3-Thia Fatty Acids A New Generation of Functional Lipids?

Size: px
Start display at page:

Download "3-Thia Fatty Acids A New Generation of Functional Lipids?"

Transcription

1 Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no

2 Fatty acids- Essential cellular metabolites Concentrations must be closely regulated. Linked to a variety of diseases (CD, hyperlipidemia, obestiy insulin resistance) Sensors: - precise control of FFA - respond to changes in the available level of FA metabolites

3 Transport of energy in the form of fatty acids

4 Transport of energy in the form of fatty acids

5 Life-style related diseases Smoking Physical inactivity Insulin resistance Type II diabetes Obesity Metabolic syndrome Diet - saturated fatty acids Hypertension Hyperlipidemia

6 Study design 13 middle-aged women in each study group Group I Diet A Fish oil enriched salmon 75g/week for 8 weeks 5 servings per week ~5 g EPA+DHA per serving Group I Diet B Plant oil enriched salmon 75g/week for 8 weeks 5 servings per week ~1.6 g EPA+DHA per serving Group II Diet B Plant oil enriched salmon 75g/week for 8 weeks 5 servings per week ~1.6 g EPA+DHA per serving Period I 8 weeks Wash out 5 weeks Group II Diet A Fish oil enriched salmon 75g/week for 8 weeks 5 servings per week ~5 g EPA+DHA per serving Period II 8 weeks

7 Fatty acid composition in feed and fish muscle Percentage of totoal fatty acids Fish oil enriched Feed Salmon muscle Plant oil enriched Feed Salmon muscle 5 18:1 n-9 18:2 n-6 2:5 n-3 22:6 n-3

8 Changes in fatty acid composition of plasma VLDL 8 7 Period 1 Period 2 Period 1 Period 2 Percent of total fatty acids :5n-3 22:6n-3 Day Fish oil Day 53 Fish oil Day Plant oil Day 53 Plant oil

9 Both diets decrease plasma triacylglycerol levels 2, 1,8 1,6 1,4 mmol/l 1,2 1,,8,6,4,2, I - Day I - Day 53 II - Day II - Day 53 Significantly different from I - Day

10 Improved LDL/HDL cholesterol ratio 4, 3,5 Plasma HDL 3, mmol/l 2,5 2, 1,5 1,,5, I - Day I - Day 53 II - Day II - Day 53 6, 5, 4, Ratio 3, 2, 1,, I - Day I - Day 53 II - Day II - Day 53 Significantly different from II - Day

11 Plasma insulin C-peptide is decreased nmol/l 2,25 2, 1,75 1,5 1,25 1,,75,5,25, I - Day I - Day 53 II - Day II - Day 53 Significantly different from day

12 Glucose tolerance 1, 9, 8, 7, mmol/l 6, 5, 4, 3, 2, 1,, I - Day I - Day 53 II - Day II - Day 53 Significantly different from Day

13 Lipid peroxides formed in vitro 7 6 mmol LPO/mol TAG I - Day I - Day 53 II - Day II - Day 53 Significantly different from Day

14 TTA (tetradecylthioacetic acid) - Can not be β-oxidized Palmitic acid TTA

15 TTA reduces plasma lipid levels in rats, rabbits and dogs 15 Tg Chol HDL/LDL % 1 5 Control TTA

16 TTA increases FFA flux from peripheral tissue to the liver PPARα L-FABP mrna 2 1 mrna 4 2 mrna 4 2 FATP Chow High fat - TTA High fat + TTA

17

18 HEPATOCYTE + - TTA PPARα TTA-CoA FFA PL TG Mitochondrial proliferation

19 Reduction in body weight gain 51 Vekt rotter O-1 O-2 L-3 L-4 T mai 17. mai 21. mai 24. mai 28. mai 31. mai 5. juni 7. juni 11. juni 14. juni 18. juni 21. juni 25. juni 28. juni 2. juli 5. juli 9. juli Vekt (gram) T-6 Dato for veiing Patent 3 TTA/TSA for treatment/prevention of obesity, hypertension and fatty liver.

