Pharmaceutical Drug Development Consulting
|
|
- Aubrey Hall
- 5 years ago
- Views:
Transcription
1 Dr. Julia Eva Diederichs Pharmaceutical Drug Development Consulting Preclinical investigations and animal studies: for comprehensive characterisation what is scientifically possible and meaningful
2 A Case Study Development of a liposomal formulation with a NCE for Phase I long term application chronic disease no oncological indication no orphan drug
3 Characterisation of the API CMC Very poorly soluble < 1 µg/ml High moleculare weight: ~ 750 g/mol Highly lipophilic High plasma protein binding > 99.9 % Very low permeability Chemically instable storage at -20 C Sensitive against base and acid purpose of the liposomal formulation: solubilisation and stabilisation
4 Liposomal formulation CMC Two component approach Empty Liposomes Drug loaded transfer medium Purpose of this formulation Immediate preparation and use due to instable drug Final formulation only stable over 48 hours
5 Preparation of the liposomes CMC Transfer medium by mixing 50mg/ml API PEG300 & Ethanol (9:1) Empty liposomes by high pressure homogenisation 96.2 mg/ml phospholipids (mainly soy PC) 21.6 mg/ml Glycerol 2.5 ml Transfer medium ml liposomal Dispersion oscillation shaker for 20 min In-situ loading by instant solubilisation technique
6 CMC Characterisation of the final formulation Batch to batch conformity? Composition 1.5 mg/ml API 93.3 mg/ml Phospholipid 28.8 mg/ml PEG mg/ml Ethanol 20.9 mg/ml Glycerol Physico-chemical characterisation Particle size: nm / PI (Spec. < 100nm / PI < 0.6) Zetapotential: around - 25 mv (Spec. Report value) Drug to Lipid ratio: 0.016
7 Partical size determination CMC PCS Mean diameter nm / PI Bimodal distribution curve seen for volume and number distribution PI decreases with higher dilution of the sample CyroTEM Particle size: 20 nm Different liposome types were detected
8 Partical size determination CMC CryoTEM picture Determination of lamellarity recommended
9 Application route and dosing Intended treatment for Phase I i.v. influsion over 60 min Application volume: 200ml single escalation dose: mg API in 7 dosage steps Composition of highest dose 0.2 g API g Phospholipid 3.8 g PEG g Ethanol 2.8 mg Glycerol 67 ml 5% Glucose as diluent High amount of excipients needed to solubilise desired amount of API
10 Potential toxicity of excipients The following i.v. applied maximal doses are considered acceptable Ethanol: 4.8 mg/kg Glycerol: 42.1 mg/kg Phospholipid: recommended dose for parenteral nutrition 2g fat/kg BW/day however: adverse effects can not be excluded Reversible increase of liver enzymes are reported PEG300: 3.6 g/patient (oral application) however: for i.v. application of PEG400 nephrotoxicity is reported
11 Pharmacology In vitro primary Pharmacodynamics Mode of action: Inhibition of a peptidase IC50 was tested in various cellular assays ( nm) and in blood (20-40µg/ml due to high plasma protein binding) Cave: All in vitro assays were performed with API DMSO solution Therapeutic effect EC50 was determined in an cellular assay with API DMSO solution: 800nM Interaction of liposomes with cells was not considered
12 In vivo Pharmacodynamics Pharmacology No satisfactory animal model exists Elucidation of pharmacodynamic properties is limited to in vitro studies To monitor proposed in vivo effect inhibition of the peptidase was quantified in various PK and Tox studies as surrogate parameter in plasma and/or liver
13 Pharmacology In vitro secondary Pharmacodynamics Cytotoxic effect CC50: 5.2µM ~ 50% apoptotic and necrotic cells were observed at a concentration >5.5µM Tox Ratio CC50/EC50: 6.4 Cytotoxicity assays were performed with DMSO solution and liposomal formulation Liposomal formulation showed higher toxicity Cytotoxic effects could be observed as with the empty liposomes
14 Pharmacology Safety pharmacoloigy according to ICH S7A No critical findings in the intended dosage range In vivo studies were performed with the liposomal formulation In vitro studies were performed with DMSO solution Different formulations for in vitro and in vivo
15 In vitro metabolism Pharmacokinetic and PK/PD relation Inhibition of CYPs 3A4, 2C9, 2C19 and 2D6 Lowest metabolic stability in cynomolgus Low metabolic stability in human and mice High metabolic stability in dog and rat Cave: study was not performed with liposomal formulation Pivotal preclinical studies were performed in rat and dog
16 Pharmacokinetic and PK/PD relation Preliminary studies with aqueous formulation- rat 10% DMSO, 20% Cremophor RH40 Single dose, i.v. bolus dose Inhibititon on Cmax toxicity 15mg/Kg % No clinical signs 30mg/Kg 71 % No clinical signs 45mg/Kg 90 % MTD, 2/5 died Cmax 3h post administration Good dose/exposure correlation
17 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Single dose, i.v. bolus, 30mg/Kg Cmax Max. Inhibition solution 8.8 µg/ml 71 % after 3 hours liposomes µg/ml 63 % after 8 hours Toxicity comparable Recovery delated (48 vs 24 hours) Influence of liposomal formulation on pharmacokinatic
18 Pharmacokinetic and PK/PD relation i.v. bolus, single dose 30mg/Kg, rat - PK/PD relation Blue: plasma concentration Red: inhibition
19 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Single and repeat dose, 30 min i.v. infusion every second day, 15mg/Kg Repeated dose caused mild clinical findings PD effect in plasma: up to 60% inhibition but high fluctuation Clear and more pronounced PD effect in the liver For better evaluation: Organ distribution study liposomal vs. nonliposomal formulation
20 Studies with liposomal formulation- rat Pharmacokinetic and PK/PD relation Two weeks repeat dose study, 60 min i.v. infusion every third day 5% glucose, empty liposomes, 5, 10, 15mg/Kg Toxicity: NOAEL: 5mg/ml MTD: 15mg/ml Target organ: liver PD effect could not be assessed due to technical issues
21 Pharmacokinetic and PK/PD relation NonlinearPK, significantlylower exposureafter thelast dose, no dose correlation For better evaluation: Organ distribution study liposomal vs nonliposomal formulation?
