Pharmaceutical Drug Development Consulting

Size: px
Start display at page:

Download "Pharmaceutical Drug Development Consulting"

Transcription

1 Dr. Julia Eva Diederichs Pharmaceutical Drug Development Consulting Preclinical investigations and animal studies: for comprehensive characterisation what is scientifically possible and meaningful

2 A Case Study Development of a liposomal formulation with a NCE for Phase I long term application chronic disease no oncological indication no orphan drug

3 Characterisation of the API CMC Very poorly soluble < 1 µg/ml High moleculare weight: ~ 750 g/mol Highly lipophilic High plasma protein binding > 99.9 % Very low permeability Chemically instable storage at -20 C Sensitive against base and acid purpose of the liposomal formulation: solubilisation and stabilisation

4 Liposomal formulation CMC Two component approach Empty Liposomes Drug loaded transfer medium Purpose of this formulation Immediate preparation and use due to instable drug Final formulation only stable over 48 hours

5 Preparation of the liposomes CMC Transfer medium by mixing 50mg/ml API PEG300 & Ethanol (9:1) Empty liposomes by high pressure homogenisation 96.2 mg/ml phospholipids (mainly soy PC) 21.6 mg/ml Glycerol 2.5 ml Transfer medium ml liposomal Dispersion oscillation shaker for 20 min In-situ loading by instant solubilisation technique

6 CMC Characterisation of the final formulation Batch to batch conformity? Composition 1.5 mg/ml API 93.3 mg/ml Phospholipid 28.8 mg/ml PEG mg/ml Ethanol 20.9 mg/ml Glycerol Physico-chemical characterisation Particle size: nm / PI (Spec. < 100nm / PI < 0.6) Zetapotential: around - 25 mv (Spec. Report value) Drug to Lipid ratio: 0.016

7 Partical size determination CMC PCS Mean diameter nm / PI Bimodal distribution curve seen for volume and number distribution PI decreases with higher dilution of the sample CyroTEM Particle size: 20 nm Different liposome types were detected

8 Partical size determination CMC CryoTEM picture Determination of lamellarity recommended

9 Application route and dosing Intended treatment for Phase I i.v. influsion over 60 min Application volume: 200ml single escalation dose: mg API in 7 dosage steps Composition of highest dose 0.2 g API g Phospholipid 3.8 g PEG g Ethanol 2.8 mg Glycerol 67 ml 5% Glucose as diluent High amount of excipients needed to solubilise desired amount of API

10 Potential toxicity of excipients The following i.v. applied maximal doses are considered acceptable Ethanol: 4.8 mg/kg Glycerol: 42.1 mg/kg Phospholipid: recommended dose for parenteral nutrition 2g fat/kg BW/day however: adverse effects can not be excluded Reversible increase of liver enzymes are reported PEG300: 3.6 g/patient (oral application) however: for i.v. application of PEG400 nephrotoxicity is reported

11 Pharmacology In vitro primary Pharmacodynamics Mode of action: Inhibition of a peptidase IC50 was tested in various cellular assays ( nm) and in blood (20-40µg/ml due to high plasma protein binding) Cave: All in vitro assays were performed with API DMSO solution Therapeutic effect EC50 was determined in an cellular assay with API DMSO solution: 800nM Interaction of liposomes with cells was not considered

12 In vivo Pharmacodynamics Pharmacology No satisfactory animal model exists Elucidation of pharmacodynamic properties is limited to in vitro studies To monitor proposed in vivo effect inhibition of the peptidase was quantified in various PK and Tox studies as surrogate parameter in plasma and/or liver

13 Pharmacology In vitro secondary Pharmacodynamics Cytotoxic effect CC50: 5.2µM ~ 50% apoptotic and necrotic cells were observed at a concentration >5.5µM Tox Ratio CC50/EC50: 6.4 Cytotoxicity assays were performed with DMSO solution and liposomal formulation Liposomal formulation showed higher toxicity Cytotoxic effects could be observed as with the empty liposomes

14 Pharmacology Safety pharmacoloigy according to ICH S7A No critical findings in the intended dosage range In vivo studies were performed with the liposomal formulation In vitro studies were performed with DMSO solution Different formulations for in vitro and in vivo

15 In vitro metabolism Pharmacokinetic and PK/PD relation Inhibition of CYPs 3A4, 2C9, 2C19 and 2D6 Lowest metabolic stability in cynomolgus Low metabolic stability in human and mice High metabolic stability in dog and rat Cave: study was not performed with liposomal formulation Pivotal preclinical studies were performed in rat and dog

16 Pharmacokinetic and PK/PD relation Preliminary studies with aqueous formulation- rat 10% DMSO, 20% Cremophor RH40 Single dose, i.v. bolus dose Inhibititon on Cmax toxicity 15mg/Kg % No clinical signs 30mg/Kg 71 % No clinical signs 45mg/Kg 90 % MTD, 2/5 died Cmax 3h post administration Good dose/exposure correlation

17 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Single dose, i.v. bolus, 30mg/Kg Cmax Max. Inhibition solution 8.8 µg/ml 71 % after 3 hours liposomes µg/ml 63 % after 8 hours Toxicity comparable Recovery delated (48 vs 24 hours) Influence of liposomal formulation on pharmacokinatic

18 Pharmacokinetic and PK/PD relation i.v. bolus, single dose 30mg/Kg, rat - PK/PD relation Blue: plasma concentration Red: inhibition

19 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Single and repeat dose, 30 min i.v. infusion every second day, 15mg/Kg Repeated dose caused mild clinical findings PD effect in plasma: up to 60% inhibition but high fluctuation Clear and more pronounced PD effect in the liver For better evaluation: Organ distribution study liposomal vs. nonliposomal formulation

20 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Two weeks repeat dose study, 60 min i.v. infusion every third day 5% glucose, empty liposomes, 5, 10, 15mg/Kg Toxicity: NOAEL: 5mg/ml MTD: 15mg/ml Target organ: liver PD effect could not be assessed due to technical issues

21 Pharmacokinetic and PK/PD relation NonlinearPK, significantlylower exposureafter thelast dose, no dose correlation For better evaluation: Organ distribution study liposomal vs nonliposomal formulation?