20 Omega Lard TTA

21 Plasma lipid levels in Wistar rats 35 3 Plasma FFS (%) Standard chow diet High fat diet - TTA + TTA

22 TTA prevent the increase in adipose tissue mass 1.5 Epididymal adipose tissue Retroperitoneal adipose tissue % adipose tissue per body weight 1.5 Chow High fat - TTA High fat + TTA

23 Effect of TTA on blood parameters of glucose homeostasis in 5 weeks (A and B) and 4 month old (C and D) Zucker (fa/fa) rats Serum insulin mu/ ( ml) Control A TTA Serum glucose (g/ l) Control B TTA Serum insulin mu/ ( ml) Control C TTA Serum glucose (g/ l) Control D TTA

24 TTA treatment prevents high fat dietinduced hyperinsulinemia in Wistar rats Insulin (mu/ml) Standard chow diet -TTA + TTA High fat diet

25 Effect of TTA on insulin sensitivity in 5 weeks old Zucker (fa/fa) rats IVGTT Glucose (g / l) Insulin (mu/ml) Time (min) A B Insulin AUC: Glucose AUC: Control 739 ± 1796 Control 21.2 ± 2.4 TTA 3575 ± 856 TTA 19.5 ± 4.3

26 An euglycemic hyperinsulinemic clamp study. TTA treatment prevents high fat-induced insulin resistance in rats. Glucose infusion rate (mg/kg/ min) Standard chow diet -TTA + TTA High fat diet

27 Activation of PPARs with TTA: PPARα>PPARδ>>PPARγ fold induction TTA (µm) Wy (µm) Gal4-mPPARα 1 Gal4-mPPARδ TTA (µm) L (µm) 1. 2 Gal4-mPPARγ TTA (µm) BRL (µm) 1.

28 TTA does not alter the expression of PPARγ target genes in adipose tissue mrna (%) PEPCK GLUT-4 Leptin Lipoprotein lipase Control TTA

29 TTA increases hepatic mitochondrial fatty acid oxidation fold increase 4 2 Fatty acid oxidation fold increase 4 2 CPT I P-CoA P-L-carnitine Activity mrna Control TTA fold increase 4 2 CPT II Activity mrna

30 Expression of PPARα target genes - increased ketone bodies formation Zucker rats HMG-CoA synthase % 2 1 Control TTA activity mrna 2 % 1 ketones FFA

31 TTA increases fatty acid oxidation and ketogenesis in primary hepatocytes ctr TTA Fatty acid oxidation Ketogenesis (nmols/h/2 mill cells) (µmols/h/2 mil cells) Substrate: PA EPA DHA PA EPA DHA Grav et al, JBC, 23

32 TTA increases oxygen consumption of primary hepatocytes ctr TTA (ngatoms oxygen/h/2 mill cells) Oxygen uptake Substrate: PA EPA DHA Grav et al, JBC, 23

33 Lowered proton motive force ( p) in liver mitochondria after TTA treatment 25 2 p (mv) Rat treatment: ctr TTA ctr TTA Respiration substrate: Succinate Palmitoyl-L-carnitine Grav et al, JBC, 23

34 TTA lowers Ψ but not ph 14 ψ (mv) 59 ph (mv) Rat treatment: ctr TTA ctr TTA Respiration substrate: Succinate Palmitoyl-L-carnitine Grav et al, JBC, 23

35 Induced UCP-2 expression in rat hepatocytes UCP-2 mrna, relative to control Liver Primary hepatocytes Purified hepatocytes control TTA 15 TTA 3 control TTA control TTA UCP-2 protein ctr Fish-oil TTA 33 kd Grav et al, JBC, 23

36 PPARα dependent and independent induction of UCP-2 7. Wild type UCP-2 mrna, relative to control PPARα deficient. Control Fish-oil TTA Fibrate Grav et al, JBC, 23

37 Transport of energy in the form of fatty acids

38 TTA treatment increases insulin-stimulated glucose uptake in skeletal muscle in 5 weeks old Zucker (fa/fa) rats c Glucose uptake (mmol/kg dw/ 3 min) a a b Control TTA Control TTA Basal Insulin

39 TTA modulates gene expression of apo C-III 1 % 5 Control TTA

40 Interorgan transport of fatty acids under TTA administration Adipose tissue CM FFA Gut VLDL Liver Muscle TTA facilitates transport of CM and VLDL to liver

41 GW 9578 a highly specific PPARα ligand Insulin mrna CD36 mrna CD36 % Plasma Liver Adipose Tissue Control GW 9578

42 Fish and soy protein decrease plasma cholesterol in rats 7, 6, mmol/l 5, 4, 3, 2, 1,, FPH Soy Casein

43

44 The effect of protein and TTA on the activity of a PPAR-α target gene 14 Acyl-CoA oxidase activity nmol/min/mg protein Protein TTA TTA + Protein Combination of protein and TTA also seem to affect the plasma Tg and cholesterol.

