Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.
|
|
|
- Hubert Reeves
- 5 years ago
- Views:
Transcription
1 Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1
2 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured from bone marrow mononuclear cells, contains a M2-like population of macrophages Alternatively activated macrophages (M2 macrophages) promote the resolution of inflammation by secreting antiinflammatory cytokines and removing tissue debris. Therefore, delivering increased numbers of this macrophage population to ischemic tissues may limit tissue injury and promote repair. The purpose of this study was to investigate a novel population of alternatively activated, M2 macrophages, a major component of ixmyelocel-t therapy, which are potentially beneficial in the treatment of atherosclerotic diseases.
3 Atherosclerosis is a multi-factorial disease of the vessel wall Libby P. Nature 42, (19 December 22) Atherosclerosis is complex disease involving several different factors including: Chronic Inflammation Cellular Death Lipid Accumulation An ideal therapy should address all components of this multifactorial disease in order to really be efficacious 3
4 Atherosclerosis- Role of the Macrophage Macrophages are a key cell type involved in atherosclerosis-lipid accumulation, inflammation, efferocytosis Efferocytosis- In early atherosclerotic lesions- macrophages remove dying foam cells, decreased plaque progression. In advanced lesions, macrophages do not function properly leading to necrosis, lipid accumulation, and a pro-inflammatory state Maintaining Cholesterol Homeostasis- Accumulation of lipid loaded macrophage foam cells is a central feature in the formation of atherosclerosis. Maintaining macrophage cholesterol homeostasis (uptake vs. efflux) is essential in preventing the pathogenesis of atherosclerosis An imbalance between cholesterol uptake by scavenger receptors and efflux in macrophages is widely recognized as an underlying mechanism progression atherosclerosis In disease states where alternatively activated macrophages promote tissue repair or limit injury it might be beneficial to enhance their activity. Thorp E, Tabas I. J Leukoc Biol. 29 Nov;86(5): Ixmyelocel-T Macrophages
5 Cytokine Secretion (pg/ml) Ixmyelocel-T Macrophages Secretes Anti- Inflammatory Cytokines IL-1 IL-1ra TNFα IL-1β IL-12 Basal +LPS IL-1, IL-r1a, TNFα, IL-1β, and IL-12 were quantified in MACS sorted CD14+ sorted ixmyelocel-t supernatants treated with and without LPS (n > 3). Ixmyelocel-T macrophages secrete elevated levels of anti-inflammatory cytokines, before and after LPS stimulation, while pro-inflammatory cytokine secretion remains minimal. P <.5 vs. basal, P <.1 vs. basal 5
6 Ixmyelocel-T Macrophages Express Surface Receptors of Alternative Activation and Scavenger Receptors Involved in Lipid and Apoptotic Cell Uptake Flow cytometry revealed that ixmyelocel-t macrophages express surface receptors of alternative activation, CD26 and CD163, and scavenger receptors involved in lipid and apoptotic cell uptake: CD36, LDLR, CD91, MSR1, and MerTK.
7 Cell Percentage (%) Efferocytosis: Ixmyelocel-T alternatively activated macrophages readily phagocytize apoptotic cells ixmyelocel-t Apoptotic Cells ixmyelocel-t + Apoptotic Cells Enlarged CD14 CD14 + Apoptotic Cells ixmyelocel-t PKH26 Apoptotic Cells ixmyelocel-t + PKH26 Apoptotic Cells Efferocytosis was measured by microscopy and flow cytometry. 6% of ixmyelocel-t CD14+ cells efferocytosed apoptotic cells (n > 5). P <.1 vs. CD14. Magnification: 6X
8 SCARB1 (Fold Change) CD36 (Fold Change) Ixmyelocel-T Macrophages as less likely to become overladen with modified lipids- Reduced Scavenger Receptor Expression THP-1 IXT Ac-LDL +Ac-LDL.2 THP-1 IXT Fluorescent microscopy images of ixmyelocel-t and THP-1 macrophages loaded with Dil-Ac-LDL. Magnification: 4X Quantitative real-time PCR gene expression analysis of scavenger receptors normalized to GAPDH, the relative control (n > 5). Expression of (A) CD36 and (B) SCARB1 in THP-1 and ixmyelocel-t macrophages before and after lipid loading. Values are presented as mean ± SEM relative to control, p <.1 vs. THP-1 Ac-LDL, p <.1 vs. THP-1 Ac-LDL. 1.5 THP-1 IXT -Ac-LDL +Ac-LDL
9 Apoptosis (Relative to Control) Ixmyelocel-T is not sensitive to modified cholesterol-induced lipotoxicity AcLDL +AcLDL 4 2 THP-1 IXT To determine if lipid loading resulted in apoptosis, both ixmyelocel-t and THP-1 macrophages were loaded with 1 μg/ml Ac-LDL for 24 hours. Apoptosis was then analyzed using a luminometric caspase 3/7 assay, which examines activation of caspases-3 and -7. THP-1 macrophages exhibited a statistically significant higher level of Ac-LDL induced apoptosis than ixmyelocel-t. Values are presented as mean ± SEM, p <.1 vs. THP -Ac LDL.