22 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Single dose, i.v. bolus vehicle, 2, 4 and 7.5 mg/kg Toxicity: no clinical finding No relevant PD effect dosage too low Gender specific difference in pharmacokinatik for high dose group

23 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation mg/kg male 4 mg/kg male 7.5 mg/kg male 2 mg/kg female 4 mg/kg female 7.5 mg/kg female Concentration [ng/ml] time profile time (h)

24 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Gender specific pharmacokinetic in high dose Dose [mg/k g] Non-compartmental analysis [µg/ml Sex ] C max AUC last AUC inf t max [h] # [h.µg. /ml] [h.µg t t 1/2 (z) V z /ml] [h] [ml/kg] Cl [ml/h/k g] 2 M F M F M F Formulation related effect as not seen with DMSO/surfactant formulation?

25 Pharmacokinetic and PK/PD relation Studies with liposomal formulation dose range finder in dogs Part 1: single escalation dose, i.v. 30 min infusion vehicle, 10, 15 and 22.5 mg/kg Results: No dose dependent plasma level Toxicity - liver and spleen were identified as target organ No gender specific pharmacokinatic No specific PD effect was observed

26 Pharmacokinetic and PK/PD relation Studies with liposomal formulation dose range finder in dogs Part 2: multiple dose, i.v. 30 min infusion, 22.5 mg/kg every second day, 3 applications 3rd dose, female rats Cmax: µg/ml AUCinf: h.µg/ml Results: No difference in PK profile after three applications 3rd dose, female dogs Cmax: µg/ml AUCinf: h.µg/ml No gender specific pharmacokinatic No specific PD effect was observed Dosage still too low? Wrong dosage schedule? Already toxicity observed!

27 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Two weeks repeat dose study, 60 min i.v. infusion every third day saline, empty liposomes, 3, 10, 20mg/Kg Toxicity: NOAEL: 3mg/ml MTD: 20mg/ml Target organ: liver PD effect could not be assessed due to technical issues

28 Pharmacokinetic and PK/PD relation Nonlinear PK, plasma level-time profiles comparable after firstand last administration Half-life increased with phospholipid dose

29 Pharmacokinetic and PK/PD relation Exposure in female animals was higher in high dose group Dose [mg /kg] Non-compartmental analysis [µg/ Sex ml] C max AUC last AUC inf V z t max [h.µg./ [h.µg t 1/2 (z) [ml/ [ml/h [h] # ml] /ml] [h] kg] /kg] R 1 st administration 3 M N/A F N/A M/F N/A 10 M N/A F N/A M/F N/A 20 M N/A F N/A M/F N/A Cl For better evaluation: Comparasion with non-liposomal formulation

30 Repeat dose toxstudy rat Toxicity i.v. 30 min infusion every second day Vehicle, 8, 12, 15, 22.5 and 30 mg/kg Male animals reacted more sensitive than female animals m: single dose 30mg/Kg 3/3 died 20mg/Kg 3/5 died f: after three applications 20mg/Kg 1/5 had to be killed Comparable body weight loss in vehicle and treatment groups

31 Repeat dose toxstudy rat Toxicity Target organ: liver White spots Pale-brown discoloration Moderate elevated liver enzymes: ASAT, ALAT in 20mg/Kg group Increased organ weight Infusion was better tolerated than bolus injection of the same dosage

32 Toxicity TwoweeksGLP toxicitystudy rat 60 min i.v. infusion every third day Vehicle (lipid concentration comparable to high dose), 5% glucose, 5, 10 and 15 mg/kg Target organ: Liver Small focal necrosis, single cell necrosis and dissociation of liver cell strains in mid and high dose group moderate degree Effect of vehicle: dissociation of liver cell strains, reduced food consumption, effect in clinical chemistry NOEAL: 5mg/Kg, MTD: 15mg/Kg

33 Toxicity Two weeks GLP toxicity study in rats clinical chemistry Group No. M/F ALAT [U/l] AP [U/l] ASAT [U/l] T-BIL [U/l] TG [mmol/l] M F M F M F M F M F After the last treatment (study day 14) 1 11/ / / / / End of recovery period(study day 35) 1 3/ / / / Group 1: 5% glucose, Group 2: Vehicle, Group 3: 5mg/Kg, Group 4: 10mg/Kg, Group 5: 15mg/Kg

34 Toxicity Extended single dose toxicity study rat 60 min i.v. infusion Vehicle (lipid concentration comparable to high dose), 5% glucose, 1.25, 2.5, 5, and 15 mg/kg Target organ: Liver Dose dependent necrosis No correlation to increase of liver enzymes no reliable monitoring parameter for clinic No correlation between exposure and increase of liver enzymes No recovery more pronounced effect after 15 days Effect of vehicle: slight liver necorsis Liver toxicity related to liposomal formulation? Administered volume of liposomes above NOEAL?

35 Toxicity Extended single dose toxicity study rat Group 1: Vehicle Group 2: 5% glucose, Group 3: 1.25mg/Kg, Group 4: 2.5mg/Kg, Group 5: 5mg/Kg, Group 6: 15mg/Kg Clinical chemistry

36 Toxicity Extended single dose toxicity study rat Group 1: Vehicle Group 2: glucose, Group 3: 1.25mg/Kg, Group 4: 2.5mg/Kg, Group 5: 5mg/Kg, Group 6: 15mg/Kg NOEAL: 1.25mg/Kg, MTD: 15mg/Kg [histopathological MTD: 2.5mg/Kg]

37 Dose range finder in dogs Toxicity Single dose, 30 min i.v. infusion Vehicle, 10, 15 and 22.5 mg/kg 30 min i.v. infusion, every third day Vehicle and 22.5 mg/kg Results: Changes in biochemistry parameter in all groups: Increased ALAT, ASAT, GGT and Bilirubin Yellow colour of serum samples Spleen weight increased yellow colour of fat tissue in all groups Significant effect of vehicle

38 Toxicity TwoweeksGLP toxicitystudy dogs 60 min i.v. infusion every third day Vehicle (lipid concentration comparable to high dose), saline, 3, 10 and 20 mg/kg Changes in hematology comparable haemolytic effect seen in all groups Biochemistry parameter Elevated ALT, AST, ALP, Bilirubin, GGT and cholesterol level in all groups Increase in spleen and liver weight in all groups no liver necrosis Bile duct hyperplasia in mid and low dose NOEAL: 3 mg/kg, MTD: 20 mg/kg

39 Toxicity TwoweeksGLP toxicitystudy dogs ALT AST GGT ALP CHOL LDH Control 1 2 Vehicle Formulation 3 3 mg/kg VL mg/kg VL mg/kg VL-01 M F M F M F M F M F [U/l] x-fold of control [U/l] % of control [U/l] x-fold of control [U/l] x-fold of control [mmol/l] % of control [U/l] % of control Significant influence of vehicle

40 Toxicity TwoweeksGLP toxicitystudy dogs Adverse effects observed in the vehicle formulation treated groups included considerably increased liver enzye levels (ALT, AST, GGT, ALP, LDH, bilirubin and cholesterol) changes in hematology (decreased RBC, HGB, MCHC levels and increased MCV and RET count) and blood coagulation (decreased APTT) parameters.