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

LIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013

Metabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013 Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure

More information

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals

Lipid Metabolism. Remember fats?? Triacylglycerols - major form of energy storage in animals Remember fats?? Triacylglycerols - major form of energy storage in animals Your energy reserves: ~0.5% carbs (glycogen + glucose) ~15% protein (muscle, last resort) ~85% fat Why use fat for energy? 1 gram

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Metabolism of acylglycerols and sphingolipids. Martina Srbová

Metabolism of acylglycerols and sphingolipids. Martina Srbová Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins

More information

Antihyperlipidemic Drugs

Antihyperlipidemic Drugs Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types

More information

Integrative Metabolism: Significance

Integrative Metabolism: Significance Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell

More information

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze

AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Medical Biochemistry and Molecular Biology department

Medical Biochemistry and Molecular Biology department Medical Biochemistry and Molecular Biology department Cardiac Fuels [Sources of energy for the Cardiac muscle] Intended learning outcomes of the lecture: By the end of this lecture you would be able to:-

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

PPAR history of research

PPAR history of research PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,

More information

Facts on Fats. Ronald P. Mensink

Facts on Fats. Ronald P. Mensink Facts on Fats Ronald P. Mensink Department of Human Biology NUTRIM, School for Nutrition, Toxicology and Metabolism Maastricht University Maastricht The Netherlands Outline of the Presentation Saturated

More information

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD

ANTIHYPERLIPIDEMIA. Darmawan,dr.,M.Kes,Sp.PD ANTIHYPERLIPIDEMIA Darmawan,dr.,M.Kes,Sp.PD Plasma lipids consist mostly of lipoproteins Spherical complexes of lipids and specific proteins (apolipoproteins). The clinically important lipoproteins, listed

More information

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction

More information

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel

Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the

More information

Intermediary metabolism. Eva Samcová

Intermediary metabolism. Eva Samcová Intermediary metabolism Eva Samcová Metabolic roles of tissues Four major tissues play a dominant role in fuel metabolism : liver, adipose, muscle, and brain. These tissues do not function in isolation.

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

AMPK. Tomáš Kučera.

AMPK. Tomáš Kučera. AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

298 Biomed Environ Sci, 2015; 28(4):

298 Biomed Environ Sci, 2015; 28(4): 298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK

More information

Fatty Acid and Triacylglycerol Metabolism 1

Fatty Acid and Triacylglycerol Metabolism 1 Fatty Acid and Triacylglycerol Metabolism 1 Mobilization of stored fats and oxidation of fatty acids Lippincott s Chapter 16 What is the first lecture about What is triacylglycerol Fatty acids structure

More information

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation

Fatty Acid Degradation. Catabolism Overview. TAG and FA 11/11/2015. Chapter 27, Stryer Short Course. Lipids as a fuel source diet Beta oxidation Fatty Acid Degradation Chapter 27, Stryer Short Course Catabolism verview Lipids as a fuel source diet Beta oxidation saturated Unsaturated dd chain Ketone bodies as fuel Physiology High energy More reduced

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23

Diosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23 Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity

More information

Zuhier Awan, MD, PhD, FRCPC

Zuhier Awan, MD, PhD, FRCPC Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

Energy metabolism - the overview

Energy metabolism - the overview Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Metabolic integration and Regulation

Metabolic integration and Regulation Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Lipid Metabolism. Catabolism Overview

Lipid Metabolism. Catabolism Overview Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water

More information

Effect of fish oil on metabolism in terrestrial animals. Geert Janssens

Effect of fish oil on metabolism in terrestrial animals. Geert Janssens Effect of fish oil on metabolism in terrestrial animals Geert Janssens Meeting UGent R & D Aquaculture Consortium 12 Juni 2008 organigram Laboratory of Animal Nutrition Department of Nutrition, Genetics

More information

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

More information

NYSE AMER: MTNB. MAT9001 OVERVIEW. September 2018

NYSE AMER: MTNB.   MAT9001 OVERVIEW. September 2018 NYSE AMER: MTNB www.matinasbiopharma.com MAT9001 OVERVIEW September 2018 1 Forward Looking Statement This presentation contains "forward-looking statements" within the meaning of the Private Securities