22 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Single dose, i.v. bolus vehicle, 2, 4 and 7.5 mg/kg Toxicity: no clinical finding No relevant PD effect dosage too low Gender specific difference in pharmacokinatik for high dose group
23 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation mg/kg male 4 mg/kg male 7.5 mg/kg male 2 mg/kg female 4 mg/kg female 7.5 mg/kg female Concentration [ng/ml] time profile time (h)
24 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Gender specific pharmacokinetic in high dose Dose [mg/k g] Non-compartmental analysis [µg/ml Sex ] C max AUC last AUC inf t max [h] # [h.µg. /ml] [h.µg t t 1/2 (z) V z /ml] [h] [ml/kg] Cl [ml/h/k g] 2 M F M F M F Formulation related effect as not seen with DMSO/surfactant formulation?
25 Pharmacokinetic and PK/PD relation Studies with liposomal formulation dose range finder in dogs Part 1: single escalation dose, i.v. 30 min infusion vehicle, 10, 15 and 22.5 mg/kg Results: No dose dependent plasma level Toxicity - liver and spleen were identified as target organ No gender specific pharmacokinatic No specific PD effect was observed
26 Pharmacokinetic and PK/PD relation Studies with liposomal formulation dose range finder in dogs Part 2: multiple dose, i.v. 30 min infusion, 22.5 mg/kg every second day, 3 applications 3rd dose, female rats Cmax: µg/ml AUCinf: h.µg/ml Results: No difference in PK profile after three applications 3rd dose, female dogs Cmax: µg/ml AUCinf: h.µg/ml No gender specific pharmacokinatic No specific PD effect was observed Dosage still too low? Wrong dosage schedule? Already toxicity observed!
27 Studies with liposomal formulation- dog Pharmacokinetic and PK/PD relation Two weeks repeat dose study, 60 min i.v. infusion every third day saline, empty liposomes, 3, 10, 20mg/Kg Toxicity: NOAEL: 3mg/ml MTD: 20mg/ml Target organ: liver PD effect could not be assessed due to technical issues
28 Pharmacokinetic and PK/PD relation Nonlinear PK, plasma level-time profiles comparable after firstand last administration Half-life increased with phospholipid dose
29 Pharmacokinetic and PK/PD relation Exposure in female animals was higher in high dose group Dose [mg /kg] Non-compartmental analysis [µg/ Sex ml] C max AUC last AUC inf V z t max [h.µg./ [h.µg t 1/2 (z) [ml/ [ml/h [h] # ml] /ml] [h] kg] /kg] R 1 st administration 3 M N/A F N/A M/F N/A 10 M N/A F N/A M/F N/A 20 M N/A F N/A M/F N/A Cl For better evaluation: Comparasion with non-liposomal formulation
30 Repeat dose toxstudy rat Toxicity i.v. 30 min infusion every second day Vehicle, 8, 12, 15, 22.5 and 30 mg/kg Male animals reacted more sensitive than female animals m: single dose 30mg/Kg 3/3 died 20mg/Kg 3/5 died f: after three applications 20mg/Kg 1/5 had to be killed Comparable body weight loss in vehicle and treatment groups
31 Repeat dose toxstudy rat Toxicity Target organ: liver White spots Pale-brown discoloration Moderate elevated liver enzymes: ASAT, ALAT in 20mg/Kg group Increased organ weight Infusion was better tolerated than bolus injection of the same dosage
32 Toxicity TwoweeksGLP toxicitystudy rat 60 min i.v. infusion every third day Vehicle (lipid concentration comparable to high dose), 5% glucose, 5, 10 and 15 mg/kg Target organ: Liver Small focal necrosis, single cell necrosis and dissociation of liver cell strains in mid and high dose group moderate degree Effect of vehicle: dissociation of liver cell strains, reduced food consumption, effect in clinical chemistry NOEAL: 5mg/Kg, MTD: 15mg/Kg
33 Toxicity Two weeks GLP toxicity study in rats clinical chemistry Group No. M/F ALAT [U/l] AP [U/l] ASAT [U/l] T-BIL [U/l] TG [mmol/l] M F M F M F M F M F After the last treatment (study day 14) 1 11/ / / / / End of recovery period(study day 35) 1 3/ / / / Group 1: 5% glucose, Group 2: Vehicle, Group 3: 5mg/Kg, Group 4: 10mg/Kg, Group 5: 15mg/Kg
34 Toxicity Extended single dose toxicity study rat 60 min i.v. infusion Vehicle (lipid concentration comparable to high dose), 5% glucose, 1.25, 2.5, 5, and 15 mg/kg Target organ: Liver Dose dependent necrosis No correlation to increase of liver enzymes no reliable monitoring parameter for clinic No correlation between exposure and increase of liver enzymes No recovery more pronounced effect after 15 days Effect of vehicle: slight liver necorsis Liver toxicity related to liposomal formulation? Administered volume of liposomes above NOEAL?
