-week-old male mice each were assigned to either or (TestDiet, Richmond, IN) for 18 weeks. Group 1 and 3: and mice fed on (1% energy from fat, Yellow, 58Y2), respectively; Group 2 and 4: and mice fed on (45% energy from fat, Red, 58V8), respectively. C and D: Representative histological section (oil red O and methylene blue staining) of the skeletal muscle (C) and pancreas (D). Scale bars, 1 μm. (E) The mean plasma cholesterol in and mice on either or. Values represent mean ± SEM, n= 8/group. Daily food intake (g) Daily food intake (g) Feeding period (wk) C D E Cholesterol (mg/dl)

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F

Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A D-F Supplementary Figure 1. Mitochondrial function in skeletal muscle and plasma parameters of STZ mice A Expression of representative subunits of the mitochondrial respiratory chain was analyzed by real time

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8 Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory

More information

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU) Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

ANSC/NUTR 618 Lipids & Lipid Metabolism

ANSC/NUTR 618 Lipids & Lipid Metabolism I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

The Effect of Dietary Fatty Acid

The Effect of Dietary Fatty Acid The Effect of Dietary Fatty Acid Composition on Skeletal Muscle and Hepatic Fatty Acid and Glucose Metabolism in Male and Female Mice Lisa Kate Philp B.Sc. (Biomedical Science), B.Sc. (Hons) Discipline

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular

Roles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23 Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Summary of fatty acid synthesis

Summary of fatty acid synthesis Lipid Metabolism, part 2 1 Summary of fatty acid synthesis 8 acetyl CoA + 14 NADPH + 14 H+ + 7 ATP palmitic acid (16:0) + 8 CoA + 14 NADP + + 7 ADP + 7 Pi + 7 H20 1. The major suppliers of NADPH for fatty

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Citric acid cycle and respiratory chain. Pavla Balínová

Citric acid cycle and respiratory chain. Pavla Balínová Citric acid cycle and respiratory chain Pavla Balínová Mitochondria Structure of mitochondria: Outer membrane Inner membrane (folded) Matrix space (mtdna, ribosomes, enzymes of CAC, β-oxidation of FA,

More information

number Done by Corrected by Doctor

number Done by Corrected by Doctor number 20 Done by Corrected by Rana Ghassan Doctor Only 4 questions in the mid-term exam are based on the 4 lectures to be given by Dr Faisal. Dr Faisal will give us 10 lectures, the first 4 are included

More information

The molecule that serves as the major source of readily available body fuel is: a. fat. b. glucose. c. acetyl CoA. d. cellulose.

The molecule that serves as the major source of readily available body fuel is: a. fat. b. glucose. c. acetyl CoA. d. cellulose. The molecule that serves as the major source of readily available body fuel is: a. fat. b. glucose. c. acetyl CoA. d. cellulose. Dietary fats are important because: a. they keep blood pressure normal.

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

BIOL2171 ANU TCA CYCLE

BIOL2171 ANU TCA CYCLE TCA CYCLE IMPORTANCE: Oxidation of 2C Acetyl Co-A 2CO 2 + 3NADH + FADH 2 (8e-s donated to O 2 in the ETC) + GTP (energy) + Heat OVERVIEW: Occurs In the mitochondrion matrix. 1. the acetyl portion of acetyl-coa

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

INTEGRATION OF METABOLISM

INTEGRATION OF METABOLISM SIBC511- INTEGRATION OF METABOLISM Assistant Professor Dr. Chatchawan Srisawat INTEGRATION OF METABOLISM INTEGRATION OF METABOLISM Dietary intake Fed state Fasting state The metabolism of carbohydrate,

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule

Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule Cell Reports, Volume 18 Supplemental Information rown dipogenic Reprogramming Induced by a Small Molecule aoming Nie, Tao Nie, Xiaoyan Hui, Ping Gu, Liufeng Mao, Kuai Li, Ran Yuan, Jiashun Zheng, Haixia

More information

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed Supplemental Fig. 1. hanges in fat and lean mass determined by EXA. Fat mass in high fat-fed mice (A) and chow-fed controls (). Lean mass in high fat-fed mice () and chow-fed controls (). ata represent

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Lehninger 5 th ed. Chapter 17

Lehninger 5 th ed. Chapter 17 Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals

More information

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle:

Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: BCH 4054 February 22, 2002 HOUR TEST 2 NAME_ Points 1. Following is the overall reaction catalyzed by the Calvin-Benson cycle: CO 2 + 3ATP + 2NADPH 1/3 glyceraldehyde-3-p + 3ADP + 2NADP + Give the structures

More information

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S

OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin

More information

CHY2026: General Biochemistry. Lipid Metabolism

CHY2026: General Biochemistry. Lipid Metabolism CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)

More information

respiration mitochondria mitochondria metabolic pathways reproduction can fuse or split DRP1 interacts with ER tubules chapter DRP1 ER tubule

respiration mitochondria mitochondria metabolic pathways reproduction can fuse or split DRP1 interacts with ER tubules chapter DRP1 ER tubule mitochondria respiration chapter 3-4 shape highly variable can fuse or split structure outer membrane inner membrane cristae intermembrane space mitochondrial matrix free ribosomes respiratory enzymes