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Biosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids

Biosynthesis of Triacylglycerides (TG) in liver. Mobilization of stored fat and oxidation of fatty acids Biosynthesis of Triacylglycerides (TG) in liver Mobilization of stored fat and oxidation of fatty acids Activation of hormone sensitive lipase This enzyme is activated when phosphorylated (3,5 cyclic AMPdependent

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile

More information

Placental Transport in Pathologic Pregnancies

Placental Transport in Pathologic Pregnancies Note: for non-commercial purposes only Placental Transport in Pathologic Pregnancies Gernot Desoye Clinic of Obstetrics and Gynaecology Medical University, Graz Most Common Pregnancy Pathologies Diabetes

More information

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids: CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation

More information

Objectives By the end of lecture the student should:

Objectives By the end of lecture the student should: Objectives By the end of lecture the student should: Discuss β oxidation of fatty acids. Illustrate α oxidation of fatty acids. Understand ω oxidation of fatty acids. List sources and fates of active acetate.

More information

number Done by Corrected by Doctor F. Al-Khateeb

number Done by Corrected by Doctor F. Al-Khateeb number 23 Done by A. Rawajbeh Corrected by Doctor F. Al-Khateeb Ketone bodies Ketone bodies are used by the peripheral tissues like the skeletal and cardiac muscles, where they are the preferred source

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Lipoprotein Particle Profile

Lipoprotein Particle Profile Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular

More information

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

More information

Future directions for nutritional and therapeutic research in omega-3 3 lipids

Future directions for nutritional and therapeutic research in omega-3 3 lipids Future directions for nutritional and therapeutic research in omega-3 3 lipids Philip Calder Professor of Nutritional Immunology University of Southampton Aim To review dietary sources and intakes of long

More information

INSULIN RESISTANCE: MOLECULAR MECHANISM

INSULIN RESISTANCE: MOLECULAR MECHANISM INSULIN RESISTANCE: MOLECULAR MECHANISM Ashish K. Saha ABSTRACT Insulin resistance in skeletal muscle is present in humans with type 2 diabetes (non-insulin dependent diabetes mellitus) and obesity and

More information

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals

THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals Br. J. Anaesth. (1981), 53, 131 THE GLUCOSE-FATTY ACID-KETONE BODY CYCLE Role of ketone bodies as respiratory substrates and metabolic signals J. C. STANLEY In this paper, the glucose-fatty acid cycle

More information

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR

BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR The West London Medical Journal 2010 Vol 2 No 4 pp 29-35 BALANCING THE SCALES USING A NOVEL CELLULAR ENERGY SENSOR Sairah Akbar The topic of obesity is rarely out of the public eye with an increasingly

More information

Fats, Cholesterol, and Hormones

Fats, Cholesterol, and Hormones Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols

More information

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages)

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the

More information

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies

Lipid metabolism. Degradation and biosynthesis of fatty acids Ketone bodies Lipid metabolism Degradation and biosynthesis of fatty acids Ketone bodies Fatty acids (FA) primary fuel molecules in the fat category main use is for long-term energy storage high level of energy storage:

More information

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes

Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the

More information

Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and

Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and Supplemental Figure 1. Plasma free fatty acid (FFA) (A), plasma glucose levels (B) and plasma insulin levels (C) during the 48 h infusion period before the two-step hyperglycemic clamp in diabetes-prone

More information

Nature Medicine: doi: /nm.3891

Nature Medicine: doi: /nm.3891 Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,

More information

Integration & Hormone Regulation

Integration & Hormone Regulation Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Main physiological functions of mitochondria

Main physiological functions of mitochondria Main physiological functions of mitochondria Energy conservation =ATP production Thermoregulatory = energy dissipation as heat Substrate production & decomposition Reactive oxygen species (ROS) Skulachev(1998)

More information

CHY2026: General Biochemistry. Lipid Metabolism

CHY2026: General Biochemistry. Lipid Metabolism CHY2026: General Biochemistry Lipid Metabolism Lipid Digestion Lipid Metabolism Fats (triglycerides) are high metabolic energy molecules Fats yield 9.3 kcal of energy (carbohydrates and proteins 4.1 kcal)