35 Toxicity Extended single dose toxicity study rat Group 1: Vehicle Group 2: 5% glucose, Group 3: 1.25mg/Kg, Group 4: 2.5mg/Kg, Group 5: 5mg/Kg, Group 6: 15mg/Kg Clinical chemistry
36 Toxicity Extended single dose toxicity study rat Group 1: Vehicle Group 2: glucose, Group 3: 1.25mg/Kg, Group 4: 2.5mg/Kg, Group 5: 5mg/Kg, Group 6: 15mg/Kg NOEAL: 1.25mg/Kg, MTD: 15mg/Kg [histopathological MTD: 2.5mg/Kg]
37 Dose range finder in dogs Toxicity Single dose, 30 min i.v. infusion Vehicle, 10, 15 and 22.5 mg/kg 30 min i.v. infusion, every third day Vehicle and 22.5 mg/kg Results: Changes in biochemistry parameter in all groups: Increased ALAT, ASAT, GGT and Bilirubin Yellow colour of serum samples Spleen weight increased yellow colour of fat tissue in all groups Significant effect of vehicle
38 Toxicity TwoweeksGLP toxicitystudy dogs 60 min i.v. infusion every third day Vehicle (lipid concentration comparable to high dose), saline, 3, 10 and 20 mg/kg Changes in hematology comparable haemolytic effect seen in all groups Biochemistry parameter Elevated ALT, AST, ALP, Bilirubin, GGT and cholesterol level in all groups Increase in spleen and liver weight in all groups no liver necrosis Bile duct hyperplasia in mid and low dose NOEAL: 3 mg/kg, MTD: 20 mg/kg
39 Toxicity TwoweeksGLP toxicitystudy dogs ALT AST GGT ALP CHOL LDH Control 1 2 Vehicle Formulation 3 3 mg/kg VL mg/kg VL mg/kg VL-01 M F M F M F M F M F [U/l] x-fold of control [U/l] % of control [U/l] x-fold of control [U/l] x-fold of control [mmol/l] % of control [U/l] % of control Significant influence of vehicle
40 Toxicity TwoweeksGLP toxicitystudy dogs Adverse effects observed in the vehicle formulation treated groups included considerably increased liver enzye levels (ALT, AST, GGT, ALP, LDH, bilirubin and cholesterol) changes in hematology (decreased RBC, HGB, MCHC levels and increased MCV and RET count) and blood coagulation (decreased APTT) parameters.
41 Lessons learned The following studies were not performed, but seemed to be meaningful for better evaluation of the presented data Organ distribution and PK study liposomal versus non-liposomal formulation Non-liposomal formulation included in toxicity studies In vitro release of the API from liposomes Determination of encapsulated versus nonencapsulated API in vivo In vivo integrity test In vitro assay showed very fast disintegration at low plasma concentration, but no disintegration at high plasma concentration
42 Clinical trial application Feed back from authorities and ethic committée No comments or questions with regard to CMC part Mean issue: therapeutic window too small NOEAL in the most sensitive species was below the dose required to get a significant PD effect
43 Controversial discussion Clinical trial application Are liposomes liver toxic? Does the liposomal formulation contributes to the observed liver toxicity due to liver targeting? Are the toxic effects of the vehicle relevant for the clinical situation or species specific?
44 Dr. Julia Eva Diederichs Pharmaceutical Drug Development Consulting Ehrengutstrasse München Telefon +49 (89) Mobil +49 (179) diederichs-pharma-consult.scherkl.com design by scherkl.com copyright 2012 Dr. Julia Eva Diederichs
>>> Oral Formulation Optimization. Introduction. A Tiered Approach for Identifying Enabling Formulations
Application Note #28-DMPK-3 >>> Oral Formulation Optimization Introduction Among the criteria required of compounds advancing from drug discovery programs, adequate systemic exposure (plasma concentrations
More informationPreclinical Requirements for Therapeutic Studies in Humans with Advanced Cancer
Preclinical Requirements for Therapeutic Studies in Humans with Advanced Cancer Scott Laurie MD, FRCPC The Ottawa Hospital Cancer Centre Associate Professor, University of Ottawa Disclosures I have no
More informationSAFETY ASPECTS OF MIDAZOLAM
Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg
More informationIOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies
IOM Workshop on Comparative Oncology Pharmacokinetics in Companion Animal Cancer Studies Daniel L. Gustafson, Ph.D. Professor Shipley University Chair in Comparative Oncology Director of Basic Research,
More informationPublic Assessment Report Scientific discussion. Kombilipid 200mg/ml, emulsion for infusion SE/H/557/01
Public Assessment Report Scientific discussion Kombilipid 200mg/ml, emulsion for infusion Fish oil, rich in omega-3-acids, Olive oil, refined, Soya-bean oil, refined and Triglycerides, medium-chain SE/H/557/01
More informationDMPK. APRIL 27 TH 2017 Jan Neelissen Scientific Adviser Science & Technology
DMPK APRIL 27 TH 2017 Jan Neelissen Scientific Adviser Science & Technology What I learned is a good DMPK profile have acceptable water solubility for development be completely absorbed, preferably via
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationThe Opportunity: c-ibs and pain relief with confidence YKP10811
The Opportunity: c-ibs and pain relief with confidence YKP10811 1 TABLE OF CONTENTS Profile Summary Clinical Data Mode of Action Pharmacologic Profile Safety and Toxicity Profile ADME Overview vs. Competitors
More informationSafety Study of ATN-249, A New Oral Kallikrein Inhibitor for Hereditary Angioedema
Safety Study of ATN-249, A New Oral Kallikrein Inhibitor for Hereditary Angioedema IRA KALFUS, MD Attune Pharmaceuticals, LLC New York City, NY Andrew McDonald, PhD; Shawn Qian, PhD Attune Pharmaceuticals,
More informationAug 28 th, 2017 Pierre Daublain
Analyzing the Potential Root Causes of Variability of Pharmacokinetics in Preclinical Species to Inform Derisking Strategies in Discovery and Early Development Aug 28 th, 2017 Pierre Daublain Outline Problem
More informationIs a Maximal Tolerated Dose in Human useful for drug development?