41 Lessons learned The following studies were not performed, but seemed to be meaningful for better evaluation of the presented data Organ distribution and PK study liposomal versus non-liposomal formulation Non-liposomal formulation included in toxicity studies In vitro release of the API from liposomes Determination of encapsulated versus nonencapsulated API in vivo In vivo integrity test In vitro assay showed very fast disintegration at low plasma concentration, but no disintegration at high plasma concentration

42 Clinical trial application Feed back from authorities and ethic committée No comments or questions with regard to CMC part Mean issue: therapeutic window too small NOEAL in the most sensitive species was below the dose required to get a significant PD effect

43 Controversial discussion Clinical trial application Are liposomes liver toxic? Does the liposomal formulation contributes to the observed liver toxicity due to liver targeting? Are the toxic effects of the vehicle relevant for the clinical situation or species specific?

44 Dr. Julia Eva Diederichs Pharmaceutical Drug Development Consulting Ehrengutstrasse München Telefon +49 (89) Mobil +49 (179) diederichs-pharma-consult.scherkl.com design by scherkl.com copyright 2012 Dr. Julia Eva Diederichs

>>> Oral Formulation Optimization. Introduction. A Tiered Approach for Identifying Enabling Formulations

>>> Oral Formulation Optimization. Introduction. A Tiered Approach for Identifying Enabling Formulations Application Note #28-DMPK-3 >>> Oral Formulation Optimization Introduction Among the criteria required of compounds advancing from drug discovery programs, adequate systemic exposure (plasma concentrations

More information

Preclinical Requirements for Therapeutic Studies in Humans with Advanced Cancer

Preclinical Requirements for Therapeutic Studies in Humans with Advanced Cancer Preclinical Requirements for Therapeutic Studies in Humans with Advanced Cancer Scott Laurie MD, FRCPC The Ottawa Hospital Cancer Centre Associate Professor, University of Ottawa Disclosures I have no

More information

SAFETY ASPECTS OF MIDAZOLAM

SAFETY ASPECTS OF MIDAZOLAM Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg

More information

IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies

IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies Daniel L. Gustafson, Ph.D. Professor Shipley University Chair in Comparative Oncology Director of Basic Research,

More information

Public Assessment Report Scientific discussion. Kombilipid 200mg/ml, emulsion for infusion SE/H/557/01

Public Assessment Report Scientific discussion. Kombilipid 200mg/ml, emulsion for infusion SE/H/557/01 Public Assessment Report Scientific discussion Kombilipid 200mg/ml, emulsion for infusion Fish oil, rich in omega-3-acids, Olive oil, refined, Soya-bean oil, refined and Triglycerides, medium-chain SE/H/557/01

More information

DMPK. APRIL 27 TH 2017 Jan Neelissen Scientific Adviser Science & Technology

DMPK. APRIL 27 TH 2017 Jan Neelissen Scientific Adviser Science & Technology DMPK APRIL 27 TH 2017 Jan Neelissen Scientific Adviser Science & Technology What I learned is a good DMPK profile have acceptable water solubility for development be completely absorbed, preferably via

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

The Opportunity: c-ibs and pain relief with confidence YKP10811

The Opportunity: c-ibs and pain relief with confidence YKP10811 The Opportunity: c-ibs and pain relief with confidence YKP10811 1 TABLE OF CONTENTS Profile Summary Clinical Data Mode of Action Pharmacologic Profile Safety and Toxicity Profile ADME Overview vs. Competitors

More information

Safety Study of ATN-249, A New Oral Kallikrein Inhibitor for Hereditary Angioedema

Safety Study of ATN-249, A New Oral Kallikrein Inhibitor for Hereditary Angioedema Safety Study of ATN-249, A New Oral Kallikrein Inhibitor for Hereditary Angioedema IRA KALFUS, MD Attune Pharmaceuticals, LLC New York City, NY Andrew McDonald, PhD; Shawn Qian, PhD Attune Pharmaceuticals,

More information

Aug 28 th, 2017 Pierre Daublain

Aug 28 th, 2017 Pierre Daublain Analyzing the Potential Root Causes of Variability of Pharmacokinetics in Preclinical Species to Inform Derisking Strategies in Discovery and Early Development Aug 28 th, 2017 Pierre Daublain Outline Problem

More information

Is a Maximal Tolerated Dose in Human useful for drug development?

Is a Maximal Tolerated Dose in Human useful for drug development? Is a Maximal Tolerated Dose in Human useful for drug development? How to define an acceptable highest dose to be tested? EuFeMED, London Pre-conference Workshop 17-May-2017 Eric Legangneux Philippe Grosjean

More information

AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD

AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning

More information

For the use of only Oncologist or a Cancer Hospital or a laboratory Doxorubicin Hydrochloride Liposome Injection 2 mg/ml KEMODOXA

For the use of only Oncologist or a Cancer Hospital or a laboratory Doxorubicin Hydrochloride Liposome Injection 2 mg/ml KEMODOXA For the use of only Oncologist or a Cancer Hospital or a laboratory Doxorubicin Hydrochloride Liposome Injection 2 mg/ml KEMODOXA COMPOSITION Each ml contains: Doxorubicin Hydrochloride IP...2 mg Water

More information

FDA Expectations and Evaluation of Inhalation Toxicology Studies

FDA Expectations and Evaluation of Inhalation Toxicology Studies FDA Expectations and Evaluation of Inhalation Toxicology Studies Presented by Timothy McGovern, Ph.D. SciLucent, LLC Herndon, Virginia Development of inhalation products has unique regulatory aspects My

More information

Pharmacokinetic and absolute bioavailability studies in early clinical development using microdose and microtracer approaches.