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water

More information

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

Moh Tarek. Razi Kittaneh. Jaqen H ghar

Moh Tarek. Razi Kittaneh. Jaqen H ghar 14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple

More information

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction

More information

Physiology Unit 1 METABOLISM OF LIPIDS AND PROTEINS

Physiology Unit 1 METABOLISM OF LIPIDS AND PROTEINS Physiology Unit 1 METABOLISM OF LIPIDS AND PROTEINS Alternate Fuel Sources When glucose levels are low Proteins and Triglycerides will be metabolized Tissues will use different fuel sources depending on:

More information

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism

ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES. Carbohydrate Metabolism ANSC 619 PHYSIOLOGICAL CHEMISTRY OF LIVESTOCK SPECIES I. Glycolysis A. Pathway Regulation of glycolysis Hexokinase: Activated by glucose. Inhibited by G6P. 6-Phosphofructokinase: Inhibited by ATP, especially

More information

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!

SUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.! SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta

More information

Fatty acid breakdown

Fatty acid breakdown Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of

More information

In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic

In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic Glycolysis 1 In glycolysis, glucose is converted to pyruvate. If the pyruvate is reduced to lactate, the pathway does not require O 2 and is called anaerobic glycolysis. If this pyruvate is converted instead

More information

Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia

Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia SUPPLEMENTARY INFORMATION Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia Tomoya Fukawa, Benjamin Chua Yan-Jiang, Jason Chua Min-Wen, Elwin Tan Jun-Hao, Dan Huang, Chao-Nan Qian,

More information

Lipid Metabolism * OpenStax

Lipid Metabolism * OpenStax OpenStax-CNX module: m46462 1 Lipid Metabolism * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able

More information

MILK BIOSYNTHESIS PART 3: FAT

MILK BIOSYNTHESIS PART 3: FAT MILK BIOSYNTHESIS PART 3: FAT KEY ENZYMES (FROM ALL BIOSYNTHESIS LECTURES) FDPase = fructose diphosphatase Citrate lyase Isocitrate dehydrogenase Fatty acid synthetase Acetyl CoA carboxylase Fatty acyl

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Hormones and Target Tissues

Hormones and Target Tissues Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

Major Metabolic Control Hormones Second messenger

Major Metabolic Control Hormones Second messenger ormone Insulin (51 amino acid heterodimeric peptide Major Metabolic ontrol ormones Second Receptor Mechanism messenger Tyrosine hosphorylated proteins decreased cam Gene transcription Target tissues adipose,

More information

Dietary Lipid Metabolism

Dietary Lipid Metabolism Dietary Lipid Metabolism Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy OVERVIEW Lipids are a heterogeneous group.

More information

acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK).

acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK). 1 SUPPLEMENTAL MATERIAL 2 SUPPLEMENTARY METHODS 3 4 5 6 7 Materials Unless stated otherwise, all solvents were from Rathburn Chemical Ltd. (Walkerburn, UK) and other chemicals from Sigma-Aldrich (Dorset,

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Integration of Metabolism

Integration of Metabolism Integration of Metabolism Metabolism is a continuous process. Thousands of reactions occur simultaneously in order to maintain homeostasis. It ensures a supply of fuel, to tissues at all times, in fed

More information

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

More information

2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above

2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above Biochem 1 Mock Exam 3 Chapter 11: 1. What is glucose completely oxidized into? a. Carbon Dioxide and Water b. Carbon Dioxide and Oxygen c. Oxygen and Water d. Water and Glycogen 2. What is molecular oxygen

More information

What systems are involved in homeostatic regulation (give an example)?

What systems are involved in homeostatic regulation (give an example)? 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS (Diabetes Mellitus Part 1): An Overview

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Medical Biochemistry and Molecular Biology department

Medical Biochemistry and Molecular Biology department Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti

More information

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids. Martina Srbová Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

More information

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 By: Dr Hadi Mozafari 1 Gluconeogenesis is the process of converting noncarbohydrate precursors to glucose or glycogen. The major substrates are the glucogenic amino acids, and lactate, glycerol, and propionate.

More information

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly

More information

Integration & Hormone Regulation

Integration & Hormone Regulation Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen

More information

Week 3 The Pancreas: Pancreatic ph buffering:

Week 3 The Pancreas: Pancreatic ph buffering: Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

Metabolism. Chapter 5. Catabolism Drives Anabolism 8/29/11. Complete Catabolism of Glucose

Metabolism. Chapter 5. Catabolism Drives Anabolism 8/29/11. Complete Catabolism of Glucose 8/29/11 Metabolism Chapter 5 All of the reactions in the body that require energy transfer. Can be divided into: Cell Respiration and Metabolism Anabolism: requires the input of energy to synthesize large

More information

Intermediary metabolism. Eva Samcová

Intermediary metabolism. Eva Samcová Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.

More information

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information