Is a Maximal Tolerated Dose in Human useful for drug development? How to define an acceptable highest dose to be tested? EuFeMED, London Pre-conference Workshop 17-May-2017 Eric Legangneux Philippe Grosjean
More informationAsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning
More informationFor the use of only Oncologist or a Cancer Hospital or a laboratory Doxorubicin Hydrochloride Liposome Injection 2 mg/ml KEMODOXA
For the use of only Oncologist or a Cancer Hospital or a laboratory Doxorubicin Hydrochloride Liposome Injection 2 mg/ml KEMODOXA COMPOSITION Each ml contains: Doxorubicin Hydrochloride IP...2 mg Water
More informationFDA Expectations and Evaluation of Inhalation Toxicology Studies
FDA Expectations and Evaluation of Inhalation Toxicology Studies Presented by Timothy McGovern, Ph.D. SciLucent, LLC Herndon, Virginia Development of inhalation products has unique regulatory aspects My
More informationPharmacokinetic and absolute bioavailability studies in early clinical development using microdose and microtracer approaches.
Pharmacokinetic and absolute bioavailability studies in early clinical development using microdose and microtracer approaches. Lloyd Stevens PhD Senior Research Fellow Pharmaceutical Profiles Nottingham,
More informationNonclinical Safety Evaluation of Inhalation Drug Products
Nonclinical Safety Evaluation of Inhalation Drug Products February 13, 2002 Life Science Research Organization Bethesda, Maryland Luqi Pei, Ph.D. Division of Pulmonary and Allergy Drug Products Center
More informationMipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
More informationPublic Assessment Report Scientific discussion. Ibuprofen 400 mg/100 ml solution for infusion & Ibuprofen 600 mg/100 ml solution for infusion
Public Assessment Report Scientific discussion Ibuprofen 400 mg/100 ml solution for infusion & Ibuprofen 600 mg/100 ml solution for infusion Ibuprofen arginine ES/H/0390/001/DC ES/H/0392/001/DC Applicant:
More informationIPAC-RS/UF Orlando Inhalation Conference March 20, S.T. Horhota 1, C.B. Verkleij 2, P.J.G. Cornelissen 2, L. Bour 3, A. Sharma 3, M.
IPAC-RS/UF Orlando Inhalation Conference March 20, 2014 Case Study: Pharmacokinetics and Pharmacodynamics of Tiotropium and Salmeterol Following Parallel Administration in COPD Patients Using Different
More informationConflict of Interest Statement
Specific Aspects and Approaches for Regulatory Evaluation of Pharmaceuticals in Two-Year Rodent Carcinogenicity Studies James A. Popp Stratoxon LLC Morgantown, PA Tel: 610.286.7592 popp@stratoxon.com Conflict
More informationMODULE PHARMACOKINETICS WRITTEN SUMMARY
MODULE 2.6.4. PHARMACOKINETICS WRITTEN SUMMARY m2.6.4. Pharmacokinetics Written Summary TABLE OF CONTENTS PAGE 1. BRIEF SUMMARY...7 1.1. Test Substance...7 2. METHODS OF ANALYSIS...10 3. ABSORPTION...11
More informationPublic Assessment Report. Scientific discussion. Tetraspan 60 mg/ml Tetraspan 100 mg/ml SE/H/609/01-02/MR
Public Assessment Report Scientific discussion Tetraspan 60 mg/ml Tetraspan 100 mg/ml (Hydroxyethyl starch 130/0.4, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, sodium acetate,
More informationDetermination of bioavailability
Pharmaceutics 2 Bioavailability Bioavailability is the rate and extent to which an administered drug reaches the systemic circulation. For example, if 100 mg of a drug is administered orally and 70 mg
More informationThe Comet Assay Tails of the (Un)expected
The Comet Assay Tails of the (Un)expected Use of the in vivo comet assay in pharmaceutical development Bas-jan van der Leede Janssen R&D Johnson & Johnson Pharmaceutical Companies Discovery Sciences Genetic
More information7. SUMMARY, CONCLUSION AND RECOMMENDATIONS
211 7. SUMMARY, CONCLUSION AND RECOMMENDATIONS Drug absorption from the gastro intestinal tract can be limited by various factors with the most common one being poor aqueous solubility and poor permeability
More informationPK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical
PK and PD Properties of Antisense ligonucleotides: Bridging Nonclinical to Clinical Rosie Z. Yu, Ph.D. Pharmacokinetics & Clinical Pharmacology Isis Pharmaceuticals, Inc. Carlsbad, CA USA 2 Antisense Mechanism
More informationCOMMITTEE FOR VETERINARY MEDICINAL PRODUCTS
The European Agency for the Evaluation of Medicinal Products Veterinary Medicines Evaluation Unit EMEA/MRL/488/98-FINAL July 1998 COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS DIETHYLENE GLYCOL MONOETHYL