Pharmacokinetic and absolute bioavailability studies in early clinical development using microdose and microtracer approaches. Pharmacokinetic and absolute bioavailability studies in early clinical development using microdose and microtracer approaches. Lloyd Stevens PhD Senior Research Fellow Pharmaceutical Profiles Nottingham,

More information

Nonclinical Safety Evaluation of Inhalation Drug Products

Nonclinical Safety Evaluation of Inhalation Drug Products Nonclinical Safety Evaluation of Inhalation Drug Products February 13, 2002 Life Science Research Organization Bethesda, Maryland Luqi Pei, Ph.D. Division of Pulmonary and Allergy Drug Products Center

More information

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3

Mipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3 (ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,

More information

Public Assessment Report Scientific discussion. Ibuprofen 400 mg/100 ml solution for infusion & Ibuprofen 600 mg/100 ml solution for infusion

Public Assessment Report Scientific discussion. Ibuprofen 400 mg/100 ml solution for infusion & Ibuprofen 600 mg/100 ml solution for infusion Public Assessment Report Scientific discussion Ibuprofen 400 mg/100 ml solution for infusion & Ibuprofen 600 mg/100 ml solution for infusion Ibuprofen arginine ES/H/0390/001/DC ES/H/0392/001/DC Applicant:

More information

IPAC-RS/UF Orlando Inhalation Conference March 20, S.T. Horhota 1, C.B. Verkleij 2, P.J.G. Cornelissen 2, L. Bour 3, A. Sharma 3, M.

IPAC-RS/UF Orlando Inhalation Conference March 20, S.T. Horhota 1, C.B. Verkleij 2, P.J.G. Cornelissen 2, L. Bour 3, A. Sharma 3, M. IPAC-RS/UF Orlando Inhalation Conference March 20, 2014 Case Study: Pharmacokinetics and Pharmacodynamics of Tiotropium and Salmeterol Following Parallel Administration in COPD Patients Using Different

More information

Conflict of Interest Statement

Conflict of Interest Statement Specific Aspects and Approaches for Regulatory Evaluation of Pharmaceuticals in Two-Year Rodent Carcinogenicity Studies James A. Popp Stratoxon LLC Morgantown, PA Tel: 610.286.7592 popp@stratoxon.com Conflict

More information

MODULE PHARMACOKINETICS WRITTEN SUMMARY

MODULE PHARMACOKINETICS WRITTEN SUMMARY MODULE 2.6.4. PHARMACOKINETICS WRITTEN SUMMARY m2.6.4. Pharmacokinetics Written Summary TABLE OF CONTENTS PAGE 1. BRIEF SUMMARY...7 1.1. Test Substance...7 2. METHODS OF ANALYSIS...10 3. ABSORPTION...11

More information

Public Assessment Report. Scientific discussion. Tetraspan 60 mg/ml Tetraspan 100 mg/ml SE/H/609/01-02/MR

Public Assessment Report. Scientific discussion. Tetraspan 60 mg/ml Tetraspan 100 mg/ml SE/H/609/01-02/MR Public Assessment Report Scientific discussion Tetraspan 60 mg/ml Tetraspan 100 mg/ml (Hydroxyethyl starch 130/0.4, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, sodium acetate,

More information

Determination of bioavailability

Determination of bioavailability Pharmaceutics 2 Bioavailability Bioavailability is the rate and extent to which an administered drug reaches the systemic circulation. For example, if 100 mg of a drug is administered orally and 70 mg

More information

The Comet Assay Tails of the (Un)expected

The Comet Assay Tails of the (Un)expected The Comet Assay Tails of the (Un)expected Use of the in vivo comet assay in pharmaceutical development Bas-jan van der Leede Janssen R&D Johnson & Johnson Pharmaceutical Companies Discovery Sciences Genetic

More information

7. SUMMARY, CONCLUSION AND RECOMMENDATIONS

7. SUMMARY, CONCLUSION AND RECOMMENDATIONS 211 7. SUMMARY, CONCLUSION AND RECOMMENDATIONS Drug absorption from the gastro intestinal tract can be limited by various factors with the most common one being poor aqueous solubility and poor permeability

More information

PK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical

PK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical PK and PD Properties of Antisense ligonucleotides: Bridging Nonclinical to Clinical Rosie Z. Yu, Ph.D. Pharmacokinetics & Clinical Pharmacology Isis Pharmaceuticals, Inc. Carlsbad, CA USA 2 Antisense Mechanism

More information

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS The European Agency for the Evaluation of Medicinal Products Veterinary Medicines Evaluation Unit EMEA/MRL/488/98-FINAL July 1998 COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS DIETHYLENE GLYCOL MONOETHYL

More information

Pharmacokinetic Modeling & Simulation in Discovery and non-clinical Development

Pharmacokinetic Modeling & Simulation in Discovery and non-clinical Development Pharmacokinetic Modeling & Simulation in Discovery and non-clinical Development Where do we stand? Disclaimer I am not a bioinformatician, mathematician or biomedical engineer. I am a simple minded pharmacist,

More information

Biopharmaceutics Dosage form factors influencing bioavailability Lec:5

Biopharmaceutics Dosage form factors influencing bioavailability Lec:5 Biopharmaceutics Dosage form factors influencing bioavailability Lec:5 Ali Y Ali BSc Pharmacy MSc Industrial Pharmaceutical Sciences Dept. of Pharmaceutics School of Pharmacy University of Sulaimani 09/01/2019

More information

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:

Individual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product: SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating

More information

Chapter 3. Need for Present Study

Chapter 3. Need for Present Study Need for Present Study Chapter 3 Chemotherapy, the use of cytotoxic drugs to kill cancerous cells remains the most common approach for cancer therapy. In conventional chemotherapy most of the anticancer

More information

Summary Chapter 8 CHAPTER 8. Summary. Page 173

Summary Chapter 8 CHAPTER 8. Summary. Page 173 CHAPTER 8 Summary Page 173 Chapter 2: Liquid Chromatography/Tandem Mass Spectrometry Method for Quantitative Estimation of PEG 400 and its Applications A rapid sensitive and selective MRM based method

More information

Public Assessment Report Scientific discussion. Orest Easyhaler (budesonide, formoterol fumarate dihydrate) SE/H/1214/02-03/DC

Public Assessment Report Scientific discussion. Orest Easyhaler (budesonide, formoterol fumarate dihydrate) SE/H/1214/02-03/DC Public Assessment Report Scientific discussion Orest Easyhaler (budesonide, formoterol fumarate dihydrate) SE/H/1214/02-03/DC This module reflects the scientific discussion for the approval of Orest Easyhaler.