10 Ixmyelocel-T Macrophages Display Enhanced Cholesterol Efflux Capacity- Cholesterol Transport Genes Quantitative real-time PCR gene expression analysis of scavenger receptors normalized to GAPDH, the relative control (n > 5). Expression of ABCA1, ABCG1, ACAT1, and CEH in THP-1 and ixmyelocel-t macrophages before and after lipid loading. Values are presented as mean ± SEM relative to control, p <.5, p <.1, p <.1 vs. THP-1 Ac-LDL; #p <.5, ##p <.1 vs. IXT Ac-LDL.
11 Cholesterol Efflux (%) Ixmyelocel-T Displays Enhanced Cholesterol Efflux Capacity ApoA-I HDL3 THP-1 ixmyelocel-t The ability of ixmyelocel-t to efflux cholesterol was measured with an in vitro cholesterol efflux assay. Ixmyelocel-T and THP-1 cells were loaded with free cholesterol using radiolabeled acetylated LDL ( 3 H- cholesterol-acldl). Ixmyelocel-T demonstrated a robust increase in ABCA1-mediated cholesterol efllux, as seen by the increase in efflux to apoa-i. (n=4) p <.1, p<.1 vs. THP-1
12 RCT to Liver (% injected cpm) RCT to Feces (% injected cpm) RCt to Serum (% injected cpm) Ixmyelocel-T Effluxes Cholesterol In Vivo (Reverse Cholesterol Transport Assay) J IXT Time (hrs) J774 IXT 5 J774 IXT Reverse cholesterol transport comprises all the different steps in cholesterol metabolism between cholesterol efflux from macrophage foam cells and the final excretion of cholesterol into the feces either as neutral sterols or after metabolic conversion into bile acids. In vivo cholesterol efflux was examined in scid mice after intraperitoneal injections of either 3 H-cholesterol-loaded J774 cells of ixmyelocel-t. Plasma 3 H-cholesterol levels after 24 and 48 hours, 3 H-tracer found in the liver, and 3 H-tracer found in the feces after 48 hours (n > 3 per group). Values are presented as mean ± SEM relative to control, p <.5 vs. J774
13 Collectively this data suggests ixmyelocel-t therapy might be beneficial for the treatment of atherosclerotic diseases Immunomodulation: Anti-inflammatory cytokine secretion Tissue Remodeling/Phagocytosis of necrotic tissue Modified Cholesterol Uptake/Efflux: Enhanced cholesterol uptake could protect the vasculature by removing atherogenic lipoproteins which elicit strong pro-inflammatory responses. Cholesterol efflux would allow cholesterol to be disposed of preventing more inflammation, as well as cell death Libby P. Nature 42, (19 December 22) These potential MOA of ixmyelocel-t would address several of the components of this multifactorial disease, potentially making ixmyelocel-t not only an ideal therapy but an efficacious one.
Stem Cell Research & Therapy 2013, 4:135
Stem Cell Research & Therapy This Provisional PDF corresponds to the article as it appeared upon acceptance. Copyedited and fully formatted PDF and full text (HTML) versions will be made available soon.
Summary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
Atherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter?
12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 Atherosclerosis is an Inflammatory Disease: Does it Matter? Ira Tabas, M.D., Ph.D. Richard J. Stock Professor of Medicine, Cell
Basic Mechanisms of Atherosclerosis and Plaque Rupture: Clinical Implications
12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 KEYNOTE ADDRESS Basic Mechanisms of Atherosclerosis and Plaque Rupture: Clinical Implications Ira Tabas, M.D., Ph.D. Richard J.
Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
High density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington
HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Incorporating HDL interaction in an ODE model of Atherosclerosis
Incorporating HDL interaction in an ODE model of Atherosclerosis Diego Lopez Texas A&M University July 29, 2015 Diego Lopez (TAMU) July 29, 2015 1 / 10 Introduction Atherosclerosis A disease of the arteries
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
Lipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ
Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra
Supplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol
Alginic Acid Cell Entrapment: A Novel Method for Measuring In Vivo Macrophage Cholesterol Homeostasis Timothy J. Sontag 1,#, Bijoy Chellan 2, Clarissa V. Bhanvadia 1,3, Godfrey S. Getz 1, Catherine A.
About OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
Taylor Yohe. Project Advisor: Dr. Martha A. Belury. Department of Human Nutrition at the Ohio State University
Atherosclerosis Development and the Inflammatory Response of Hepatocytes to Sesame Oil Supplementation Taylor Yohe Project Advisor: Dr. Martha A. Belury Department of Human Nutrition at the Ohio State
Lipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
Alginic acid cell entrapment: a novel method for measuring in vivo macrophage cholesterol homeostasis. 1 To whom correspondence should be addressed.
methods Alginic acid cell entrapment: a novel method for measuring in vivo macrophage cholesterol homeostasis Timothy J. Sontag, 1, * Bijoy Chellan, Clarissa V. Bhanvadia, 2, * Godfrey S. Getz, * and Catherine
Atherosclerosis is the underlying cause of cardiovascular
RP5-833A20.1/miR-382-5p/NFIA Dependent Signal Transduction Pathway Contributes to the Regulation of Cholesterol Homeostasis and Inflammatory Reaction Yan-Wei Hu, Jia-Yi Zhao, Shu-Fen Li, Jin-Lan Huang,
Atherosclerosis Compendium
Atherosclerosis Compendium Circulation Research Compendium on Atherosclerosis Atherosclerosis: Successes, Surprises, and Future Challenges Epidemiology of Atherosclerosis and the Potential to Reduce the
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Arteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
Author Manuscript Faculty of Biology and Medicine Publication
Serveur Académique Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but dos not include the final publisher proof-corrections
Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins
Review Article Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins A. R. Tall From the Division of Molecular Medicine, Department
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
Pathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
Strathprints Institutional Repository
Strathprints Institutional Repository Tate, Rothwelle and Rotondo, Dino and Davidson, Jillian (2015) Regulation of lipid metabolism by micrornas. Current Opinion in Lipidology, 26 (3). pp. 243-244. ISSN
Potential mechanisms for the resolution of atherosclerosis by conjugated linoleic acid (CLA)
HRB IMDA Oct HRB 2010 IMDA Seminar 28 th Oct 2010 Potential mechanisms for the resolution of atherosclerosis by conjugated linoleic acid (CLA) Dr. Orina Belton, School of Biomolecular and Biomedical Science,
Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France
LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille,
Cholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease
Related Commentary, page 2545 Research article Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease Christian Besler, 1,2,3 Kathrin Heinrich,
Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers
CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes
Sphingosine-1-phosphate receptor-2 deficiency leads to inhibition of macrophage proinflammatory activities and atherosclerosis in apoe-deficient mice
RETRACTED View retraction Amendment history: Retraction (March 2012) Expression of concern (January 2012) Sphingosine-1-phosphate receptor-2 deficiency leads to inhibition of macrophage proinflammatory
CHAPTER Cir. Res. 2010; 107(12): e
CHAPTER 5 Enhanced foam cell formation, atherosclerotic lesion development, and inflammation by combined deletion of ABCA1 and SR-BI in bone marrow-derived cells in LDL receptor knockout mice on Western-type
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School
A real life example In human studies, we quantify ~120 plasma related proteins Monocytes MMP9 Macrophages TNFα IL1ß platelet derived growth factor IFNγ MMP1 MMP8 MMP13 Myeloid Related Protein14 CD40
Dyslipidemia Endothelial dysfunction Free radicals Immunologic
ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and
Apolipoprotein AI prevents regulatory to follicular helper T cell switching during atherosclerosis
ARTICLE DOI: 1.138/s41467-18-3493- OPEN Apolipoprotein AI prevents regulatory to follicular helper T cell switching during atherosclerosis Dalia E. Gaddis 1, Lindsey E. Padgett 1, Runpei Wu 1, Chantel
The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema
The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,
Attenuating Effect of Curcumin on Diet-induced Hypercholesterolemia in Mice
International Journal of Medical Laboratory 2017;4(4):299-306. Original Article Attenuating Effect of Curcumin on Diet-induced Hypercholesterolemia in Mice Sahar Farzaneh 1 M.Sc., Masoud Salehipour 1*
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
Thematic review series: The Immune System and Atherogenesis
thematic review Thematic review series: The Immune System and Atherogenesis Lipoprotein-associated inflammatory proteins: markers or mediators of cardiovascular disease? Alan Chait, 1 Chang Yeop Han, John
Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
The HDL hypothesis: does high-density lipoprotein protect from atherosclerosis?