More informationPharmacokinetic Modeling & Simulation in Discovery and non-clinical Development
Pharmacokinetic Modeling & Simulation in Discovery and non-clinical Development Where do we stand? Disclaimer I am not a bioinformatician, mathematician or biomedical engineer. I am a simple minded pharmacist,
More informationBiopharmaceutics Dosage form factors influencing bioavailability Lec:5
Biopharmaceutics Dosage form factors influencing bioavailability Lec:5 Ali Y Ali BSc Pharmacy MSc Industrial Pharmaceutical Sciences Dept. of Pharmaceutics School of Pharmacy University of Sulaimani 09/01/2019
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationChapter 3. Need for Present Study
Need for Present Study Chapter 3 Chemotherapy, the use of cytotoxic drugs to kill cancerous cells remains the most common approach for cancer therapy. In conventional chemotherapy most of the anticancer
More informationSummary Chapter 8 CHAPTER 8. Summary. Page 173
CHAPTER 8 Summary Page 173 Chapter 2: Liquid Chromatography/Tandem Mass Spectrometry Method for Quantitative Estimation of PEG 400 and its Applications A rapid sensitive and selective MRM based method
More informationPublic Assessment Report Scientific discussion. Orest Easyhaler (budesonide, formoterol fumarate dihydrate) SE/H/1214/02-03/DC
Public Assessment Report Scientific discussion Orest Easyhaler (budesonide, formoterol fumarate dihydrate) SE/H/1214/02-03/DC This module reflects the scientific discussion for the approval of Orest Easyhaler.
More informationICH Topic S1C(R2) Dose Selection for Carcinogenicity Studies of Pharmaceuticals. Step 5
European Medicines Agency October 2008 EMEA/CHMP/ICH/383/1995 ICH Topic S1C(R2) Dose Selection for Carcinogenicity Studies of Pharmaceuticals Step 5 NOTE FOR GUIDANCE ON DOSE SELECTION FOR CARCINOGENICITY
More informationPublic Assessment Report Scientific discussion. Eezeneo (Diclofenac potassium) Asp. no:
Public Assessment Report Scientific discussion Eezeneo (Diclofenac potassium) Asp. no: 2005-0629 - 2005-0630 This module reflects the scientific discussion for the approval of Eezeneo. The procedure was
More informationSupplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
More informationPublic Assessment Report. Scientific discussion. Celecoxib Apotex 100 mg and 200 mg, capsules, hard (celecoxib) NL/H/2760/ /DC
Public Assessment Report Scientific discussion Celecoxib Apotex 100 mg and 200 mg, capsules, hard (celecoxib) NL/H/2760/001-002/DC Date: 29 April 2014 This module reflects the scientific discussion for
More informationStep-by-step instructions for intravenous (iv) infusions for patients with:
Step-by-step instructions for intravenous (iv) infusions for patients with: Rheumatoid Arthritis (RA) Systemic Juvenile Idiopathic Arthritis (sjia) Polyarticular Juvenile Idiopathic Arthritis (pjia) Please
More informationPublic Assessment Report. Mebeverine hydrochloride 50mg/5ml Oral Suspension. (Mebeverine hydrochloride) UK Licence No: PL 44710/0024
Public Assessment Report Mebeverine hydrochloride 50mg/5ml Oral Suspension (Mebeverine hydrochloride) UK Licence No: PL 44710/0024 Kinedexe UK Limited 1 LAY SUMMARY Mebeverine hydrochloride 50mg/5ml Oral
More informationDOSE SELECTION FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS *)
DOSE SELECTION FOR CARCINOGENICITY STUDIES OF PHARMACEUTICALS *) Guideline Title Dose Selection for Carcinogenicity Studies of Pharmaceuticals *) Legislative basis Directive 75/318/EEC as amended Date
More informationPUBLIC ASSESSMENT REPORT Scientific Discussion
Direction de l Evaluation des Médicaments et des Produits Biologiques PUBLIC ASSESSMENT REPORT Scientific Discussion Tramadol hydrochloride + paracetamol 37.5 mg-325 mg Grünenthal film coated tablets Bonoc
More informationSMe. Me NITROIMIDAZOLES FOR VISCERAL LEISHMANIASIS FEXINIDAZOLE AND VL-2098 SHYAM SUNDAR
SMe O 2 CH 2 O Me ITROIMIDAZOLES FOR VISCERAL LEISHMAIASIS FEXIIDAZOLE AD VL-2098 SHYAM SUDAR Target Product Profile for a CE Optimal Target Profile Target Label VL and PKDL VL Spp All species L. donavani
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSCIENTIFIC DISCUSSION. Efavirenz
SCIENTIFIC DISCUSSION Name of the Finished Pharmaceutical Product: Manufacturer of Prequalified Product: Active Pharmaceutical Ingredient (API): Pharmaco-therapeutic group (ATC Code): Therapeutic indication:
More informationAdaptive and Innovative Study Designs to Accelerate Drug Development from First-In-Human to First-In-Patient
Adaptive and Innovative Study Designs to Accelerate Drug Development from First-In-Human to First-In-Patient Michelle L. Combs, PhD Vice President, Clinical Pharmacology Sciences New Drug And Biologics
More informationPractical approaches for endocrine toxicity in preclinical safety assessment
Practical approaches for endocrine toxicity in preclinical safety assessment Akira Inomata, D.V.M., Ph.D., D.J.S.T.P. Tsukuba Drug Safety, Global Drug Safety, Biopharmaceutical Assessments Core Function
More informationSCIENTIFIC DISCUSSION. Lopinavir and Ritonavir 200 mg/50 mg Tablets * Name of the Finished Pharmaceutical Product:
SCIENTIFIC DISCUSSION Name of the Finished Pharmaceutical Product: Manufacturer of Prequalified Product: Active Pharmaceutical Ingredients (APIs): Pharmaco-therapeutic group (ATC Code): Therapeutic indication:
More informationPublic Assessment Report Scientific discussion. Anastrozole Bluefish 1 mg film-coated tablets (anastrozole) SE/H/781/01/DC
Public Assessment Report Scientific discussion Anastrozole Bluefish 1 mg film-coated tablets (anastrozole) SE/H/781/01/DC This module reflects the scientific discussion for the approval of Anastrozole
More informationCiprofloxacin Bluefish (Ciprofloxacin hydrochloride)
Public Assessment Report Scientific discussion Ciprofloxacin Bluefish (Ciprofloxacin hydrochloride) Asp. no: 2006-1626 - 1628 This module reflects the scientific discussion for the approval of Ciprofloxacin
More informationYear in review. Vit Perlik Director of Regulatory Science and Clinical Development
Year in review Vit Perlik Director of Regulatory Science and Clinical Development Content Year in review Covering September 2013 to September 2014 Where the regulation goes selection of events for illustration
More informationClinical Study Synopsis for Public Disclosure
abcd Clinical Study for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of the clinical
More informationPreclinical Experience with rhasm for Niemann-Pick Disease
Preclinical Experience with rhasm for Niemann-Pick Disease Gerry Cox, MD, PhD Vice President, Clinical Development September 16, 2014 Shani Niemann-Pick disease Type B UK www.genzyme.com Acid Sphingomyelinase
More informationPublic Assessment Report Scientific discussion. Nicorette Pepparmint (nicotine) SE/H/904/01/DC
Public Assessment Report Scientific discussion Nicorette Pepparmint (nicotine) SE/H/904/01/DC This module reflects the scientific discussion for the approval of Nicorette Pepparmint. The procedure was
More informationFDB FOOD AND DRUGS BOARD G H A N A GUIDELINES FOR CONDUCTING BIOEQUIVALENCE STUDIES
FDB FOOD AND DRUGS BOARD G H A N A GUIDELINES FOR CONDUCTING BIOEQUIVALENCE STUDIES 1 SCOPE In pursuance of section 47 of the Food and Drugs Law 1992, P.N.D.C.L 305B, as amended by Act 523, 1996, these
More informationThis clinical study synopsis is provided in line with Boehringer Ingelheim s Policy on Transparency and Publication of Clinical Study Data.
abcd Clinical Study for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis which is part of the clinical
More informationVarun Goel 1, Nathalie H Gosselin 2, Claudia Jomphe 2, Husain Attarwala 1, Xiaoping (Amy) Zhang 1, JF Marier 2, Gabriel Robbie 1
Population Pharmacokinetic (PK) / Pharmacodynamic (PD) Model of Serum Transthyretin (TTR) Following Patisiran Administration in Healthy Volunteers and Patients with Hereditary TTR-Mediated (hattr) Amyloidosis
More informationSection 5.2: Pharmacokinetic properties
Section 5.2: Pharmacokinetic properties SmPC training presentation Note: for full information refer to the European Commission s Guideline on summary of product characteristics (SmPC) SmPC Advisory Group
More informationLiposome Drug Products Chemistry, Manufacturing, and Controls; Human Pharmacokinetics and Bioavailability; and Labeling Documentation
Liposome Drug Products Chemistry, Manufacturing, and Controls; Human Pharmacokinetics and Bioavailability; and Labeling Documentation Guidance for Industry U.S. Department of Health and Human Services
More informationOral Formulations for Poorly Water Soluble Compounds. SAQ - Fachgruppe Pharma & Chemie Oskar Kalb, Novartis Pharma AG Basel Olten, 23.