More information

ICH Topic S1C(R2) Dose Selection for Carcinogenicity Studies of Pharmaceuticals. Step 5

ICH Topic S1C(R2) Dose Selection for Carcinogenicity Studies of Pharmaceuticals. Step 5 European Medicines Agency October 2008 EMEA/CHMP/ICH/383/1995 ICH Topic S1C(R2) Dose Selection for Carcinogenicity Studies of Pharmaceuticals Step 5 NOTE FOR GUIDANCE ON DOSE SELECTION FOR CARCINOGENICITY

More information

Public Assessment Report Scientific discussion. Eezeneo (Diclofenac potassium) Asp. no:

Public Assessment Report Scientific discussion. Eezeneo (Diclofenac potassium) Asp. no: Public Assessment Report Scientific discussion Eezeneo (Diclofenac potassium) Asp. no: 2005-0629 - 2005-0630 This module reflects the scientific discussion for the approval of Eezeneo. The procedure was

More information

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5

More information

Public Assessment Report. Scientific discussion. Celecoxib Apotex 100 mg and 200 mg, capsules, hard (celecoxib) NL/H/2760/ /DC

Public Assessment Report. Scientific discussion. Celecoxib Apotex 100 mg and 200 mg, capsules, hard (celecoxib) NL/H/2760/ /DC Public Assessment Report Scientific discussion Celecoxib Apotex 100 mg and 200 mg, capsules, hard (celecoxib) NL/H/2760/001-002/DC Date: 29 April 2014 This module reflects the scientific discussion for

More information

Step-by-step instructions for intravenous (iv) infusions for patients with:

Step-by-step instructions for intravenous (iv) infusions for patients with: Step-by-step instructions for intravenous (iv) infusions for patients with: Rheumatoid Arthritis (RA) Systemic Juvenile Idiopathic Arthritis (sjia) Polyarticular Juvenile Idiopathic Arthritis (pjia) Please

More information

Public Assessment Report. Mebeverine hydrochloride 50mg/5ml Oral Suspension. (Mebeverine hydrochloride) UK Licence No: PL 44710/0024

Public Assessment Report. Mebeverine hydrochloride 50mg/5ml Oral Suspension. (Mebeverine hydrochloride) UK Licence No: PL 44710/0024 Public Assessment Report Mebeverine hydrochloride 50mg/5ml Oral Suspension (Mebeverine hydrochloride) UK Licence No: PL 44710/0024 Kinedexe UK Limited 1 LAY SUMMARY Mebeverine hydrochloride 50mg/5ml Oral

More information

DOSE SELECTION FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS *)

DOSE SELECTION FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS *) DOSE SELECTION FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS *) Guideline Title Dose Selection for Carcinogenicity Studies of Pharmaceuticals *) Legislative basis Directive 75/318/EEC as amended Date

More information

PUBLIC ASSESSMENT REPORT Scientific Discussion

PUBLIC ASSESSMENT REPORT Scientific Discussion Direction de l Evaluation des Médicaments et des Produits Biologiques PUBLIC ASSESSMENT REPORT Scientific Discussion Tramadol hydrochloride + paracetamol 37.5 mg-325 mg Grünenthal film coated tablets Bonoc

More information

SMe. Me NITROIMIDAZOLES FOR VISCERAL LEISHMANIASIS FEXINIDAZOLE AND VL-2098 SHYAM SUNDAR

SMe. Me NITROIMIDAZOLES FOR VISCERAL LEISHMANIASIS FEXINIDAZOLE AND VL-2098 SHYAM SUNDAR SMe O 2 CH 2 O Me ITROIMIDAZOLES FOR VISCERAL LEISHMAIASIS FEXIIDAZOLE AD VL-2098 SHYAM SUDAR Target Product Profile for a CE Optimal Target Profile Target Label VL and PKDL VL Spp All species L. donavani

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

SCIENTIFIC DISCUSSION. Efavirenz

SCIENTIFIC DISCUSSION. Efavirenz SCIENTIFIC DISCUSSION Name of the Finished Pharmaceutical Product: Manufacturer of Prequalified Product: Active Pharmaceutical Ingredient (API): Pharmaco-therapeutic group (ATC Code): Therapeutic indication:

More information

Adaptive and Innovative Study Designs to Accelerate Drug Development from First-In-Human to First-In-Patient

Adaptive and Innovative Study Designs to Accelerate Drug Development from First-In-Human to First-In-Patient Adaptive and Innovative Study Designs to Accelerate Drug Development from First-In-Human to First-In-Patient Michelle L. Combs, PhD Vice President, Clinical Pharmacology Sciences New Drug And Biologics

More information

Practical approaches for endocrine toxicity in preclinical safety assessment

Practical approaches for endocrine toxicity in preclinical safety assessment Practical approaches for endocrine toxicity in preclinical safety assessment Akira Inomata, D.V.M., Ph.D., D.J.S.T.P. Tsukuba Drug Safety, Global Drug Safety, Biopharmaceutical Assessments Core Function

More information

SCIENTIFIC DISCUSSION. Lopinavir and Ritonavir 200 mg/50 mg Tablets * Name of the Finished Pharmaceutical Product:

SCIENTIFIC DISCUSSION. Lopinavir and Ritonavir 200 mg/50 mg Tablets * Name of the Finished Pharmaceutical Product: SCIENTIFIC DISCUSSION Name of the Finished Pharmaceutical Product: Manufacturer of Prequalified Product: Active Pharmaceutical Ingredients (APIs): Pharmaco-therapeutic group (ATC Code): Therapeutic indication:

More information

Public Assessment Report Scientific discussion. Anastrozole Bluefish 1 mg film-coated tablets (anastrozole) SE/H/781/01/DC

Public Assessment Report Scientific discussion. Anastrozole Bluefish 1 mg film-coated tablets (anastrozole) SE/H/781/01/DC Public Assessment Report Scientific discussion Anastrozole Bluefish 1 mg film-coated tablets (anastrozole) SE/H/781/01/DC This module reflects the scientific discussion for the approval of Anastrozole

More information

Ciprofloxacin Bluefish (Ciprofloxacin hydrochloride)