More information

NOTES. Developed by Fabio Comana, MA., MS., All rights Reserved Page 1

NOTES. Developed by Fabio Comana, MA., MS., All rights Reserved Page 1 Session 455: Core Essentials in Science Fabio Comana, MA, MS, NASM CPT, CES & PES; ACE CPT & LWMC; ACSM HFS, NSCA CSCS; CISSN National Academy of Sports Medicine fabio.comana@nasm.org NOTES Developed by

More information

MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS

MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181

More information

Lehninger 5 th ed. Chapter 17

Lehninger 5 th ed. Chapter 17 Lehninger 5 th ed. Chapter 17 December 26, 2010 Prof. Shimon Schuldiner Email: Shimon.Schuldiner@huji.ac.il Phone: 6585992 CHAPTER 17 Fatty Acid Catabolism Key topics: How fats are digested in animals

More information

Lecture 29: Membrane Transport and metabolism

Lecture 29: Membrane Transport and metabolism Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is

More information

Cetoleic acid makes pelagic fish more healthy

Cetoleic acid makes pelagic fish more healthy Cetoleic acid makes pelagic fish more healthy WORKSHOP IN FISHMEAL AND FISH OIL, NOVEMBER 2018 Bente Ruyter Nofima Omega-3 fatty acids and health Eye Brain Cell membrane The marine omega-3 fatty acids

More information

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets

FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu

More information

Effect of Alpha-Linolenic Acid on Global Fatty Oxidation in Adipocytes and Skeletal Muscle Cells

Effect of Alpha-Linolenic Acid on Global Fatty Oxidation in Adipocytes and Skeletal Muscle Cells University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange University of Tennessee Honors Thesis Projects University of Tennessee Honors Program 5-2011 Effect of Alpha-Linolenic

More information

BIO th November 2002 KEY EXAM III

BIO th November 2002 KEY EXAM III 1 BIO 451 15 th November 2002 KEY EXAM III This exam may be taken apart for grading. Please PRINT your name on each page. If you do not have sufficient room for your answer in the space provided, please

More information

Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA. Graduate School of Agriculture, Kyoto Prefectural University, Kyoto ABSTRACT

Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA. Graduate School of Agriculture, Kyoto Prefectural University, Kyoto ABSTRACT Ryuhei KANAMOTO, Shinya KIMURA and Gaku OKAMURA Graduate School of Agriculture, Kyoto Prefectural University, Kyoto 606-8522 ABSTRACT Recently, a group of lipophilic proteins (LP) associated with lecithin

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Lecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation

Lecture 36. Key Concepts. Overview of lipid metabolism. Reactions of fatty acid oxidation. Energy yield from fatty acid oxidation Lecture 36 Lipid Metabolism 1 Fatty Acid Oxidation Ketone Bodies Key Concepts Overview of lipid metabolism Reactions of fatty acid oxidation Energy yield from fatty acid oxidation Formation of ketone bodies

More information

Bachelorarbeit Fructose and weight gain

Bachelorarbeit Fructose and weight gain Bachelorarbeit Fructose and weight gain Bogner-Strauß, Juliane Gertrude, Assoc.Prof. Mag.rer.nat. Dr.rer.nat. Von Johanna Maria Ticar Mat: 0730208 Graz, 27.07.2011 Abstract The prevalence of obesity is

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Hormones and Target Tissues

Hormones and Target Tissues Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Role of the Pyruvate

Role of the Pyruvate Role of the Pyruvate Dehydrogenase Complex in the Regulation of Blood Glucose Robert A. Harris Indiana University School of Medicine Indianapolis, Indiana Kyungpook National University School of Medicine

More information

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in

23.1 Lipid Metabolism in Animals. Chapter 23. Micelles Lipid Metabolism in. Animals. Overview of Digestion Lipid Metabolism in Denniston Topping Caret Copyright! The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 23 Fatty Acid Metabolism Triglycerides (Tgl) are emulsified into fat droplets

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network

Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira

More information

STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty

STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS. R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE AND METABOLISM Of LIPIDS AND LIPOPROTEINS R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty STRUCTURE OF LIPIDS AND LIPOPROTEINS DEFINTITION: Compounds Insoluble in water But

More information

Putting Science to Work. Heptox Virtual Liver Platform

Putting Science to Work. Heptox Virtual Liver Platform Putting Science to Work A report on TAK-875 analysis using the Heptox Virtual Liver Platform Compound MW TAK 875 524.625 EXECUTIVE SUMMARY Simulated exposures based on average drug plasma concentration

More information

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information