Oral Formulations for Poorly Water Soluble Compounds SAQ - Fachgruppe Pharma & Chemie Oskar Kalb, Novartis Pharma AG Basel Olten, 23. June 2009 Oral Delivery of Poorly Water Soluble Compounds For systemic
More informationViera Lukacova Director, Simulation Sciences
Use of In Silico Mechanistic Models to Support Interspecies Extrapolation of Oral Bioavailability and Formulation Optimization: Model Example Using GastroPlus Viera Lukacova Director, Simulation Sciences
More informationSCIENTIFIC DISCUSSION. Darunavir
This part reflects the scientific knowledge and the information about this product available at the time of prequalification. Thereafter, updates may have become necessary which are included in parts 1
More informationGuideline for the Development of Liposome Drug Products
参考 ( ガイドライン英訳 ) Guideline for the Development of Liposome Drug Products (March 2016, MHLW, Japan) Table of Contents 1. Introduction... 3 2. Scope... 3 3. Chemistry, manufacturing, and controls... 4 3.1
More informationSCIENTIFIC DISCUSSION
SCIENTIFIC DISCUSSION 1 Introduction This is an application for a CHMP Scientific Opinion in accordance with Article 58 of Regulation (EC) No 726/2004, in the context of cooperation with the World Health
More informationDevelopment of Canagliflozin: Mechanistic Absorption Modeling During Late-Stage Formulation and Process Optimization
Development of Canagliflozin: Mechanistic Absorption Modeling During Late-Stage Formulation and Process Optimization Nico Holmstock Scientist, Janssen R&D M CERSI 2017, BALTIMORE (USA) Canagliflozin An
More informationModeling & Simulation to support evaluation of Safety and Efficacy of Drugs in Older Patients
Modeling & Simulation to support evaluation of Safety and Efficacy of Drugs in Older Patients Eva Bredberg, Director Global Clinical Pharmacology, AstraZeneca On behalf of EFPIA EMA Geriatrics Workshop
More informationBASIC PHARMACOKINETICS
BASIC PHARMACOKINETICS MOHSEN A. HEDAYA CRC Press Taylor & Francis Croup Boca Raton London New York CRC Press is an imprint of the Taylor & Francis Group, an informa business Table of Contents Chapter
More informationICH Topic M 4 S Common Technical Document for the Registration of Pharmaceuticals for Human Use - Safety. Step 5
European Medicines Agency July 23 CPMP/ICH/2887/99 Safety ICH Topic M 4 S Common Technical Document for the Registration of Pharmaceuticals for Human Use Safety Step 5 COMMON TECHNICAL DOCUMENT FOR THE
More informationPublic Assessment Report Scientific discussion. Salmeterol/Fluticasone Sandoz (salmeterol xinafoate, fluticasone propionate) SE/H/1323/03/DC
Public Assessment Report Scientific discussion Salmeterol/Fluticasone Sandoz (salmeterol xinafoate, fluticasone propionate) SE/H/1323/03/DC This module reflects the scientific discussion for the approval
More informationPublic Assessment Report Scientific discussion. Ciprofloxacin Accord (ciprofloxacin hydrochloride) SE/H/1026/01-03/DC
Public Assessment Report Scientific discussion Ciprofloxacin Accord (ciprofloxacin hydrochloride) SE/H/1026/01-03/DC This module reflects the scientific discussion for the approval of Ciprofloxacin Accord.
More informationNCCP Chemotherapy Regimen
Dose Dense DOXOrubicin, Cyclophosphamide (AC 60/600) 14 day followed by PACLitaxel (175) 14 day and Trastuzumab Therapy (DD AC-TH) Note: There is an option for Dose Dense DOXOrubicin, cyclophosphamide
More informationEMA/EGA. Session 1: orally administered Modified Release Products European Regulatory Requirements London 30 April 2015 Dr.
EMA/EGA Session 1: orally administered Modified Release Products European Regulatory Requirements London 30 April 2015 Dr. Henrike Potthast Disclaimer The presentation reflects the personal opinion of
More informationBasic Biopharmaceutics, Pharmacokinetics, and Pharmacodynamics
Basic Biopharmaceutics, Pharmacokinetics, and Pharmacodynamics Learning Outcomes Define biopharmaceutics Describe 4 processes of pharmacokinetics Describe factors that affect medication absorption Describe
More informationPublic Assessment Report. Scientific discussion. Thyrofix 25, 50, 75 and 100 micrograms tablets. (levothyroxine sodium) NL/H/3039/ /DC
Public Assessment Report Scientific discussion Thyrofix 25, 50, 75 and 100 micrograms tablets (levothyroxine sodium) NL/H/3039/001-004/DC Date: 19 February 2015 This module reflects the scientific discussion
More informationAbsolute bioavailability and pharmacokinetic studies in early clinical development using microdose and microtracer approaches.
Absolute bioavailability and pharmacokinetic studies in early clinical development using microdose and microtracer approaches. Dr Lloyd Stevens Senior Research Fellow Pharmaceutical Profiles Nottingham,
More informationPK/PD analysis in assessment of abuse deterrence
PK/PD analysis in assessment of abuse deterrence Megan J. Shram, PhD Director and Principal, Altreos Research Partners Inc. Adjunct Professor and Lecturer, Department of Pharmacology, University of Toronto
More informationBENZETHONIUM CHLORIDE
OPINION OF THE SCIENTIFIC COMMITTEE ON COSMETIC PRODUCTS AND NON-FOOD PRODUCTS INTENDED FOR CONSUMERS CONCERNING BENZETHONIUM CHLORIDE COLIPA n P 70 adopted by the SCCNFP during the 26 th plenary meeting
More informationDecentralised Procedure. Public Assessment Report. Lorazepam-neuraxpharm 1/ 2,5 mg Schmelztabletten. Lorazepam DE/H/4558/ /DC
Decentralised Procedure Public Assessment Report Lorazepam-neuraxpharm 1/ 2,5 mg Schmelztabletten Lorazepam DE/H/4558/001-002/DC Applicant: neuraxpharm Arzneimittel GmbH, Germany Reference Member State
More informationSponsor: Sanofi Drug substance(s): GZ316455
