3-Thia Fatty Acids A New Generation of Functional Lipids?
|
|
- Kristopher Ferguson
- 5 years ago
- Views:
Transcription
1 Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no
2 Fatty acids- Essential cellular metabolites Concentrations must be closely regulated. Linked to a variety of diseases (CD, hyperlipidemia, obestiy insulin resistance) Sensors: - precise control of FFA - respond to changes in the available level of FA metabolites
3 Transport of energy in the form of fatty acids
4 Transport of energy in the form of fatty acids
5 Life-style related diseases Smoking Physical inactivity Insulin resistance Type II diabetes Obesity Metabolic syndrome Diet - saturated fatty acids Hypertension Hyperlipidemia
6 Study design 13 middle-aged women in each study group Group I Diet A Fish oil enriched salmon 75g/week for 8 weeks 5 servings per week ~5 g EPA+DHA per serving Group I Diet B Plant oil enriched salmon 75g/week for 8 weeks 5 servings per week ~1.6 g EPA+DHA per serving Group II Diet B Plant oil enriched salmon 75g/week for 8 weeks 5 servings per week ~1.6 g EPA+DHA per serving Period I 8 weeks Wash out 5 weeks Group II Diet A Fish oil enriched salmon 75g/week for 8 weeks 5 servings per week ~5 g EPA+DHA per serving Period II 8 weeks
7 Fatty acid composition in feed and fish muscle Percentage of totoal fatty acids Fish oil enriched Feed Salmon muscle Plant oil enriched Feed Salmon muscle 5 18:1 n-9 18:2 n-6 2:5 n-3 22:6 n-3
8 Changes in fatty acid composition of plasma VLDL 8 7 Period 1 Period 2 Period 1 Period 2 Percent of total fatty acids :5n-3 22:6n-3 Day Fish oil Day 53 Fish oil Day Plant oil Day 53 Plant oil
9 Both diets decrease plasma triacylglycerol levels 2, 1,8 1,6 1,4 mmol/l 1,2 1,,8,6,4,2, I - Day I - Day 53 II - Day II - Day 53 Significantly different from I - Day
10 Improved LDL/HDL cholesterol ratio 4, 3,5 Plasma HDL 3, mmol/l 2,5 2, 1,5 1,,5, I - Day I - Day 53 II - Day II - Day 53 6, 5, 4, Ratio 3, 2, 1,, I - Day I - Day 53 II - Day II - Day 53 Significantly different from II - Day
11 Plasma insulin C-peptide is decreased nmol/l 2,25 2, 1,75 1,5 1,25 1,,75,5,25, I - Day I - Day 53 II - Day II - Day 53 Significantly different from day
12 Glucose tolerance 1, 9, 8, 7, mmol/l 6, 5, 4, 3, 2, 1,, I - Day I - Day 53 II - Day II - Day 53 Significantly different from Day
13 Lipid peroxides formed in vitro 7 6 mmol LPO/mol TAG I - Day I - Day 53 II - Day II - Day 53 Significantly different from Day
14 TTA (tetradecylthioacetic acid) - Can not be β-oxidized Palmitic acid TTA
15 TTA reduces plasma lipid levels in rats, rabbits and dogs 15 Tg Chol HDL/LDL % 1 5 Control TTA
16 TTA increases FFA flux from peripheral tissue to the liver PPARα L-FABP mrna 2 1 mrna 4 2 mrna 4 2 FATP Chow High fat - TTA High fat + TTA
17
18 HEPATOCYTE + - TTA PPARα TTA-CoA FFA PL TG Mitochondrial proliferation
19 Reduction in body weight gain 51 Vekt rotter O-1 O-2 L-3 L-4 T mai 17. mai 21. mai 24. mai 28. mai 31. mai 5. juni 7. juni 11. juni 14. juni 18. juni 21. juni 25. juni 28. juni 2. juli 5. juli 9. juli Vekt (gram) T-6 Dato for veiing Patent 3 TTA/TSA for treatment/prevention of obesity, hypertension and fatty liver.