Ciprofloxacin Bluefish (Ciprofloxacin hydrochloride) Public Assessment Report Scientific discussion Ciprofloxacin Bluefish (Ciprofloxacin hydrochloride) Asp. no: 2006-1626 - 1628 This module reflects the scientific discussion for the approval of Ciprofloxacin

More information

Year in review. Vit Perlik Director of Regulatory Science and Clinical Development

Year in review. Vit Perlik Director of Regulatory Science and Clinical Development Year in review Vit Perlik Director of Regulatory Science and Clinical Development Content Year in review Covering September 2013 to September 2014 Where the regulation goes selection of events for illustration

More information

Clinical Study Synopsis for Public Disclosure

Clinical Study Synopsis for Public Disclosure abcd Clinical Study for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of the clinical

More information

Preclinical Experience with rhasm for Niemann-Pick Disease

Preclinical Experience with rhasm for Niemann-Pick Disease Preclinical Experience with rhasm for Niemann-Pick Disease Gerry Cox, MD, PhD Vice President, Clinical Development September 16, 2014 Shani Niemann-Pick disease Type B UK www.genzyme.com Acid Sphingomyelinase

More information

Public Assessment Report Scientific discussion. Nicorette Pepparmint (nicotine) SE/H/904/01/DC

Public Assessment Report Scientific discussion. Nicorette Pepparmint (nicotine) SE/H/904/01/DC Public Assessment Report Scientific discussion Nicorette Pepparmint (nicotine) SE/H/904/01/DC This module reflects the scientific discussion for the approval of Nicorette Pepparmint. The procedure was

More information

FDB FOOD AND DRUGS BOARD G H A N A GUIDELINES FOR CONDUCTING BIOEQUIVALENCE STUDIES

FDB FOOD AND DRUGS BOARD G H A N A GUIDELINES FOR CONDUCTING BIOEQUIVALENCE STUDIES FDB FOOD AND DRUGS BOARD G H A N A GUIDELINES FOR CONDUCTING BIOEQUIVALENCE STUDIES 1 SCOPE In pursuance of section 47 of the Food and Drugs Law 1992, P.N.D.C.L 305B, as amended by Act 523, 1996, these

More information

This clinical study synopsis is provided in line with Boehringer Ingelheim s Policy on Transparency and Publication of Clinical Study Data.

This clinical study synopsis is provided in line with Boehringer Ingelheim s Policy on Transparency and Publication of Clinical Study Data. abcd Clinical Study for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis which is part of the clinical

More information

Varun Goel 1, Nathalie H Gosselin 2, Claudia Jomphe 2, Husain Attarwala 1, Xiaoping (Amy) Zhang 1, JF Marier 2, Gabriel Robbie 1

Varun Goel 1, Nathalie H Gosselin 2, Claudia Jomphe 2, Husain Attarwala 1, Xiaoping (Amy) Zhang 1, JF Marier 2, Gabriel Robbie 1 Population Pharmacokinetic (PK) / Pharmacodynamic (PD) Model of Serum Transthyretin (TTR) Following Patisiran Administration in Healthy Volunteers and Patients with Hereditary TTR-Mediated (hattr) Amyloidosis

More information

Section 5.2: Pharmacokinetic properties

Section 5.2: Pharmacokinetic properties Section 5.2: Pharmacokinetic properties SmPC training presentation Note: for full information refer to the European Commission s Guideline on summary of product characteristics (SmPC) SmPC Advisory Group

More information

Liposome Drug Products Chemistry, Manufacturing, and Controls; Human Pharmacokinetics and Bioavailability; and Labeling Documentation

Liposome Drug Products Chemistry, Manufacturing, and Controls; Human Pharmacokinetics and Bioavailability; and Labeling Documentation Liposome Drug Products Chemistry, Manufacturing, and Controls; Human Pharmacokinetics and Bioavailability; and Labeling Documentation Guidance for Industry U.S. Department of Health and Human Services

More information

Oral Formulations for Poorly Water Soluble Compounds. SAQ - Fachgruppe Pharma & Chemie Oskar Kalb, Novartis Pharma AG Basel Olten, 23.

Oral Formulations for Poorly Water Soluble Compounds. SAQ - Fachgruppe Pharma & Chemie Oskar Kalb, Novartis Pharma AG Basel Olten, 23. Oral Formulations for Poorly Water Soluble Compounds SAQ - Fachgruppe Pharma & Chemie Oskar Kalb, Novartis Pharma AG Basel Olten, 23. June 2009 Oral Delivery of Poorly Water Soluble Compounds For systemic

More information

Viera Lukacova Director, Simulation Sciences

Viera Lukacova Director, Simulation Sciences Use of In Silico Mechanistic Models to Support Interspecies Extrapolation of Oral Bioavailability and Formulation Optimization: Model Example Using GastroPlus Viera Lukacova Director, Simulation Sciences

More information

SCIENTIFIC DISCUSSION. Darunavir

SCIENTIFIC DISCUSSION. Darunavir This part reflects the scientific knowledge and the information about this product available at the time of prequalification. Thereafter, updates may have become necessary which are included in parts 1

More information

Guideline for the Development of Liposome Drug Products

Guideline for the Development of Liposome Drug Products 参考 ( ガイドライン英訳 ) Guideline for the Development of Liposome Drug Products (March 2016, MHLW, Japan) Table of Contents 1. Introduction... 3 2. Scope... 3 3. Chemistry, manufacturing, and controls... 4 3.1

More information

SCIENTIFIC DISCUSSION

SCIENTIFIC DISCUSSION SCIENTIFIC DISCUSSION 1 Introduction This is an application for a CHMP Scientific Opinion in accordance with Article 58 of Regulation (EC) No 726/2004, in the context of cooperation with the World Health

More information

Development of Canagliflozin: Mechanistic Absorption Modeling During Late-Stage Formulation and Process Optimization

Development of Canagliflozin: Mechanistic Absorption Modeling During Late-Stage Formulation and Process Optimization Development of Canagliflozin: Mechanistic Absorption Modeling During Late-Stage Formulation and Process Optimization Nico Holmstock Scientist, Janssen R&D M CERSI 2017, BALTIMORE (USA) Canagliflozin An

More information

Modeling & Simulation to support evaluation of Safety and Efficacy of Drugs in Older Patients

Modeling & Simulation to support evaluation of Safety and Efficacy of Drugs in Older Patients Modeling & Simulation to support evaluation of Safety and Efficacy of Drugs in Older Patients Eva Bredberg, Director Global Clinical Pharmacology, AstraZeneca On behalf of EFPIA EMA Geriatrics Workshop