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor: Sanofi Drug substance(s):
More informationProduct: Omecamtiv Mecarbil Clinical Study Report: Date: 02 April 2014 Page 1
Date: 02 April 2014 Page 1. 2. SYNOPSIS Name of Sponsor: Amgen Inc. Name of Finished Product: Omecamtiv mecarbil injection Name of Active Ingredient: Omecamtiv mecarbil (AMG 423) Title of Study: A double-blind,
More informationPublic Assessment Report. Scientific discussion. Metoprololsuccinat Actavis. Prolonged release tablets 25 mg, 50 mg, 100 mg and 200 mg
Public Assessment Report Scientific discussion Metoprololsuccinat Actavis Prolonged release tablets 25 mg, 50 mg, 100 mg and 200 mg Metoprolol succinate This module reflects the scientific discussion for
More informationIndividual Study Table Referring to Part of the Dossier. Volume:
Final Report M/100977/21Final Version () 2. SYNOPSIS A Title of Study: A PHASE IIa, RANDOMISED, DOUBLE-BLIND, MULTIPLE DOSE, PLACEBO CONTROLLED, 3 PERIOD CROSS-OVER, ASCENDING DOSE CLINICAL TRIAL TO ASSESS
More informationClinical Study Synopsis for Public Disclosure
abcd Clinical Study Synopsis for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of
More informationTranslatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal
Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related
More informationAgents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology
Agents that inhibit the BSEP and mitochondrial function what do we know? Prepared by Michael D. Aleo, Ph.D. Groton, Investigative Toxicology Declarations Nonclinical studies All procedures performed on
More informationDrug Delivery to the CNS: Barriers that May Influence Efficacy in Treating Tuberculosis in the Brain
Drug Delivery to the CNS: Barriers that May Influence Efficacy in Treating Tuberculosis in the Brain TB-Meningitis Blood Brain Barrier astrocyte endfeet TB-Meningitis Rockville MD 22-23 May 2017 tight
More informationNOTE FOR GUIDANCE ON TOXICOKINETICS: THE ASSESSMENT OF SYSTEMIC EXPOSURE IN TOXICITY STUDIES S3A
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE NOTE FOR GUIDANCE ON TOXICOKINETICS: THE ASSESSMENT
More informationENMD-2076, an Oral Aurora A and Angiogenesis Kinase Inhibitor
ENMD-2076, an Oral Aurora A and Angiogenesis Kinase Inhibitor Dr. Mark R. Bray VP Research, EntreMed, Inc. AACR Annual Meeting New Drugs on the Horizon 2 April 2008 1 Disclosure Information: AACR New Drugs
More informationPublic Assessment Report. Scientific discussion. Tadalafil 1A Pharma 2.5 mg, 5 mg, 10 mg and 20 mg, film-coated tablets.
Public Assessment Report Scientific discussion Tadalafil 1A Pharma 2.5 mg, 5 mg, 10 mg and 20 mg, film-coated tablets (tadalafil) NL/H/3634/001-004/DC Date: 24 May 2017 This module reflects the scientific
More informationSponsor / Company: Sanofi Drug substance: SAR236553/REGN727 (alirocumab)
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance:
More informationMutual Recognition Procedure. Public Assessment Report. Valproat Orion 300 / 500 mg Retardtabletten. Sodium valproate DE/H/1910/ /MR
Mutual Recognition Procedure Public Assessment Report Valproat Orion 300 / 500 mg Retardtabletten Sodium valproate DE/H/1910/001-002/MR (former FI/H/0608/001-002/MR) Applicant: Orion Corporation Date:
More informationSynopsis (C1034T02) CNTO 95 Module 5.3 Clinical Study Report C1034T02
Module 5.3 Protocol: EudraCT No.: 2004-002130-18 Title of the study: A Phase 1/2, Multi-Center, Blinded, Randomized, Controlled Study of the Safety and Efficacy of the Human Monoclonal Antibody to Human
More informationAAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao
Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference
More informationNanomedicine & Drug Delivery Systems Group Research Institute for Medicines and Pharmaceutical Sciences (imed.ul)
Faculty of Pharmacy of the University of Lisbon Nanomedicine & Drug Delivery Systems Group Research Institute for Medicines and Pharmaceutical Sciences (imed.ul) Leishmania in southern Europe. (Duiardin,
More informationPublic Assessment Report. Scientific discussion. Pentasa Compact 4 g, prolonged-release granules. (mesalazine) NL License RVG:
Public Assessment Report Scientific discussion Pentasa Compact 4 g, prolonged-release granules (mesalazine) NL License RVG: 114015 Date: 30 March 2015 This module reflects the scientific discussion for
More informationThe clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only.
The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only. Please note that the results reported in any single trial may not reflect the overall
More informationClinical Study Synopsis for Public Disclosure
abcd Clinical Study Synopsis for Public Disclosure This clinical study synopsis is provided in line with s Policy on Transparency and Publication of Clinical Study Data. The synopsis - which is part of
More informationPHARMACEUTICS I صيدالنيات 1 UNIT 1 INTRODUCTION
PHARMACEUTICS I صيدالنيات 1 UNIT 1 INTRODUCTION 1 PHARMACEUTICS Pharmaceutics is the science of dosage form design. The general area of study concerned with the formulation, manufacture, stability, and
More informationDrug discovery and development for the treatment and control of filariasis: repurposing emodepside
Drug discovery and development for the treatment and control of filariasis: repurposing emodepside IMMIP, Bonn Sabine Specht, Achim Hoerauf DNDi Robert Don Ivan Scandale NPIMR, Northwick Park Simon Townson
More informationCoping with Analytical Interferences
Coping with Analytical Interferences (Handling Icteric, Hemolytic and Lipaemic Samples) Graham Jones Department of Chemical Pathology St Vincent s Hospital, Sydney Surabaya Indonesia 2016 Acknowledgements
More information