20 Omega Lard TTA
21 Plasma lipid levels in Wistar rats 35 3 Plasma FFS (%) Standard chow diet High fat diet - TTA + TTA
22 TTA prevent the increase in adipose tissue mass 1.5 Epididymal adipose tissue Retroperitoneal adipose tissue % adipose tissue per body weight 1.5 Chow High fat - TTA High fat + TTA
23 Effect of TTA on blood parameters of glucose homeostasis in 5 weeks (A and B) and 4 month old (C and D) Zucker (fa/fa) rats Serum insulin mu/ ( ml) Control A TTA Serum glucose (g/ l) Control B TTA Serum insulin mu/ ( ml) Control C TTA Serum glucose (g/ l) Control D TTA
24 TTA treatment prevents high fat dietinduced hyperinsulinemia in Wistar rats Insulin (mu/ml) Standard chow diet -TTA + TTA High fat diet
25 Effect of TTA on insulin sensitivity in 5 weeks old Zucker (fa/fa) rats IVGTT Glucose (g / l) Insulin (mu/ml) Time (min) A B Insulin AUC: Glucose AUC: Control 739 ± 1796 Control 21.2 ± 2.4 TTA 3575 ± 856 TTA 19.5 ± 4.3
26 An euglycemic hyperinsulinemic clamp study. TTA treatment prevents high fat-induced insulin resistance in rats. Glucose infusion rate (mg/kg/ min) Standard chow diet -TTA + TTA High fat diet
27 Activation of PPARs with TTA: PPARα>PPARδ>>PPARγ fold induction TTA (µm) Wy (µm) Gal4-mPPARα 1 Gal4-mPPARδ TTA (µm) L (µm) 1. 2 Gal4-mPPARγ TTA (µm) BRL (µm) 1.
28 TTA does not alter the expression of PPARγ target genes in adipose tissue mrna (%) PEPCK GLUT-4 Leptin Lipoprotein lipase Control TTA
29 TTA increases hepatic mitochondrial fatty acid oxidation fold increase 4 2 Fatty acid oxidation fold increase 4 2 CPT I P-CoA P-L-carnitine Activity mrna Control TTA fold increase 4 2 CPT II Activity mrna
30 Expression of PPARα target genes - increased ketone bodies formation Zucker rats HMG-CoA synthase % 2 1 Control TTA activity mrna 2 % 1 ketones FFA
31 TTA increases fatty acid oxidation and ketogenesis in primary hepatocytes ctr TTA Fatty acid oxidation Ketogenesis (nmols/h/2 mill cells) (µmols/h/2 mil cells) Substrate: PA EPA DHA PA EPA DHA Grav et al, JBC, 23
32 TTA increases oxygen consumption of primary hepatocytes ctr TTA (ngatoms oxygen/h/2 mill cells) Oxygen uptake Substrate: PA EPA DHA Grav et al, JBC, 23
33 Lowered proton motive force ( p) in liver mitochondria after TTA treatment 25 2 p (mv) Rat treatment: ctr TTA ctr TTA Respiration substrate: Succinate Palmitoyl-L-carnitine Grav et al, JBC, 23
34 TTA lowers Ψ but not ph 14 ψ (mv) 59 ph (mv) Rat treatment: ctr TTA ctr TTA Respiration substrate: Succinate Palmitoyl-L-carnitine Grav et al, JBC, 23
35 Induced UCP-2 expression in rat hepatocytes UCP-2 mrna, relative to control Liver Primary hepatocytes Purified hepatocytes control TTA 15 TTA 3 control TTA control TTA UCP-2 protein ctr Fish-oil TTA 33 kd Grav et al, JBC, 23
36 PPARα dependent and independent induction of UCP-2 7. Wild type UCP-2 mrna, relative to control PPARα deficient. Control Fish-oil TTA Fibrate Grav et al, JBC, 23
37 Transport of energy in the form of fatty acids
38 TTA treatment increases insulin-stimulated glucose uptake in skeletal muscle in 5 weeks old Zucker (fa/fa) rats c Glucose uptake (mmol/kg dw/ 3 min) a a b Control TTA Control TTA Basal Insulin
39 TTA modulates gene expression of apo C-III 1 % 5 Control TTA
40 Interorgan transport of fatty acids under TTA administration Adipose tissue CM FFA Gut VLDL Liver Muscle TTA facilitates transport of CM and VLDL to liver
41 GW 9578 a highly specific PPARα ligand Insulin mrna CD36 mrna CD36 % Plasma Liver Adipose Tissue Control GW 9578
42 Fish and soy protein decrease plasma cholesterol in rats 7, 6, mmol/l 5, 4, 3, 2, 1,, FPH Soy Casein
43
44 The effect of protein and TTA on the activity of a PPAR-α target gene 14 Acyl-CoA oxidase activity nmol/min/mg protein Protein TTA TTA + Protein Combination of protein and TTA also seem to affect the plasma Tg and cholesterol.