More information

BASIC PHARMACOKINETICS

BASIC PHARMACOKINETICS BASIC PHARMACOKINETICS MOHSEN A. HEDAYA CRC Press Taylor & Francis Croup Boca Raton London New York CRC Press is an imprint of the Taylor & Francis Group, an informa business Table of Contents Chapter

More information

ICH Topic M 4 S Common Technical Document for the Registration of Pharmaceuticals for Human Use - Safety. Step 5

ICH Topic M 4 S Common Technical Document for the Registration of Pharmaceuticals for Human Use - Safety. Step 5 European Medicines Agency July 23 CPMP/ICH/2887/99 Safety ICH Topic M 4 S Common Technical Document for the Registration of Pharmaceuticals for Human Use Safety Step 5 COMMON TECHNICAL DOCUMENT FOR THE

More information

Public Assessment Report Scientific discussion. Salmeterol/Fluticasone Sandoz (salmeterol xinafoate, fluticasone propionate) SE/H/1323/03/DC

Public Assessment Report Scientific discussion. Salmeterol/Fluticasone Sandoz (salmeterol xinafoate, fluticasone propionate) SE/H/1323/03/DC Public Assessment Report Scientific discussion Salmeterol/Fluticasone Sandoz (salmeterol xinafoate, fluticasone propionate) SE/H/1323/03/DC This module reflects the scientific discussion for the approval

More information

Public Assessment Report Scientific discussion. Ciprofloxacin Accord (ciprofloxacin hydrochloride) SE/H/1026/01-03/DC

Public Assessment Report Scientific discussion. Ciprofloxacin Accord (ciprofloxacin hydrochloride) SE/H/1026/01-03/DC Public Assessment Report Scientific discussion Ciprofloxacin Accord (ciprofloxacin hydrochloride) SE/H/1026/01-03/DC This module reflects the scientific discussion for the approval of Ciprofloxacin Accord.

More information

NCCP Chemotherapy Regimen

NCCP Chemotherapy Regimen Dose Dense DOXOrubicin, Cyclophosphamide (AC 60/600) 14 day followed by PACLitaxel (175) 14 day and Trastuzumab Therapy (DD AC-TH) Note: There is an option for Dose Dense DOXOrubicin, cyclophosphamide

More information

EMA/EGA. Session 1: orally administered Modified Release Products European Regulatory Requirements London 30 April 2015 Dr.

EMA/EGA. Session 1: orally administered Modified Release Products European Regulatory Requirements London 30 April 2015 Dr. EMA/EGA Session 1: orally administered Modified Release Products European Regulatory Requirements London 30 April 2015 Dr. Henrike Potthast Disclaimer The presentation reflects the personal opinion of

More information

Basic Biopharmaceutics, Pharmacokinetics, and Pharmacodynamics

Basic Biopharmaceutics, Pharmacokinetics, and Pharmacodynamics Basic Biopharmaceutics, Pharmacokinetics, and Pharmacodynamics Learning Outcomes Define biopharmaceutics Describe 4 processes of pharmacokinetics Describe factors that affect medication absorption Describe

More information

Public Assessment Report. Scientific discussion. Thyrofix 25, 50, 75 and 100 micrograms tablets. (levothyroxine sodium) NL/H/3039/ /DC

Public Assessment Report. Scientific discussion. Thyrofix 25, 50, 75 and 100 micrograms tablets. (levothyroxine sodium) NL/H/3039/ /DC Public Assessment Report Scientific discussion Thyrofix 25, 50, 75 and 100 micrograms tablets (levothyroxine sodium) NL/H/3039/001-004/DC Date: 19 February 2015 This module reflects the scientific discussion

More information

Absolute bioavailability and pharmacokinetic studies in early clinical development using microdose and microtracer approaches.

Absolute bioavailability and pharmacokinetic studies in early clinical development using microdose and microtracer approaches. Absolute bioavailability and pharmacokinetic studies in early clinical development using microdose and microtracer approaches. Dr Lloyd Stevens Senior Research Fellow Pharmaceutical Profiles Nottingham,

More information

PK/PD analysis in assessment of abuse deterrence

PK/PD analysis in assessment of abuse deterrence PK/PD analysis in assessment of abuse deterrence Megan J. Shram, PhD Director and Principal, Altreos Research Partners Inc. Adjunct Professor and Lecturer, Department of Pharmacology, University of Toronto

More information

BENZETHONIUM CHLORIDE

BENZETHONIUM CHLORIDE OPINION OF THE SCIENTIFIC COMMITTEE ON COSMETIC PRODUCTS AND NON-FOOD PRODUCTS INTENDED FOR CONSUMERS CONCERNING BENZETHONIUM CHLORIDE COLIPA n P 70 adopted by the SCCNFP during the 26 th plenary meeting

More information

Decentralised Procedure. Public Assessment Report. Lorazepam-neuraxpharm 1/ 2,5 mg Schmelztabletten. Lorazepam DE/H/4558/ /DC

Decentralised Procedure. Public Assessment Report. Lorazepam-neuraxpharm 1/ 2,5 mg Schmelztabletten. Lorazepam DE/H/4558/ /DC Decentralised Procedure Public Assessment Report Lorazepam-neuraxpharm 1/ 2,5 mg Schmelztabletten Lorazepam DE/H/4558/001-002/DC Applicant: neuraxpharm Arzneimittel GmbH, Germany Reference Member State

More information

Sponsor: Sanofi Drug substance(s): GZ316455

Sponsor: Sanofi Drug substance(s): GZ316455 These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor: Sanofi Drug substance(s):

More information

Product: Omecamtiv Mecarbil Clinical Study Report: Date: 02 April 2014 Page 1

Product: Omecamtiv Mecarbil Clinical Study Report: Date: 02 April 2014 Page 1 Date: 02 April 2014 Page 1. 2. SYNOPSIS Name of Sponsor: Amgen Inc. Name of Finished Product: Omecamtiv mecarbil injection Name of Active Ingredient: Omecamtiv mecarbil (AMG 423) Title of Study: A double-blind,

More information

Public Assessment Report. Scientific discussion. Metoprololsuccinat Actavis. Prolonged release tablets 25 mg, 50 mg, 100 mg and 200 mg