The HDL hypothesis: does high-density lipoprotein protect from atherosclerosis? review Menno Vergeer, 1 Adriaan G. Holleboom, John J. P. Kastelein, and Jan Albert Kuivenhoven Department of Vascular Medicine,
Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University
Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O
SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL
SR-BI inhibits ABCG1-stimulated net cholesterol efflux from cells to plasma HDL Laurent Yvan-Charvet, 1, * Tamara A. Pagler,* Nan Wang,* Takafumi Senokuchi,* May Brundert, Hongna Li,* Franz Rinninger,
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
Pathogenesis of lupus apoptosis clearance and regulation of self tolerance. Durga Prasanna Misra
Pathogenesis of lupus apoptosis clearance and regulation of self tolerance Durga Prasanna Misra Format Apoptosis Apoptosis in SLE Decreased apoptosis of autoreactive cells Increased apoptosis Defective
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug
Curriculum Vitae Yi Fu ( 付毅 ) (PhD, MBBS) Baker IDI Heart and Diabetes Institute 75 Commercial Road, Prahran, Melbourne, VIC 3004 Australia Phone: +61 3 8532 1288 Email: yi.fu@bakeridi.edu.au PROFILE Research
Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
Integrative Physiology
Integrative Physiology Acute Psychological Stress Accelerates Reverse Cholesterol Transport via Corticosterone-Dependent Inhibition of Intestinal Cholesterol Absorption Reija Silvennoinen, Joan Carles
A Role of RIP3-Mediated Macrophage Necrosis in Atherosclerosis Development
Cell Reports Article A Role of RIP3-Mediated Macrophage Necrosis in Atherosclerosis Development Juan Lin, 1,6 Hanjie Li, 1,6 Min Yang, 2 Junming Ren, 1 Zhe Huang, 1 Felicia Han, 1 Jian Huang, 3 Jianhui
Cardiology, CardioVascular Center University Hospital Zurich Zurich, Switzerland
Modification of by the lipoxidation product malondialdehyde leads to LOX-1 dependent activation of endothelial PKCbeta-2 and adverse endothelial effects of in patients with coronary artery disease Christian
Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.
Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081
TISSUE-SPECIFIC ROLE OF ATP BINDING CASSETTE TRANSPORTER A1 IN ATHEROGENESIS. Xin Bi
TISSUE-SPECIFIC ROLE OF ATP BINDING CASSETTE TRANSPORTER A1 IN ATHEROGENESIS By Xin Bi A Dissertation Submitted to the Graduate Faculty of WAKE FOREST UNIVERSITY SCHOOL OF ARTS AND SCIENCES in Partial
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
Chapter 1 GENERAL INTRODUCTION. 1.1 Lipoproteins and Lipid Metabolism
GENERAL INTRODUCTION Contents 1.1 Lipoproteins and lipid metabolism 1.2 Atherosclerosis 1.3 HDL and atherosclerosis 1.4 ABCA-transporters 1.5 Lipid transfer proteins: CETP and PLTP 1.6 Macrophage RCT pathway:
Lipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
The progression of atherosclerosis is linked to the accumulation
Novel In Vivo Method for Measuring Cholesterol Mass Flux in Peripheral Macrophages Ginny L. Weibel, Sara Hayes, Aisha Wilson, Michael C. Phillips, Jeffrey Billheimer, Daniel J. Rader, George H. Rothblat
UvA-DARE (Digital Academic Repository) HDL cholesterol: atherosclerosis and beyond Bochem, A.E. Link to publication
UvA-DARE (Digital Academic Repository) HDL cholesterol: atherosclerosis and beyond Bochem, A.E. Link to publication Citation for published version (APA): Bochem, A. E. (201). HDL cholesterol: atherosclerosis
Ebrahim Abbasi Oshaghi 1,2
1 2 Flaxseed normalized antioxidant status and also changed ABCG5 and ABCG8 genes expression in diabetic rat Fatemeh Mirzaei 1,Mona Pourjafarr 1, Seyyed Alireza Vafaei 1, Rezvan Mostoli 1, Ebrahim Abbasi
Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease
Research article Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease Christian Besler, 1,2,3 Kathrin Heinrich, 1,2,3 Lucia Rohrer, 3,4 Carola
Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR
Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA
MinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway.
MinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway. *Randon T. Hall I, Joseph L. Witztum2, Yury I. Miller2 From the IMSTP-SURF Program and 2Division of Endocrinology and
Protective effect of the polarity of macrophages regulated by IL-37 on atherosclerosis
Protective effect of the polarity of macrophages regulated by IL-37 on atherosclerosis J. Huang 1, F.L. Hou 2, A.Y. Zhang 1 and Z.L. Li 2 1 Department of Cardiology, Weifang People s Hospital, Weifang,
Part 1 Risk Factors and Atherosclerosis. LO1. Define the Different Forms of CVD
Week 3: Cardiovascular Disease Learning Outcomes: 1. Define the difference forms of CVD 2. Describe the various risk factors of CVD 3. Describe atherosclerosis and its stages 4. Describe the role of oxidation,
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Biliary Sterol Secretion Is Required for Functional In Vivo Reverse Cholesterol Transport in Mice
GASTROENTEROLOGY 2011;140:1043 1051 Biliary Sterol Secretion Is Required for Functional In Vivo Reverse Cholesterol Transport in Mice NIELS NIJSTAD,* THOMAS GAUTIER,* FRANÇOIS BRIAND, DANIEL J. RADER,
CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia
CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH
FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response
The Role of Macrophage Lipophagy in Reverse Cholesterol Transport
Review Article Endocrinol Metab 2017;32:41-46 https://doi.org/10.3803/enm.2017.32.1.41 pissn 2093-596X eissn 2093-5978 The Role of Macrophage Lipophagy in Reverse Cholesterol Transport Se-Jin Jeong, Mi-Ni
Autophagy Regulates Cholesterol Efflux from Macrophage Foam Cells via Lysosomal Acid Lipase
Article Autophagy Regulates Cholesterol Efflux from Macrophage Foam Cells via Lysosomal Acid Lipase Mireille Ouimet, 1 Vivian Franklin, 1 Esther Mak, 1 Xianghai Liao, 2 Ira Tabas, 2,3,4 and Yves L. Marcel
Liver. LDL LDL Bad Cholesterol. α HDL transports Excess Cholesterol to the liver. αhdl. Modification LCA T A-I
HDL Therapy Via Plasmapheresis A First-In-Man, Randomized, Placebo-Controlled Study to Evaluate the Safety and Feasibility of Autologous Delipidated HDL Plasma Infusions in Patients with Acute Coronary
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
Hepatic Inflammation and Cellular Therapy
Hepatic Inflammation and Cellular Therapy Lee K. Landeen, Jessica Van Allen, Patricia W. Bedard Vital Therapies, Inc., San Diego, CA, USA Alcoholic Hepatitis: Role of Inflammation Inflammatory Mediators
Best Lipid Treatments
Best Lipid Treatments Pam R. Taub MD, FACC Director of Step Family Cardiac Rehabilitation and Wellness Center Associate Professor of Medicine UC San Diego Health System Overview of Talk Review of pathogenesis
DOWNLOAD PDF A DISTINCT ROLE FOR B1B LYMPHOCYTES IN T CELL-INDEPENDENT IMMUNITY
Chapter 1 : CiteSeerX â 1 A distinct role for B1b lymphocytes in T cell-independent immunity 4/10/08 1 A distinct role for B1b lymphocytes in T cell-independent immunity Kishore R. Alugupalli Department
CIC Edizioni Internazionali. Cardio-metabolic comorbidities in rheumatoid arthritis and SLE. Review. 120 Clinical Dermatology 2013; 1 (2):
Review Cardio-metabolic comorbidities in rheumatoid arthritis and SLE Andrea Doria Division of Rheumatology University of Padua, Italy Address for correspondence: Division of Rheumatology University of
Quantification of sterol-specific response in human macrophages using automated imaged-based analysis
Gater et al. Lipids in Health and Disease (2017) 16:242 DOI 10.1186/s12944-017-0629-9 RESEARCH Quantification of sterol-specific response in human macrophages using automated imaged-based analysis Deborah
Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
![Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.](/thumbs/90/103696086.jpg "Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.")
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina
Review Article Diverse Roles of Macrophages in Atherosclerosis: From Inflammatory Biology to Biomarker Discovery
Mediators of Inflammation Volume 2012, Article ID 693083, 14 pages doi:10.1155/2012/693083 Review Article Diverse Roles of Macrophages in Atherosclerosis: From Inflammatory Biology to Biomarker Discovery
Supplemental Figure 1. Loss of Cdkn2b promotes atherosclerosis in both genders and at serial timepoints. Loss of Cdkn2b also increases growth of the
Supplemental Figure. Loss of Cdkn2b promotes atherosclerosis in both genders and at serial timepoints. Loss of Cdkn2b also increases growth of the necrotic core and increases early apoptosis. (A) Relative