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationLipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals
Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationCornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationMedical Biochemistry and Molecular Biology department
Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationFacts on Fats. Ronald P. Mensink
Facts on Fats Ronald P. Mensink Department of Human Biology NUTRIM, School for Nutrition, Toxicology and Metabolism Maastricht University Maastricht The Netherlands Outline of the Presentation Saturated
More informationANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD
ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed
More informationImplications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss
GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationIntermediary metabolism. Eva Samcová
Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More information298 Biomed Environ Sci, 2015; 28(4):
298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK
More informationFatty Acid and Triacylglycerol Metabolism 1
Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure
More informationFatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation
Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationThe health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences
The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationDiosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationEnergy metabolism - the overview
Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationMetabolic integration and Regulation
Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationEffect of fish oil on metabolism in terrestrial animals. Geert Janssens
Effect of fish oil on metabolism in terrestrial animals Geert Janssens Meeting UGent R & D Aquaculture Consortium 12 Juni 2008 organigram Laboratory of Animal Nutrition Department of Nutrition, Genetics
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationNYSE AMER: MTNB. MAT9001 OVERVIEW. September 2018
NYSE AMER: MTNB www.matinasbiopharma.com MAT9001 OVERVIEW September 2018 1 Forward Looking Statement This presentation contains "forward-looking statements" within the meaning of the Private Securities
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationBiosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids
Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
More informationPlacental Transport in Pathologic Pregnancies
Note: for non-commercial purposes only Placental Transport in Pathologic Pregnancies Gernot Desoye Clinic of Obstetrics and Gynaecology Medical University, Graz Most Common Pregnancy Pathologies Diabetes
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationObjectives By the end of lecture the student should:
Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.
More informationnumber Done by Corrected by Doctor F. Al-Khateeb
number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationLipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationFuture directions for nutritional and therapeutic research in omega-3 3 lipids
Future directions for nutritional and therapeutic research in omega-3 3 lipids Philip Calder Professor of Nutritional Immunology University of Southampton Aim To review dietary sources and intakes of long
More informationINSULIN RESISTANCE: MOLECULAR MECHANISM
INSULIN RESISTANCE: MOLECULAR MECHANISM Ashish K. Saha ABSTRACT Insulin resistance in skeletal muscle is present in humans with type 2 diabetes (non-insulin dependent diabetes mellitus) and obesity and
More informationTHE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals
Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle
More informationThe effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses
The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationBALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR
The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly
More informationFats, Cholesterol, and Hormones
Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols
More informationBio 366: Biological Chemistry II Test #1, 100 points (7 pages)
Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the
More informationLipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies
Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationSupplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and
Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationIntegration & Hormone Regulation
Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationMain physiological functions of mitochondria
Main physiological functions of mitochondria Energy conservation =ATP production Thermoregulatory = energy dissipation as heat Substrate production & decomposition Reactive oxygen species (ROS) Skulachev(1998)
More informationCHY2026: General Biochemistry. Lipid Metabolism
CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)
More informationNOTES. Developed by Fabio Comana, MA., MS., All rights Reserved Page 1
Session 455: Core Essentials in Science Fabio Comana, MA, MS, NASM CPT, CES & PES; ACE CPT & LWMC; ACSM HFS, NSCA CSCS; CISSN National Academy of Sports Medicine fabio.comana@nasm.org NOTES Developed by
More informationMATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS
Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181
More informationLehninger 5 th ed. Chapter 17
Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals
More informationLecture 29: Membrane Transport and metabolism
Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is
More informationCetoleic acid makes pelagic fish more healthy
Cetoleic acid makes pelagic fish more healthy WORKSHOP IN FISHMEAL AND FISH OIL, NOVEMBER 2018 Bente Ruyter Nofima Omega-3 fatty acids and health Eye Brain Cell membrane The marine omega-3 fatty acids
More informationFSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
More informationEffect of Alpha-Linolenic Acid on Global Fatty Oxidation in Adipocytes and Skeletal Muscle Cells
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2011 Effect of Alpha-Linolenic
More informationBIO th November 2002 KEY EXAM III
1 BIO 451 15 th November 2002 KEY EXAM III This exam may be taken apart for grading. Please PRINT your name on each page. If you do not have sufficient room for your answer in the space provided, please
More informationRyuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA. Graduate School of Agriculture, Kyoto Prefectural University, Kyoto ABSTRACT
Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA Graduate School of Agriculture, Kyoto Prefectural University, Kyoto 606-8522 ABSTRACT Recently, a group of lipophilic proteins (LP) associated with lecithin
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationLecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation
Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies
More informationBachelorarbeit Fructose and weight gain
Bachelorarbeit Fructose and weight gain Bogner-Strauß, Juliane Gertrude, Assoc.Prof. Mag.rer.nat. Dr.rer.nat. Von Johanna Maria Ticar Mat: 0730208 Graz, 27.07.2011 Abstract The prevalence of obesity is
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationHormones and Target Tissues
Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationRole of the Pyruvate
Role of the Pyruvate Dehydrogenase Complex in the Regulation of Blood Glucose Robert A. Harris Indiana University School of Medicine Indianapolis, Indiana Kyungpook National University School of Medicine
More information23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in
Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationResveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
More informationSTRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty
STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But
More informationPutting Science to Work. Heptox Virtual Liver Platform
Putting Science to Work A report on TAK-875 analysis using the Heptox Virtual Liver Platform Compound MW TAK 875 524.625 EXECUTIVE SUMMARY Simulated exposures based on average drug plasma concentration
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More information