Public Assessment Report. Scientific discussion. Metoprololsuccinat Actavis. Prolonged release tablets 25 mg, 50 mg, 100 mg and 200 mg Public Assessment Report Scientific discussion Metoprololsuccinat Actavis Prolonged release tablets 25 mg, 50 mg, 100 mg and 200 mg Metoprolol succinate This module reflects the scientific discussion for

More information

Individual Study Table Referring to Part of the Dossier. Volume:

Individual Study Table Referring to Part of the Dossier. Volume: Final Report M/100977/21Final Version () 2. SYNOPSIS A Title of Study: A PHASE IIa, RANDOMISED, DOUBLE-BLIND, MULTIPLE DOSE, PLACEBO CONTROLLED, 3 PERIOD CROSS-OVER, ASCENDING DOSE CLINICAL TRIAL TO ASSESS

More information

Clinical Study Synopsis for Public Disclosure

Clinical Study Synopsis for Public Disclosure abcd Clinical Study Synopsis for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of

More information

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related

More information

Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology

Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology Declarations Nonclinical studies All procedures performed on

More information

Drug Delivery to the CNS: Barriers that May Influence Efficacy in Treating Tuberculosis in the Brain

Drug Delivery to the CNS: Barriers that May Influence Efficacy in Treating Tuberculosis in the Brain Drug Delivery to the CNS: Barriers that May Influence Efficacy in Treating Tuberculosis in the Brain TB-Meningitis Blood Brain Barrier astrocyte endfeet TB-Meningitis Rockville MD 22-23 May 2017 tight

More information

NOTE FOR GUIDANCE ON TOXICOKINETICS: THE ASSESSMENT OF SYSTEMIC EXPOSURE IN TOXICITY STUDIES S3A

NOTE FOR GUIDANCE ON TOXICOKINETICS: THE ASSESSMENT OF SYSTEMIC EXPOSURE IN TOXICITY STUDIES S3A INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE NOTE FOR GUIDANCE ON TOXICOKINETICS: THE ASSESSMENT

More information

ENMD-2076, an Oral Aurora A and Angiogenesis Kinase Inhibitor

ENMD-2076, an Oral Aurora A and Angiogenesis Kinase Inhibitor ENMD-2076, an Oral Aurora A and Angiogenesis Kinase Inhibitor Dr. Mark R. Bray VP Research, EntreMed, Inc. AACR Annual Meeting New Drugs on the Horizon 2 April 2008 1 Disclosure Information: AACR New Drugs

More information

Public Assessment Report. Scientific discussion. Tadalafil 1A Pharma 2.5 mg, 5 mg, 10 mg and 20 mg, film-coated tablets.

Public Assessment Report. Scientific discussion. Tadalafil 1A Pharma 2.5 mg, 5 mg, 10 mg and 20 mg, film-coated tablets. Public Assessment Report Scientific discussion Tadalafil 1A Pharma 2.5 mg, 5 mg, 10 mg and 20 mg, film-coated tablets (tadalafil) NL/H/3634/001-004/DC Date: 24 May 2017 This module reflects the scientific

More information

Sponsor / Company: Sanofi Drug substance: SAR236553/REGN727 (alirocumab)

Sponsor / Company: Sanofi Drug substance: SAR236553/REGN727 (alirocumab) These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance:

More information

Mutual Recognition Procedure. Public Assessment Report. Valproat Orion 300 / 500 mg Retardtabletten. Sodium valproate DE/H/1910/ /MR

Mutual Recognition Procedure. Public Assessment Report. Valproat Orion 300 / 500 mg Retardtabletten. Sodium valproate DE/H/1910/ /MR Mutual Recognition Procedure Public Assessment Report Valproat Orion 300 / 500 mg Retardtabletten Sodium valproate DE/H/1910/001-002/MR (former FI/H/0608/001-002/MR) Applicant: Orion Corporation Date:

More information

Synopsis (C1034T02) CNTO 95 Module 5.3 Clinical Study Report C1034T02

Synopsis (C1034T02) CNTO 95 Module 5.3 Clinical Study Report C1034T02 Module 5.3 Protocol: EudraCT No.: 2004-002130-18 Title of the study: A Phase 1/2, Multi-Center, Blinded, Randomized, Controlled Study of the Safety and Efficacy of the Human Monoclonal Antibody to Human

More information

AAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao

AAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference

More information

Nanomedicine & Drug Delivery Systems Group Research Institute for Medicines and Pharmaceutical Sciences (imed.ul)

Nanomedicine & Drug Delivery Systems Group Research Institute for Medicines and Pharmaceutical Sciences (imed.ul) Faculty of Pharmacy of the University of Lisbon Nanomedicine & Drug Delivery Systems Group Research Institute for Medicines and Pharmaceutical Sciences (imed.ul) Leishmania in southern Europe. (Duiardin,

More information

Public Assessment Report. Scientific discussion. Pentasa Compact 4 g, prolonged-release granules. (mesalazine) NL License RVG:

Public Assessment Report. Scientific discussion. Pentasa Compact 4 g, prolonged-release granules. (mesalazine) NL License RVG: Public Assessment Report Scientific discussion Pentasa Compact 4 g, prolonged-release granules (mesalazine) NL License RVG: 114015 Date: 30 March 2015 This module reflects the scientific discussion for

More information

The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only.

The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only. The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only. Please note that the results reported in any single trial may not reflect the overall

More information

Clinical Study Synopsis for Public Disclosure

Clinical Study Synopsis for Public Disclosure abcd Clinical Study Synopsis for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of

More information

PHARMACEUTICS I صيدالنيات 1 UNIT 1 INTRODUCTION

PHARMACEUTICS I صيدالنيات 1 UNIT 1 INTRODUCTION PHARMACEUTICS I صيدالنيات 1 UNIT 1 INTRODUCTION 1 PHARMACEUTICS Pharmaceutics is the science of dosage form design. The general area of study concerned with the formulation, manufacture, stability, and

More information

Drug discovery and development for the treatment and control of filariasis: repurposing emodepside

Drug discovery and development for the treatment and control of filariasis: repurposing emodepside Drug discovery and development for the treatment and control of filariasis: repurposing emodepside IMMIP, Bonn Sabine Specht, Achim Hoerauf DNDi Robert Don Ivan Scandale NPIMR, Northwick Park Simon Townson

More information

Coping with Analytical Interferences

Coping with Analytical Interferences Coping with Analytical Interferences (Handling Icteric, Hemolytic and Lipaemic Samples) Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements

More information